ID: 1102951421

View in Genome Browser
Species Human (GRCh38)
Location 12:117033938-117033960
Sequence AACTGCAGGCAGGTGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 438}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102951412_1102951421 15 Left 1102951412 12:117033900-117033922 CCGTTTCCAGCACAGCAGAGTTC 0: 1
1: 0
2: 1
3: 27
4: 220
Right 1102951421 12:117033938-117033960 AACTGCAGGCAGGTGGGGACAGG 0: 1
1: 0
2: 4
3: 41
4: 438
1102951413_1102951421 9 Left 1102951413 12:117033906-117033928 CCAGCACAGCAGAGTTCAGCCGC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1102951421 12:117033938-117033960 AACTGCAGGCAGGTGGGGACAGG 0: 1
1: 0
2: 4
3: 41
4: 438
1102951415_1102951421 -10 Left 1102951415 12:117033925-117033947 CCGCAGCCTCGTTAACTGCAGGC 0: 1
1: 0
2: 2
3: 21
4: 459
Right 1102951421 12:117033938-117033960 AACTGCAGGCAGGTGGGGACAGG 0: 1
1: 0
2: 4
3: 41
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102951421 Original CRISPR AACTGCAGGCAGGTGGGGAC AGG Intergenic
900137495 1:1124560-1124582 AACTGCAGCCCTGTGGGCACAGG + Intergenic
900274201 1:1812883-1812905 ACCTGCAGGCAGGTGTGTTCAGG - Intronic
900411833 1:2516057-2516079 GACTGCAGGGAGGTGGTGATGGG - Intronic
900771428 1:4547829-4547851 ATCTCCAAGCAGGTGGAGACTGG + Intergenic
901215504 1:7552654-7552676 AACTGAAAGCAGGGGAGGACTGG + Intronic
901448018 1:9319860-9319882 ACCTGCAGCCAGGTGGCGACTGG - Intronic
901520972 1:9784719-9784741 CACTGCCAGCAGGTGGTGACAGG + Intronic
901649309 1:10734420-10734442 TACTGTTAGCAGGTGGGGACTGG - Intronic
902073486 1:13762873-13762895 AGCTGCAGGCAGGAGGTGGCTGG + Intronic
902225946 1:14996549-14996571 CACTGCAGGCAGGTGTGGTCAGG - Intronic
902283053 1:15388347-15388369 AACTGCAGGCAGGTGGGGCAGGG - Intronic
902438861 1:16416152-16416174 AAGTGCAGTCACGTGGGTACAGG + Intronic
902631953 1:17710033-17710055 AACTGCAGACAGGTGTAGACGGG + Intergenic
902672622 1:17985287-17985309 AACTGCAGGCTGGAGAGGAGGGG - Intergenic
902939310 1:19788453-19788475 AACTCCAGGTAGGCAGGGACCGG + Intronic
904005600 1:27361626-27361648 ACCTGCAGGCAGTTGGGGAGTGG + Exonic
904259313 1:29279422-29279444 ATTGGCAGGCAGGTGGGCACTGG - Intronic
904295365 1:29516785-29516807 CACTGCAGCCTGGTGGGGGCAGG + Intergenic
904614854 1:31744154-31744176 CCCTGCAGGCAGGTGGGGTGGGG + Intronic
905033458 1:34902681-34902703 AGCAGCAGGCAGGTGGAGAGAGG + Intronic
905271194 1:36788838-36788860 ACCTGCAGGCAAGTGGGGCTGGG + Intergenic
905548244 1:38816948-38816970 AGATGAAGGCAGTTGGGGACTGG - Intergenic
905883850 1:41481283-41481305 TCCCGCAGGCAGGTGGGGATGGG - Intronic
906054556 1:42905064-42905086 AACTGGAAGAAGGTGGGGAGTGG + Intergenic
906284363 1:44576946-44576968 AACTGCAGACAAGTGGGGACAGG + Intronic
907383396 1:54109804-54109826 TACATCAGGCAGGAGGGGACGGG - Intronic
913311900 1:117506925-117506947 AACTGTAGTCAGGTTGGCACTGG - Intronic
917968345 1:180192419-180192441 TACTGCAGGCAGGGGGAGGCAGG + Intronic
919822068 1:201479831-201479853 AAATGCAGGCAGCTGGGTCCAGG - Intergenic
919855405 1:201703078-201703100 ATCTGCAGGCAAATGGGGACGGG - Intronic
920174886 1:204094500-204094522 GACTGCAGGCAGTGGGGGAAGGG + Intronic
920430222 1:205914195-205914217 AACTGCATGCAGATGTGGAAAGG - Exonic
920694175 1:208169229-208169251 AAGGGCAGGCAGGAGGTGACAGG + Intronic
920847624 1:209607094-209607116 AACTGCAAACAGGTGACGACTGG - Intronic
921376862 1:214483471-214483493 AACTGGAGGCGGGTGGGGAAGGG - Intronic
921604716 1:217139418-217139440 AACTGCGGGCAGGCGGGAGCTGG + Intergenic
921693168 1:218176679-218176701 AACTGCAGTCAAATGGGGGCTGG - Intergenic
922203294 1:223425084-223425106 ATGTGCAGGCAGGTGGGGTGGGG - Intergenic
922804095 1:228376891-228376913 GGCTGCAGGCGGGTGGGGCCAGG + Intronic
923190993 1:231620543-231620565 AACTGATGGCTGCTGGGGACTGG - Intronic
923447711 1:234087966-234087988 AGCTGGAGGCAGGTGTGGAGGGG - Intronic
923903202 1:238352534-238352556 AACTGCAGGTAGCTGGGGTTTGG + Intergenic
1062970258 10:1642852-1642874 AACTGCAGGCAGGTATGTTCTGG + Intronic
1063432340 10:6001475-6001497 ACCTGCAGGCTGGTGAGGCCAGG + Intergenic
1064081465 10:12311333-12311355 CACTGCAGGCAGCTGGAGGCAGG - Intergenic
1064302681 10:14136668-14136690 AACTGGAAGCGGGTGGGGATGGG - Intronic
1064995795 10:21295966-21295988 AGCTGGAGGGAGGTGGGGAGAGG - Intergenic
1066357032 10:34694944-34694966 AAGAGCAGGCCGGTGGGGAGAGG + Intronic
1066654071 10:37683042-37683064 CACTGCAGGAAGGTGGGGGAAGG + Intergenic
1067571896 10:47377923-47377945 CACTTCAGGCACCTGGGGACAGG + Intronic
1067728812 10:48794151-48794173 AATTGCAGGAAGGCCGGGACAGG + Intronic
1069604331 10:69730307-69730329 CACTCAAGGCTGGTGGGGACAGG - Intergenic
1069659905 10:70116792-70116814 ACCAGGAGGCTGGTGGGGACAGG + Intronic
1069755359 10:70771476-70771498 GACAGCAGGCAGGAGAGGACCGG + Intronic
1069776473 10:70930143-70930165 CAATGCAGGCAGATGGGGCCTGG + Intergenic
1070375814 10:75830312-75830334 AAATGCAGGCACTTGGAGACAGG - Intronic
1072443612 10:95478951-95478973 CACTGCTGGCAGGAGGGGAAGGG + Intronic
1073034306 10:100552584-100552606 AACTGCAGGCAGCTCTGGAGAGG - Exonic
1073582516 10:104681332-104681354 CACTGCAGGCAGGGGCGGGCGGG - Intronic
1074705376 10:116125206-116125228 ATCTGCAGGTAAGTGGGCACTGG - Exonic
1075301396 10:121327735-121327757 AACTGGGGGCAGGTGGGAATGGG - Intergenic
1076538116 10:131195900-131195922 AGCTCCAGGCCAGTGGGGACAGG - Intronic
1076873960 10:133206946-133206968 ATCTGCAGGCAAGTGGGCTCCGG + Exonic
1077192006 11:1259504-1259526 ACCTGCAGGCTGCTGGGGACAGG + Intronic
1077351503 11:2095203-2095225 AGGTGCAGCCAGGTTGGGACAGG + Intergenic
1077410610 11:2402273-2402295 AACTGCAGGTGGGTGGGGTGGGG - Exonic
1078426274 11:11253659-11253681 CACTGCAGGCAGGAGAGGAAAGG + Intergenic
1078471172 11:11588024-11588046 AACTGCAGAAAGTTGGGGAAAGG - Intronic
1078597572 11:12701660-12701682 AACTGCAGGCTAGTGGGAAAAGG + Intronic
1080296556 11:30736535-30736557 AACTGCGGGCAAGTGAGTACTGG + Intergenic
1080567527 11:33525646-33525668 AGCTGCAGGCAGGCAGGGAGAGG + Intergenic
1082081918 11:48018925-48018947 CTCTGCAGGCTGGTGGGGAGGGG + Intronic
1083267756 11:61554794-61554816 ATCTGCAGGCAGAGGGGGATCGG + Intronic
1083340988 11:61958251-61958273 AACTGCAGGAACGTGAAGACGGG - Exonic
1083369477 11:62166842-62166864 AACAGGAGGCAGGAGGGGTCTGG + Intergenic
1083738089 11:64693173-64693195 AACTGGAGGAAGGAGGGGGCGGG + Intronic
1083856626 11:65396276-65396298 AAGTGCAGGAAGGTGGGGCCCGG + Intronic
1083892140 11:65600804-65600826 CACTCCAGGCAGGAGGGGAAAGG - Intronic
1084162312 11:67356518-67356540 AGCTGGAGGCAGGTGGAGAGAGG + Intronic
1084961146 11:72717334-72717356 CAGTCCAGGGAGGTGGGGACAGG + Intronic
1086876842 11:92107493-92107515 AACTGCAGTCAGATGGCGGCTGG + Intergenic
1087359312 11:97137474-97137496 TACTGCATGCAGTTGGGGAGGGG + Intergenic
1088722369 11:112605646-112605668 AACTGGAAGCAGATGGGGAATGG + Intergenic
1088742771 11:112780490-112780512 AGCTGCAGGGAGGTGGGGGGTGG + Intergenic
1088834291 11:113564704-113564726 TATTGCAGGCAGGTGGGAGCTGG + Intergenic
1089470518 11:118716699-118716721 AAAAGCAGGCAGGAGGGGAAAGG - Intergenic
1089498153 11:118918147-118918169 AGCTGGAGGAAGCTGGGGACTGG - Intronic
1089576486 11:119447951-119447973 AGGTGGAGGCAGGTGGAGACAGG - Intergenic
1090278453 11:125435905-125435927 AGATGCGGGCAGGTGGGGGCGGG - Intergenic
1090875635 11:130786451-130786473 CACAGCAGGAAGGTGGGGGCAGG - Intergenic
1091349439 11:134881299-134881321 CACAGCAGGGAGGTGGGGAAGGG - Intergenic
1091634064 12:2184079-2184101 AGCTGCAGGCAGTGGGGGATGGG - Intronic
1092527297 12:9317070-9317092 AACTACAGTCAGGAGGTGACAGG - Intergenic
1092539979 12:9414703-9414725 AACTACAGTCAGGAGGTGACAGG + Intergenic
1094513061 12:31107761-31107783 AACTACAGTCAGGAGGTGACAGG - Intergenic
1095945381 12:47750724-47750746 AACTGCAGTCCGGTGGGTCCAGG - Intronic
1095989686 12:48026216-48026238 AAGTGCAGACTGGAGGGGACAGG - Intergenic
1096526017 12:52210924-52210946 ACCTGTAGGCAGGTGGAGAGGGG + Intergenic
1097380251 12:58886656-58886678 AACAGCAGGCATTTGGGGAGAGG + Intronic
1098347821 12:69524526-69524548 CACTGCATGCAGGTGTGGCCAGG + Intronic
1100879019 12:98995804-98995826 AACTGCAGGCTGCAGGGGTCAGG - Intronic
1102951421 12:117033938-117033960 AACTGCAGGCAGGTGGGGACAGG + Intergenic
1103368229 12:120398521-120398543 AAGAGCAGGGAGGTGGGGAGAGG - Intergenic
1103758792 12:123233028-123233050 AGCTGTAGGCCGCTGGGGACAGG - Exonic
1103949084 12:124541731-124541753 AACTGGAGGGAGATGGGGAGTGG + Intronic
1103968112 12:124652934-124652956 AGCTGCTGCCAGGTGGGGGCAGG - Intergenic
1105239603 13:18598074-18598096 AGCTGCAGGAGGGTGGGAACCGG - Intergenic
1105314148 13:19242224-19242246 AGGTGCAGGCAGGTGGGGAGAGG + Intergenic
1105839693 13:24243383-24243405 AACTGCTGGAGGGAGGGGACAGG - Intronic
1106299246 13:28448908-28448930 AACTGGATGCAGGAGGGGAATGG - Intronic
1106796585 13:33212534-33212556 TCCTGCAGGCAGGTGTGGGCAGG + Intronic
1107142045 13:37009844-37009866 AAATGCAGGCAGGTGTAGAAAGG + Intronic
1107361166 13:39619005-39619027 AAATGCCATCAGGTGGGGACAGG - Intergenic
1109174674 13:59140535-59140557 ACCTGCAGACAGTGGGGGACAGG + Intergenic
1112245525 13:97729988-97730010 AACTGAAAGCAGGAGGGGAAAGG - Intergenic
1112926728 13:104684740-104684762 AACTGAAAGCAGGTTGGGGCAGG + Intergenic
1113890553 13:113733064-113733086 AACTGGAGGCAGCTGGAGGCTGG + Exonic
1113912984 13:113853020-113853042 AGCTGCAGGCAGGTAGGCAGGGG - Intronic
1114134031 14:19826739-19826761 AGCTGCATGCAGGTGTGGAGTGG + Intronic
1114150383 14:20031883-20031905 AAATGCAAGCAGGTGGGGGATGG + Intergenic
1115408713 14:33048539-33048561 AACAGCAGGCAAATGGGGATTGG - Intronic
1117638708 14:57774634-57774656 TACTGCAAGCAGGTGTGGCCAGG - Intronic
1118820158 14:69339855-69339877 TTCTGCAGGCAGCTGTGGACAGG - Intronic
1119622276 14:76139986-76140008 ATCTGCAGTCAGCTGGGGACTGG - Intergenic
1119725959 14:76922063-76922085 AAGTCCTGGGAGGTGGGGACGGG + Intergenic
1119850269 14:77861780-77861802 TGTTGCAGGCAGGTGGGGCCCGG + Intronic
1120018114 14:79497487-79497509 AACTGCAGGGAGGTGGGATAAGG - Intronic
1120661868 14:87259430-87259452 AACTACAGGCAGTTGGAGAGGGG + Intergenic
1120844076 14:89111449-89111471 AACGCCAGGCAGGTGGTGAGAGG + Intergenic
1121320912 14:92991177-92991199 AACAGCAGGCAGTTGAGGAGGGG + Intronic
1121433849 14:93906020-93906042 ATCTGCAGGAAGGTCAGGACAGG + Intergenic
1121687298 14:95846252-95846274 AACTGCAGGCATCTGGGGACCGG - Intergenic
1121720933 14:96108263-96108285 CAGTGGAGGCAGGTGGGGACAGG - Intergenic
1121738671 14:96236328-96236350 AATTCCAGGCAGGTGGGGATGGG - Intronic
1122400452 14:101464453-101464475 CCCTGCATGCAGGTGAGGACTGG + Intergenic
1122576718 14:102747527-102747549 AACAGCAGGCACCTGGGAACGGG - Intergenic
1122875146 14:104660480-104660502 AAGTGCAGGGGGGTGGGGGCAGG - Intergenic
1122881885 14:104693952-104693974 AAGCAGAGGCAGGTGGGGACAGG - Intronic
1122961959 14:105097999-105098021 AACTGCAGGAATGTGAGCACTGG + Intergenic
1123577102 15:21682329-21682351 AGCTGCATGCAGGTGTGGAGTGG + Intergenic
1123613723 15:22124802-22124824 AGCTGCATGCAGGTGTGGAGTGG + Intergenic
1125348739 15:38745562-38745584 AACTGGAGTCAAGTGGGGACTGG + Intergenic
1125585234 15:40814912-40814934 AATGGCAGGCAGGTTGGGACAGG - Exonic
1127129403 15:55846315-55846337 AACTGCAGGCAAAGGAGGACAGG + Intronic
1128800653 15:70494822-70494844 AAAGGCAGGCAGGTGGGGCCAGG + Intergenic
1129180033 15:73868211-73868233 AACCGCAGGCAAGTGGGGGTGGG + Intergenic
1129252471 15:74316476-74316498 CACAGCAGGCAGGGGAGGACAGG + Intronic
1129651188 15:77491315-77491337 AACTGAAGGCAGCTGGGTCCAGG + Intergenic
1129674235 15:77623666-77623688 AAGGGGAGGCAGGTGGGGGCGGG - Intronic
1129737567 15:77974690-77974712 TACTGAAGGCAGGTGTGGAGAGG - Intergenic
1129992405 15:79976485-79976507 AACGGCAGCCAGTTGGGGAGAGG + Intergenic
1131882577 15:96875741-96875763 AATTGCTGGCAGGTGGGGGAGGG + Intergenic
1202985970 15_KI270727v1_random:416574-416596 AGCTGCATGCAGGTGTGGAGTGG + Intergenic
1133024310 16:2980996-2981018 AGCTGCAGGCAGGCGAGGTCAGG - Intergenic
1133127874 16:3657885-3657907 GCCTGCAGGCAAGTGGGCACAGG - Exonic
1133141998 16:3751958-3751980 AACAGGGGGCAGGTGGGGAAAGG + Intronic
1133266384 16:4586905-4586927 GACAGCAGGCAGGTGGGCATGGG - Intronic
1133777885 16:8911961-8911983 AACTGAAAGGATGTGGGGACAGG + Intronic
1134156033 16:11844141-11844163 GCTTGCAGGCAGGTGGTGACAGG - Intronic
1134223987 16:12377490-12377512 AACTGCAGGTGGGTGGGGAGGGG + Intronic
1134609803 16:15598934-15598956 GACGGCAGGCACGAGGGGACAGG + Exonic
1137787388 16:51150561-51150583 AGCTGCAAGAAGATGGGGACTGG - Intronic
1138583872 16:57958223-57958245 AACTCCTGGCAGGTGGGGCTGGG + Intronic
1139782360 16:69362337-69362359 CACTGCAGGCAGGAGGAGAAAGG - Intronic
1139795686 16:69481342-69481364 AGCTGTAGGCAGGAGGGGAGAGG + Intergenic
1139923852 16:70475076-70475098 GACTGCAGGCCAGTGGGGTCTGG + Intronic
1140213633 16:72990154-72990176 AACTGCAGGAGGGTGGGGAAGGG + Intronic
1141592985 16:85081032-85081054 CGCTGCAGGCAGGAGGGCACTGG - Intronic
1141847109 16:86618399-86618421 ACCTGCAGGCAGTTGGGGTTGGG - Intergenic
1142029573 16:87831812-87831834 CTCTGCAGGCGGGTGGGGACTGG + Exonic
1142145064 16:88489467-88489489 AAAGGCAGGGAGGTGGGAACAGG + Intronic
1143434038 17:6909392-6909414 CACTGCAGGCAGGTGCAGCCAGG + Intronic
1143765950 17:9137923-9137945 CACTGCAGGCACGTGGGCCCTGG - Intronic
1143815036 17:9506209-9506231 GAATGCAGACAGGTGGGGAGAGG - Intronic
1144329354 17:14210367-14210389 CACAGCAAGGAGGTGGGGACAGG - Intergenic
1144465956 17:15497738-15497760 GACTTCAGTCAGGTGGGCACTGG + Intronic
1144493806 17:15734981-15735003 ACCTGGAGGCAGGTGGAGTCAGG - Exonic
1144640250 17:16932850-16932872 ACCTGGAGGCAGTTGGGGTCAGG + Intronic
1144906456 17:18641699-18641721 ACCTGGAGGCAGGTGGAGTCAGG + Exonic
1145241427 17:21242832-21242854 CACCGCTGGCAGGTGGGGTCTGG + Exonic
1146370935 17:32265584-32265606 GAGTGCAGGCCGGTGGTGACCGG + Intergenic
1146483813 17:33227357-33227379 AGCTGCAGGCAGGAGGGGCCTGG - Intronic
1146638135 17:34521002-34521024 ATCTGCTGGCAGGAGGGGAGTGG - Intergenic
1146787645 17:35732822-35732844 CAGTACAGGCAGGTGGGGAGTGG - Intronic
1147001930 17:37369743-37369765 AACTGCAGGCTGGAGGGCAGTGG + Intronic
1147721372 17:42541605-42541627 CACTGCAGGCAGGAGGTGAGTGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148950330 17:51305347-51305369 GGCTGCAGGCTGGTGGGGAGAGG + Intergenic
1148993672 17:51688681-51688703 TTCTGCAGGCAGATGGGGAAAGG - Intronic
1150226361 17:63526685-63526707 AACTCCAGGGAGGTGGGAAGGGG + Intronic
1151393494 17:73803766-73803788 ACCTGCTGGCAGGTGTGCACAGG + Intergenic
1151652032 17:75476027-75476049 AGCTGCAGGAAGGAGGGGAGAGG - Intronic
1151722231 17:75863829-75863851 AACTTCAGGCATATGGGGAGGGG - Intergenic
1151979338 17:77499387-77499409 ACCTGCAGCCCGGTGGGGGCGGG - Exonic
1152169296 17:78733581-78733603 AAGTGAAGGCCAGTGGGGACAGG + Intronic
1152257112 17:79246570-79246592 GACAGCAGCCAAGTGGGGACTGG - Intronic
1152509260 17:80774194-80774216 AACTCAAGGCGGGTGGAGACGGG - Intronic
1152544371 17:80993354-80993376 AAAGGCAGGCAGGTGTGGCCAGG - Intronic
1152730708 17:81968259-81968281 AACTGCAGCCAGGTCTGGAGAGG - Intergenic
1153220384 18:2855587-2855609 AAGGGGAGGCAGGTGGGGCCAGG + Intronic
1153902472 18:9630052-9630074 AAATGCAGCCAGCTGGGGAAGGG - Intergenic
1154207011 18:12346107-12346129 ACCTGTAGGCTGGAGGGGACAGG - Intronic
1156435566 18:37124784-37124806 AACTACAAGCACGAGGGGACTGG - Intronic
1157384131 18:47247724-47247746 GGCTGCAGGTAGGTGGGCACCGG + Intronic
1157524725 18:48372135-48372157 GACTGCAGCCAGGTGAGCACTGG - Intronic
1160889310 19:1368939-1368961 ATCTGAACGCAGGTGGGCACCGG - Intronic
1160889322 19:1368982-1369004 ATCTGAACGCAGGTGGGCACCGG - Intronic
1161698335 19:5782534-5782556 CACTGCAGGCAGGGCGGGAAGGG - Intergenic
1161850462 19:6735606-6735628 ATCTGCAGTGAGTTGGGGACCGG - Exonic
1163169322 19:15519724-15519746 AACTGCAGCCAGGTGGCTCCTGG + Intronic
1163255419 19:16153197-16153219 CCCTGCAGGCAGGTGAGGGCGGG + Exonic
1165155972 19:33788102-33788124 AGCTCCAGGCAGCTGGAGACTGG - Intergenic
1165708317 19:37991871-37991893 CACTGCAGGCAGCTGGGTTCGGG + Intronic
1165904836 19:39187530-39187552 AAGTGCAGCCAGGTCGGGAGGGG - Intergenic
1166377526 19:42336062-42336084 AGCTGGAGGCAGGTGGTGCCAGG - Exonic
1167117570 19:47497155-47497177 GACTGCAGCCAGGTGGGGCGGGG - Intronic
1167320831 19:48796402-48796424 AGCTGCAGGGAGCTGGGGAATGG - Intronic
1167357846 19:49015000-49015022 ACCTGCAAGCAGTGGGGGACAGG - Exonic
1167661714 19:50799356-50799378 ACCTGGAGGCAGGAGGGCACAGG + Exonic
1167741991 19:51329336-51329358 AACTCCTGGCAGGTTGGGAGTGG + Exonic
1168264776 19:55216758-55216780 AACGCCAGGCAGGCGGGGAATGG + Intergenic
1168350598 19:55673837-55673859 CACTGAAGGCAGGAAGGGACAGG - Intronic
925210734 2:2043523-2043545 AACTGGAGGCAGTTGTGGCCGGG - Intronic
925344615 2:3162044-3162066 AACAGCAGGCAGATTGGAACGGG + Intergenic
925592600 2:5525515-5525537 ACATCCAGGCAGGTGCGGACAGG - Intergenic
926350089 2:11986326-11986348 AATAGCAGGGAGGTGGGGCCAGG - Intergenic
927869608 2:26615299-26615321 AACTGCAGCCAGGTGAGCAGTGG + Intronic
928166100 2:28973244-28973266 TAAGGCAGGCAGGTGAGGACAGG - Intronic
928298288 2:30104430-30104452 CAGAGCAGGCAGGTGGGAACTGG - Intergenic
929549347 2:42879618-42879640 ACCTGCTGGCAGCTGGGGAGGGG + Intergenic
931207669 2:60163785-60163807 CACTGCAGGCATGAGTGGACGGG + Intergenic
932601124 2:73126683-73126705 ACCTCCTGGCCGGTGGGGACGGG - Intronic
933120617 2:78532548-78532570 AACTGCAAGCTGGTGGGCAGTGG + Intergenic
934938022 2:98479249-98479271 CACTGCAGCCAAATGGGGACAGG - Intronic
934945621 2:98539279-98539301 AAGTGCAAGCAGCTGGGGGCAGG - Intronic
935211395 2:100942024-100942046 AACTGCAAGCAGCTTGGCACGGG + Intronic
936065988 2:109332536-109332558 AACTGCGGGGAGCTCGGGACAGG - Intronic
936233474 2:110724568-110724590 AAAGGCTGGCATGTGGGGACAGG - Intergenic
936408836 2:112235738-112235760 AAATACAGGAAGGTGGGGAGTGG + Intronic
936857660 2:116979881-116979903 AGGTGCAGGCAGGTGGGAAGGGG + Intergenic
936908130 2:117561226-117561248 AATTTCAGGCAGGTGGGAGCTGG + Intergenic
938094295 2:128451598-128451620 ATCTGCATGCAGCTGGGGAAGGG - Intergenic
938099880 2:128491423-128491445 AACTGCGGGCAGCTGGGGACAGG - Intergenic
940134932 2:150425255-150425277 AACCGGAGGCAGGAGGGGCCAGG + Intergenic
941324130 2:164091852-164091874 CAATGCTGGCAGGTGGGGAGGGG - Intergenic
943190883 2:184679401-184679423 AGCTGGAGGGAGCTGGGGACAGG + Intronic
943225534 2:185169485-185169507 TACAGCAGGGAGGTGGGGAGTGG - Intergenic
946391869 2:219420980-219421002 AACTGCAGACAGGAAGGGGCAGG - Intronic
946777559 2:223159157-223159179 AGCTTCAGGCAGGTAGGGATTGG + Intronic
946818999 2:223610987-223611009 AACTGCATGCAAGGGGGTACGGG - Intergenic
947872128 2:233445056-233445078 AACAGCAGGCAGGCGGGCAGAGG + Intronic
948456077 2:238105239-238105261 AAGTGGAGGAAGGTGGGGGCTGG - Intronic
948718679 2:239882558-239882580 AACTGCAGGGAGCTGAGGGCTGG + Intergenic
948756877 2:240165223-240165245 ACCTGCAGGCAGGTGTGGATGGG - Intergenic
1172097964 20:32469825-32469847 TCCTCCAGGGAGGTGGGGACAGG + Intronic
1172811787 20:37653331-37653353 AAGTGCAGGCAGGAGGGCAGTGG + Intergenic
1173249786 20:41358383-41358405 GCCTGCAGGCAGCTGGGGAGAGG - Intronic
1173688771 20:44942722-44942744 AACTGCAGTGAGTTGGGGTCTGG + Exonic
1175012299 20:55750847-55750869 AACTGGTAGCAGGTGAGGACAGG - Intergenic
1175572504 20:60034638-60034660 ACCTGAAGGCAGCTGGGGGCTGG - Intergenic
1175653181 20:60746627-60746649 AGCTGGAGGAGGGTGGGGACAGG + Intergenic
1175853702 20:62107508-62107530 GACCCCAGGCAGGTAGGGACCGG - Intergenic
1176058973 20:63163788-63163810 GACTGCAGGCAGGCGGAGGCGGG + Intergenic
1176268929 20:64225341-64225363 CGCTGCAGCCAGGTGCGGACAGG - Intronic
1176389900 21:6158111-6158133 AGCTGCAGTCAGGAGGGGACAGG - Intergenic
1179255307 21:39710798-39710820 ATGTGCATGCAGGTGGTGACTGG + Intergenic
1179733567 21:43380129-43380151 GGCTGCAGTCAGGAGGGGACAGG + Intergenic
1179985035 21:44915685-44915707 AAGTGCCGTCAGGTGGGGACTGG + Intronic
1179996431 21:44976521-44976543 AACTTCCGGCAGGAGGGGAGAGG - Intronic
1180149363 21:45939862-45939884 ACCTGCAGGCAGGTGTGGGCGGG + Intronic
1180593682 22:16960517-16960539 CACTGTAGTCAGCTGGGGACAGG + Intergenic
1180650274 22:17370460-17370482 AACTTCGGGCCGGTGGGGACCGG + Intronic
1181003117 22:19997252-19997274 GACTGCAGGCAGGACGTGACAGG + Intronic
1181031972 22:20152678-20152700 ATCTTTAGGCAGCTGGGGACCGG - Intergenic
1181938086 22:26453211-26453233 AACTGCACCCAGGAGGTGACTGG - Exonic
1182941363 22:34280536-34280558 CACTGGAGGCAGGTGGGAAGAGG + Intergenic
1183414804 22:37676067-37676089 AGCTGCAGGGGGGAGGGGACAGG - Intronic
1183456463 22:37925770-37925792 GACAGCAGGCAGGTGGAGAATGG + Exonic
1183834957 22:40444717-40444739 AACTGCATGGAGGTGGGCAGGGG + Intronic
1184445454 22:44544479-44544501 AAGTGGGGGCAGGTGGGGACAGG + Intergenic
1184535628 22:45084869-45084891 AAGTGCAGGCAGGCGCGGCCAGG + Intergenic
1184688441 22:46106777-46106799 CACTGCACGCAGGTGGGAAGGGG - Intronic
1184718080 22:46293272-46293294 AAGGGCAGCCTGGTGGGGACGGG - Exonic
1185062131 22:48612584-48612606 AACAGCAGACAGGTGGGGCGGGG - Intronic
1185233634 22:49698877-49698899 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233642 22:49698904-49698926 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233650 22:49698931-49698953 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233658 22:49698958-49698980 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233666 22:49698985-49699007 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233674 22:49699012-49699034 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233927 22:49700145-49700167 AACCCCAGGCAGCTGTGGACAGG + Intergenic
950483824 3:13261170-13261192 CACTCCTGGCAGGCGGGGACAGG - Intergenic
950574871 3:13826191-13826213 AACTCAGGGAAGGTGGGGACCGG - Intronic
951019526 3:17767208-17767230 AAGTGCAGCCAGGTGGGCGCGGG - Intronic
951112372 3:18819364-18819386 AACTGGAGTCAGGTGGGGCTGGG + Intergenic
951954569 3:28240625-28240647 GACTGCAGGTAGGTGGGGAGGGG + Intergenic
952165115 3:30739374-30739396 GGGTGCAGGCAGGTGGGCACAGG - Intronic
952341454 3:32451043-32451065 CAGTGCAGACAGTTGGGGACCGG + Intronic
952901740 3:38115651-38115673 GACTGAAGGCAGGAGGGGAGGGG + Intronic
953414282 3:42706663-42706685 AACTGCAGACAGGCAGGCACAGG - Intronic
953532128 3:43748361-43748383 ACATGCAGGCAGTTGGGGGCTGG - Intergenic
954282980 3:49597440-49597462 AGCTACTGGCAGGTGGGGAGAGG - Intronic
954302660 3:49708412-49708434 ATCTGCTGACAGGTGGGGATGGG - Intronic
954370914 3:50169235-50169257 AGGTGCGGGCAGGTGAGGACAGG - Intronic
956026498 3:64988218-64988240 AACTGTGGGGAGGAGGGGACAGG + Intergenic
956286737 3:67618305-67618327 AGCTACAGGGAGGCGGGGACAGG + Intronic
956751424 3:72346869-72346891 AACAGCAGTCAGGTGGGGCCGGG - Intergenic
960577900 3:119245397-119245419 CATTGCAGGCAGATGGGGAGGGG + Intergenic
960997792 3:123351169-123351191 AAGTGGAGACAGGTGGGGACTGG + Intronic
961328011 3:126121771-126121793 CACTCCAGGCAGGTGTGGCCAGG + Intronic
962258914 3:133890743-133890765 AACTACCTGCAGGTGGGGAGGGG + Intronic
962359630 3:134726889-134726911 AACTGCAGCCAGGCTGGAACAGG - Intronic
962920548 3:139946567-139946589 ATCTGCAGGGAGGTAGGGATGGG + Intronic
966394807 3:179491698-179491720 AGCTGCAGGAAGGAAGGGACAGG + Intergenic
966831842 3:184017127-184017149 GGCTGGAGGCAGGTGGGCACAGG - Intronic
966878053 3:184334903-184334925 AACTGAGGGCTGGTGGGGCCGGG + Exonic
967150427 3:186643749-186643771 ATCTGCATGCACTTGGGGACTGG - Intronic
967245303 3:187480501-187480523 AAGGCCAGGAAGGTGGGGACTGG + Intergenic
968087184 3:195879038-195879060 AACGGCAGTCAGGTGAGGGCTGG - Exonic
968487371 4:870251-870273 AAGTGCTGGCAGGTGGGCCCAGG - Intronic
969248560 4:5952530-5952552 ACCCGCAGCCAGGTGGGGAGCGG - Intronic
970320212 4:14867909-14867931 AACTGCAGGGCTGTGGGGAGGGG - Intergenic
971331376 4:25684317-25684339 AATTGCCAGGAGGTGGGGACAGG + Intergenic
972294129 4:37720139-37720161 GACTGCAGTCAGATGGTGACTGG - Intergenic
975321183 4:73011552-73011574 AACTGCAAGGAGGTGTGGGCAGG + Intergenic
975537077 4:75462083-75462105 AACAGCAGGCTGATGAGGACAGG + Intergenic
975909200 4:79248123-79248145 CACTGCAAGCAGGTGTGGTCAGG - Intronic
980998152 4:139801453-139801475 ACCTGCAGGCAGGAGGGGAGGGG + Intronic
981276248 4:142901039-142901061 CACTGCAAGCAGGTGTGGCCAGG + Intergenic
981401843 4:144322358-144322380 ATCTGCAGGCAGGTGTGCACTGG - Intergenic
981516863 4:145619314-145619336 GACTGCAGGCGCGTGGGGCCCGG - Exonic
981599838 4:146474431-146474453 AACAGCAGCCATGTGGTGACAGG + Intronic
982049815 4:151489507-151489529 AGGTGCAGGCAGGTGGGGAGGGG + Intronic
982947878 4:161649001-161649023 AAGTGCAGGCTGGTGAGCACAGG + Intronic
985593781 5:778607-778629 ACCTGCAGGCAGCTGGGACCAGG + Intergenic
985672892 5:1215145-1215167 CACTGCAGGCAGCTGGGGCAGGG + Intronic
985914400 5:2906610-2906632 AAGTGGGGGCAGGTGGGGACAGG - Intergenic
988503044 5:31799313-31799335 GCCTGCAGGAAGGTGGGGATGGG + Exonic
992543193 5:77784860-77784882 AGCTGGTGGCAGGTGTGGACTGG - Intronic
994887400 5:105582405-105582427 TGGTGCAGGCAGGTGGGGAGGGG + Intergenic
995484402 5:112625377-112625399 TTCTGCAGTCAGGTTGGGACAGG + Intergenic
996141400 5:119913661-119913683 AGGTTCAGGCAGGTGGGGAGGGG - Intergenic
997165924 5:131660120-131660142 AACTGGTGGCAGGTGTGGATGGG + Intronic
997473683 5:134130626-134130648 TATTGCAGGCAGGAGAGGACGGG + Intronic
997521029 5:134524874-134524896 AAGTGCTGGCAGGAGGGGAGTGG - Intronic
999719915 5:154391986-154392008 GACTGCAGGAAGGTGGGGATGGG + Intronic
1001557187 5:172644829-172644851 AAGTGTAAGCAGGTGGGGATAGG + Intronic
1001562318 5:172677706-172677728 ATGAGCAGGCAGGAGGGGACAGG - Intronic
1001951327 5:175818610-175818632 TTTTGCAGGGAGGTGGGGACTGG - Intronic
1002500037 5:179642458-179642480 ACATGCAGGCAGGTGGAGGCAGG - Exonic
1002786884 6:408338-408360 AACCGCTGGCAGGTGGGGGATGG - Exonic
1002796011 6:471497-471519 AAGTGGAGGCAGGTGGGCAGAGG - Intergenic
1004002237 6:11605995-11606017 GAATGCAGGCAGGTGGGGCAGGG + Intergenic
1004424309 6:15497210-15497232 AACTGCAGGGATCTGGGGGCAGG - Intronic
1004507428 6:16258409-16258431 AAGTGCAGGAAGGAGGGGGCTGG + Intronic
1006145285 6:31955256-31955278 AACGGCTGGAAAGTGGGGACTGG + Exonic
1007254084 6:40516476-40516498 ATCTGAAGGCAGCTGGGGAAGGG + Intronic
1007414156 6:41682446-41682468 AGCAGCAGGCAGGTGGAGGCGGG + Intergenic
1007505336 6:42331435-42331457 AAGTGCAGGCAGGTGGAGGGAGG - Intronic
1007636004 6:43300072-43300094 GACTGCAGGCAGCTGGGGAGCGG + Intronic
1007727367 6:43924530-43924552 AACAGCAGGCAGGTGACCACGGG - Intergenic
1008527433 6:52420500-52420522 GGCTGCTGGAAGGTGGGGACAGG - Intronic
1008931528 6:56945418-56945440 AACTGCAGGGGTTTGGGGACTGG + Intronic
1010756098 6:79667890-79667912 AACTGGGGGGAGGTGGGGCCGGG - Intronic
1010787526 6:80021532-80021554 AAATGCTAGCAGCTGGGGACTGG + Intronic
1011853174 6:91655607-91655629 AGCTGCAGGTAGGTGGGCAGAGG - Intergenic
1012490774 6:99780419-99780441 CACTGCAAGCAGGTGTGGCCAGG + Intergenic
1012869779 6:104659201-104659223 AGGTGCAGGCAGGTGGAGAAGGG + Intergenic
1014398742 6:120960549-120960571 AACTACAGGTAGATGGGAACAGG - Intergenic
1016384956 6:143521842-143521864 ATCTGGATGCAGGTGGGGAAGGG + Intergenic
1016460354 6:144275020-144275042 AAGTGGAGGGTGGTGGGGACAGG - Intergenic
1017796327 6:157848007-157848029 TACAGCAGGCAGGTGAGGAGGGG - Intronic
1018309247 6:162491510-162491532 AACTGCAGTCAGGTGCTGTCTGG - Intronic
1018875343 6:167817603-167817625 AACTGAAGCCAGGTGGTGAGTGG + Intergenic
1019408989 7:898506-898528 AGCTGCCGGCCGCTGGGGACTGG - Exonic
1019481572 7:1269489-1269511 AACTTGCGGCAGGAGGGGACCGG - Intergenic
1019633897 7:2065223-2065245 AGCTGAAGGCAGATGGAGACTGG - Intronic
1019769692 7:2876043-2876065 ACCTCCAGGCAGGAGGGGGCGGG - Intergenic
1020194440 7:6026297-6026319 AACAGCAGGCAGGTGGTGAAGGG + Intronic
1021449867 7:20774989-20775011 TATTGCAGGGAGGTGGGGAGGGG - Intronic
1021560655 7:21965832-21965854 AACTGAGGGGAGGTGGGGGCTGG - Intergenic
1022153317 7:27632899-27632921 GACTGGAGGATGGTGGGGACTGG - Intronic
1022490998 7:30817609-30817631 AAGTGCTTGCAGGTGGGGAGGGG + Intronic
1023357231 7:39379455-39379477 TTCTGCAGGCAGGTGGGTGCAGG - Intronic
1023548636 7:41345131-41345153 AACTGCAGGGAGGTGGGAAAGGG + Intergenic
1024141687 7:46468629-46468651 AACTGCAGGATGGGGAGGACTGG - Intergenic
1025776969 7:64568830-64568852 AACTCCTGGCAGGTTGGGAGTGG - Intergenic
1025996084 7:66528364-66528386 CACTGCGGGCAGGTGGGGTGTGG - Intergenic
1029220423 7:98984347-98984369 GAGTGCATGCAGGTGCGGACAGG + Exonic
1029608665 7:101615023-101615045 AATTGCAGGCAGGAGTGGGCGGG - Intronic
1029704769 7:102270455-102270477 AACTGGAGGCTGCAGGGGACAGG - Intronic
1030303133 7:107993871-107993893 AACAGCAGGCTGCTGGGGAGTGG + Intronic
1032491079 7:132325058-132325080 AGGTGAAGGCAGGTGGGGGCAGG - Intronic
1032931483 7:136677604-136677626 CACAGCAGGCAGGGAGGGACAGG + Intergenic
1033718074 7:144023960-144023982 ATCTGCAGGGTGGAGGGGACAGG - Intergenic
1035316020 7:157997942-157997964 GAGTGCAGGGAGGTGGGGAGAGG + Intronic
1035473962 7:159129199-159129221 AACTGGACTCTGGTGGGGACAGG + Intronic
1035473996 7:159129325-159129347 AACTGGACTCTGGTGGGGACAGG + Intronic
1035826275 8:2647327-2647349 TAAGACAGGCAGGTGGGGACTGG + Intergenic
1036255965 8:7206749-7206771 ACCTGCAGGTAGGTGGGCAAGGG + Intergenic
1036361523 8:8080750-8080772 ACCTGCAGGTAGGTGGGCAAGGG - Intergenic
1036889449 8:12586273-12586295 ACCTGCAGGTAGGTGGGCAAGGG + Intergenic
1036961715 8:13251293-13251315 AACTGCAGGCTGATGGGGCAGGG + Intronic
1037814271 8:22103586-22103608 AGCTGCAGCCAGGAGGGGAGCGG + Exonic
1037964197 8:23120608-23120630 AAGTCAAGGCAGTTGGGGACGGG - Intergenic
1038325866 8:26572353-26572375 AACTGCAGGGAAGTGGGGCTGGG - Intronic
1038375471 8:27036083-27036105 AACTCCAGGCAGGAGGACACAGG + Intergenic
1038613686 8:29074392-29074414 AACTCCAGTCAAGTGGGGATGGG - Intronic
1039521447 8:38175927-38175949 TACTGCAGGCAGGAGTGGACGGG + Intronic
1039918238 8:41875318-41875340 AACTGGAGGCAGGAGGAGGCAGG + Intronic
1040332131 8:46391089-46391111 AACTGCAGGGTGGTGGGGGTGGG + Intergenic
1041381555 8:57258619-57258641 AACTGCAGGAGGGCGGGAACCGG + Intergenic
1041704896 8:60836196-60836218 AACTGAAGGCTGGTGGCCACAGG + Exonic
1042006153 8:64182554-64182576 CACTGCATGCAGGTGTGGCCAGG - Intergenic
1042084067 8:65088767-65088789 ACTTGCAGGCAGGTAGGGAGGGG + Intergenic
1042113387 8:65405402-65405424 CACTGCAGGCAGTGGGGCACAGG - Intergenic
1043147083 8:76672857-76672879 CACTGCAGGCAGGAGTGGGCTGG - Intergenic
1045342584 8:101267880-101267902 AACTGCCTGGAGGTGGGGATTGG - Intergenic
1045651569 8:104346346-104346368 GACTGCGGGCAGGTGGGCAGAGG - Intronic
1047303619 8:123635788-123635810 TGCTGCAGGCAGCTGGGGAAAGG - Intergenic
1047754951 8:127911403-127911425 AACAGCTGGCAGCCGGGGACCGG - Intergenic
1048869160 8:138783068-138783090 AACTTCATGTGGGTGGGGACTGG + Intronic
1048940205 8:139393937-139393959 CACTACAGGCAGATGGGGATAGG + Intergenic
1049403968 8:142443407-142443429 CACTGGAGGCAGGTGGGGGTAGG + Intergenic
1049505438 8:142994053-142994075 AACTGGAGGCAGCTGGAGGCAGG + Intergenic
1049534349 8:143171302-143171324 CCCTGCAGGGAGCTGGGGACAGG + Intergenic
1049574054 8:143382371-143382393 GACTGGCTGCAGGTGGGGACAGG + Intronic
1051161585 9:14214215-14214237 AAGAGCAGGCTGGTGGGGAAGGG - Intronic
1051273140 9:15374568-15374590 CAGTGCAGGCAGGTGGGAAGGGG + Intergenic
1051610314 9:18955487-18955509 AACTGCAAGCACTTGGGTACTGG + Intronic
1052720705 9:32168465-32168487 AATTGCAGGCAGGTGGGGGAAGG + Intergenic
1053542986 9:38993894-38993916 CACTGCAAGCAGGTGTGGCCAGG + Intergenic
1053807429 9:41817411-41817433 CACTGCAAGCAGGTGTGGCCAGG + Intergenic
1054623163 9:67370016-67370038 CACTGCAAGCAGGTGTGGCCAGG - Intergenic
1054821860 9:69530652-69530674 TACTGCATACTGGTGGGGACTGG - Intronic
1055626659 9:78182583-78182605 AATTGCTGGCAGGTGGGGGAGGG - Intergenic
1055687342 9:78790863-78790885 AAAAGCAGGCTGGTGGGGATGGG + Intergenic
1056331065 9:85521806-85521828 GACTCGAGGCAGGTGGGGAACGG + Intergenic
1057108526 9:92444892-92444914 TACTGCAAGCAGGTGTGGCCAGG + Intronic
1057139118 9:92716193-92716215 GGCTCCTGGCAGGTGGGGACAGG - Intronic
1058474363 9:105316746-105316768 AACAGCAGGCTGGTGGGGAGAGG + Intronic
1059798381 9:117724946-117724968 AAATGCAGGGTGGTGGGGAGTGG + Intergenic
1060222610 9:121772685-121772707 AGCTGCGGGCAGGTGAGGGCTGG - Exonic
1060233089 9:121840060-121840082 AACTGCAGCCTGGAGGGCACTGG + Intronic
1060234625 9:121853613-121853635 GACTGCAGGCAGCTGGGGGCCGG + Intronic
1060543411 9:124446923-124446945 AAGTGGGGACAGGTGGGGACAGG + Intergenic
1060877003 9:127090704-127090726 AAATGGAGGCAGGAGGGGACTGG + Intronic
1061095883 9:128456556-128456578 ACCAGCAGGCAGGAGGGTACCGG - Exonic
1061192083 9:129087922-129087944 AAATGAAGGCAGGTGGAGGCCGG - Intronic
1061201414 9:129140582-129140604 AAAGGCAGGCAGATGGGCACTGG - Intronic
1061412770 9:130430263-130430285 ATCTGCAGACGGGTGGGGTCAGG - Exonic
1061430318 9:130526726-130526748 GAGTCCAGACAGGTGGGGACAGG - Intergenic
1061618350 9:131794564-131794586 CTCTGCAGGGAGGAGGGGACGGG + Intergenic
1061734949 9:132648075-132648097 AACCTCAGGGAGGTGGGGGCAGG - Intronic
1062316553 9:135970146-135970168 AACTTCAGGCCAGTGGGGCCTGG - Intergenic
1062413625 9:136437177-136437199 ACCAGCAGGCAGGTGGGCTCAGG - Intronic
1185943568 X:4348767-4348789 AAGAGAAGGGAGGTGGGGACAGG - Intergenic
1187450048 X:19388017-19388039 AGCTGCAGGAAGGAGAGGACAGG - Intronic
1187564949 X:20440139-20440161 AACTGAAGGCAGTTGTGTACTGG - Intergenic
1189888171 X:45570938-45570960 ATCTGTAGGGAGCTGGGGACTGG + Intergenic
1190638040 X:52455674-52455696 TCCTGCAGGCAGGTAGAGACTGG + Intergenic
1190640041 X:52475465-52475487 TCCTGCAGGCAGGTAGAGACAGG + Intergenic
1190647631 X:52537400-52537422 TCCTGCAGGCAGGTAGAGACAGG - Intergenic
1190678618 X:52804776-52804798 TCCTGCAGGCAGGTAGAGACAGG - Intergenic
1191034008 X:56005954-56005976 CACTGCAGGCAGGCGTGGCCAGG + Intergenic
1191912736 X:66168287-66168309 AACTGCAGCCAGGAGGGAAAAGG + Intronic
1192496506 X:71619908-71619930 AGCTGAGGGCAGGTGGGGAGAGG - Intergenic
1194503043 X:94702723-94702745 AATTGCTGGCAGGTGGGGGAGGG + Intergenic
1194584690 X:95717901-95717923 AAGGGCAGGCAGGAGGGGAAGGG + Intergenic
1195656637 X:107337603-107337625 ACTTACAGGCATGTGGGGACTGG - Intergenic
1195766963 X:108306331-108306353 AAGTGCAGGCAGCTGGAGAAAGG + Intronic
1197445900 X:126552268-126552290 AACTCCAGGCAGGTGGTGTGCGG - Exonic
1198451120 X:136767702-136767724 GGCTGCGGGCAGGAGGGGACCGG - Intronic
1199093325 X:143715103-143715125 ACCTGAAGACAGGTGGGGCCTGG + Intronic
1199950973 X:152706120-152706142 GACTTCAGGCCGGTGGGGTCAGG + Intergenic
1199953272 X:152722734-152722756 GACTTCAGGCCGGTGGGGTCAGG + Intergenic
1199956410 X:152745716-152745738 GACTTCAGGCCGGTGGGGTCAGG - Intergenic
1199958709 X:152762341-152762363 GACTTCAGGCCGGTGGGGTCAGG - Intergenic
1200122135 X:153796159-153796181 AACTGGGGACAGGTGGGGGCTGG - Intronic
1200180410 X:154147046-154147068 AAATACAGGCAGGTAGGGAAGGG - Intronic
1200186238 X:154185441-154185463 AAATACAGGCAGGTAGGGAAGGG - Intergenic
1200191890 X:154222579-154222601 AAATACAGGCAGGTAGGGAAGGG - Intronic
1200197645 X:154260383-154260405 AAATACAGGCAGGTAGGGAAGGG - Intronic
1200611205 Y:5328686-5328708 AATTGCTGGCAGGTGGGGGAGGG + Intronic