ID: 1102950574

View in Genome Browser
Species Human (GRCh38)
Location 12:117028167-117028189
Sequence GTTTAGGGATGTGCCTCAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102950564_1102950574 27 Left 1102950564 12:117028117-117028139 CCATGGCCACTCACTACTACGAC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1102950574 12:117028167-117028189 GTTTAGGGATGTGCCTCAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 86
1102950565_1102950574 21 Left 1102950565 12:117028123-117028145 CCACTCACTACTACGACCTCGCA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1102950574 12:117028167-117028189 GTTTAGGGATGTGCCTCAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 86
1102950567_1102950574 5 Left 1102950567 12:117028139-117028161 CCTCGCACTGGCCTTTCCCTATA 0: 1
1: 0
2: 2
3: 6
4: 142
Right 1102950574 12:117028167-117028189 GTTTAGGGATGTGCCTCAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 86
1102950568_1102950574 -6 Left 1102950568 12:117028150-117028172 CCTTTCCCTATAACCATGTTTAG 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1102950574 12:117028167-117028189 GTTTAGGGATGTGCCTCAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102950574 Original CRISPR GTTTAGGGATGTGCCTCAGT TGG Exonic