ID: 1102950579

View in Genome Browser
Species Human (GRCh38)
Location 12:117028186-117028208
Sequence TTGGGAGCAAGGAGAAAAAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 509}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102950571_1102950579 8 Left 1102950571 12:117028155-117028177 CCCTATAACCATGTTTAGGGATG 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1102950579 12:117028186-117028208 TTGGGAGCAAGGAGAAAAATGGG 0: 1
1: 0
2: 4
3: 40
4: 509
1102950573_1102950579 0 Left 1102950573 12:117028163-117028185 CCATGTTTAGGGATGTGCCTCAG 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1102950579 12:117028186-117028208 TTGGGAGCAAGGAGAAAAATGGG 0: 1
1: 0
2: 4
3: 40
4: 509
1102950572_1102950579 7 Left 1102950572 12:117028156-117028178 CCTATAACCATGTTTAGGGATGT 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1102950579 12:117028186-117028208 TTGGGAGCAAGGAGAAAAATGGG 0: 1
1: 0
2: 4
3: 40
4: 509
1102950567_1102950579 24 Left 1102950567 12:117028139-117028161 CCTCGCACTGGCCTTTCCCTATA 0: 1
1: 0
2: 2
3: 6
4: 142
Right 1102950579 12:117028186-117028208 TTGGGAGCAAGGAGAAAAATGGG 0: 1
1: 0
2: 4
3: 40
4: 509
1102950568_1102950579 13 Left 1102950568 12:117028150-117028172 CCTTTCCCTATAACCATGTTTAG 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1102950579 12:117028186-117028208 TTGGGAGCAAGGAGAAAAATGGG 0: 1
1: 0
2: 4
3: 40
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102950579 Original CRISPR TTGGGAGCAAGGAGAAAAAT GGG Exonic