ID: 1102950572

View in Genome Browser
Species Human (GRCh38)
Location 12:117028156-117028178
Sequence ACATCCCTAAACATGGTTAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102950572_1102950576 -4 Left 1102950572 12:117028156-117028178 CCTATAACCATGTTTAGGGATGT 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1102950576 12:117028175-117028197 ATGTGCCTCAGTTGGGAGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 186
1102950572_1102950579 7 Left 1102950572 12:117028156-117028178 CCTATAACCATGTTTAGGGATGT 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1102950579 12:117028186-117028208 TTGGGAGCAAGGAGAAAAATGGG 0: 1
1: 0
2: 4
3: 40
4: 509
1102950572_1102950578 6 Left 1102950572 12:117028156-117028178 CCTATAACCATGTTTAGGGATGT 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1102950578 12:117028185-117028207 GTTGGGAGCAAGGAGAAAAATGG 0: 1
1: 0
2: 3
3: 54
4: 576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102950572 Original CRISPR ACATCCCTAAACATGGTTAT AGG (reversed) Exonic