ID: 1102950578

View in Genome Browser
Species Human (GRCh38)
Location 12:117028185-117028207
Sequence GTTGGGAGCAAGGAGAAAAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 576}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102950568_1102950578 12 Left 1102950568 12:117028150-117028172 CCTTTCCCTATAACCATGTTTAG 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1102950578 12:117028185-117028207 GTTGGGAGCAAGGAGAAAAATGG 0: 1
1: 0
2: 3
3: 54
4: 576
1102950572_1102950578 6 Left 1102950572 12:117028156-117028178 CCTATAACCATGTTTAGGGATGT 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1102950578 12:117028185-117028207 GTTGGGAGCAAGGAGAAAAATGG 0: 1
1: 0
2: 3
3: 54
4: 576
1102950573_1102950578 -1 Left 1102950573 12:117028163-117028185 CCATGTTTAGGGATGTGCCTCAG 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1102950578 12:117028185-117028207 GTTGGGAGCAAGGAGAAAAATGG 0: 1
1: 0
2: 3
3: 54
4: 576
1102950571_1102950578 7 Left 1102950571 12:117028155-117028177 CCCTATAACCATGTTTAGGGATG 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1102950578 12:117028185-117028207 GTTGGGAGCAAGGAGAAAAATGG 0: 1
1: 0
2: 3
3: 54
4: 576
1102950567_1102950578 23 Left 1102950567 12:117028139-117028161 CCTCGCACTGGCCTTTCCCTATA 0: 1
1: 0
2: 2
3: 6
4: 142
Right 1102950578 12:117028185-117028207 GTTGGGAGCAAGGAGAAAAATGG 0: 1
1: 0
2: 3
3: 54
4: 576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102950578 Original CRISPR GTTGGGAGCAAGGAGAAAAA TGG Exonic