ID: 1102952966

View in Genome Browser
Species Human (GRCh38)
Location 12:117042294-117042316
Sequence ACACCTCGGATTCTCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102952966_1102952974 -9 Left 1102952966 12:117042294-117042316 CCCCCAGGGAGAATCCGAGGTGT 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1102952974 12:117042308-117042330 CCGAGGTGTGGGTGACATGAGGG 0: 1
1: 0
2: 1
3: 12
4: 165
1102952966_1102952975 -4 Left 1102952966 12:117042294-117042316 CCCCCAGGGAGAATCCGAGGTGT 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1102952975 12:117042313-117042335 GTGTGGGTGACATGAGGGCATGG 0: 1
1: 0
2: 1
3: 39
4: 458
1102952966_1102952976 -3 Left 1102952966 12:117042294-117042316 CCCCCAGGGAGAATCCGAGGTGT 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1102952976 12:117042314-117042336 TGTGGGTGACATGAGGGCATGGG 0: 1
1: 0
2: 2
3: 25
4: 247
1102952966_1102952977 -2 Left 1102952966 12:117042294-117042316 CCCCCAGGGAGAATCCGAGGTGT 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1102952977 12:117042315-117042337 GTGGGTGACATGAGGGCATGGGG 0: 1
1: 0
2: 0
3: 27
4: 344
1102952966_1102952972 -10 Left 1102952966 12:117042294-117042316 CCCCCAGGGAGAATCCGAGGTGT 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1102952972 12:117042307-117042329 TCCGAGGTGTGGGTGACATGAGG 0: 1
1: 0
2: 0
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102952966 Original CRISPR ACACCTCGGATTCTCCCTGG GGG (reversed) Intronic