ID: 1102950571

View in Genome Browser
Species Human (GRCh38)
Location 12:117028155-117028177
Sequence CATCCCTAAACATGGTTATA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102950571_1102950578 7 Left 1102950571 12:117028155-117028177 CCCTATAACCATGTTTAGGGATG 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1102950578 12:117028185-117028207 GTTGGGAGCAAGGAGAAAAATGG 0: 1
1: 0
2: 3
3: 54
4: 576
1102950571_1102950579 8 Left 1102950571 12:117028155-117028177 CCCTATAACCATGTTTAGGGATG 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1102950579 12:117028186-117028208 TTGGGAGCAAGGAGAAAAATGGG 0: 1
1: 0
2: 4
3: 40
4: 509
1102950571_1102950575 -10 Left 1102950571 12:117028155-117028177 CCCTATAACCATGTTTAGGGATG 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1102950575 12:117028168-117028190 TTTAGGGATGTGCCTCAGTTGGG 0: 1
1: 0
2: 1
3: 14
4: 130
1102950571_1102950576 -3 Left 1102950571 12:117028155-117028177 CCCTATAACCATGTTTAGGGATG 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1102950576 12:117028175-117028197 ATGTGCCTCAGTTGGGAGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102950571 Original CRISPR CATCCCTAAACATGGTTATA GGG (reversed) Exonic