ID: 1102950576

View in Genome Browser
Species Human (GRCh38)
Location 12:117028175-117028197
Sequence ATGTGCCTCAGTTGGGAGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102950568_1102950576 2 Left 1102950568 12:117028150-117028172 CCTTTCCCTATAACCATGTTTAG 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1102950576 12:117028175-117028197 ATGTGCCTCAGTTGGGAGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 186
1102950565_1102950576 29 Left 1102950565 12:117028123-117028145 CCACTCACTACTACGACCTCGCA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1102950576 12:117028175-117028197 ATGTGCCTCAGTTGGGAGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 186
1102950567_1102950576 13 Left 1102950567 12:117028139-117028161 CCTCGCACTGGCCTTTCCCTATA 0: 1
1: 0
2: 2
3: 6
4: 142
Right 1102950576 12:117028175-117028197 ATGTGCCTCAGTTGGGAGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 186
1102950571_1102950576 -3 Left 1102950571 12:117028155-117028177 CCCTATAACCATGTTTAGGGATG 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1102950576 12:117028175-117028197 ATGTGCCTCAGTTGGGAGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 186
1102950572_1102950576 -4 Left 1102950572 12:117028156-117028178 CCTATAACCATGTTTAGGGATGT 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1102950576 12:117028175-117028197 ATGTGCCTCAGTTGGGAGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102950576 Original CRISPR ATGTGCCTCAGTTGGGAGCA AGG Exonic