ID: 1102953498

View in Genome Browser
Species Human (GRCh38)
Location 12:117045311-117045333
Sequence GTTTTATGCAGATCAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102953486_1102953498 13 Left 1102953486 12:117045275-117045297 CCGCCCCGAGATGCCTCTGCTTC 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
1102953481_1102953498 28 Left 1102953481 12:117045260-117045282 CCCGGAGCCCGGCCTCCGCCCCG 0: 1
1: 0
2: 7
3: 60
4: 596
Right 1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
1102953489_1102953498 8 Left 1102953489 12:117045280-117045302 CCGAGATGCCTCTGCTTCCCAGG 0: 1
1: 0
2: 1
3: 34
4: 433
Right 1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
1102953488_1102953498 9 Left 1102953488 12:117045279-117045301 CCCGAGATGCCTCTGCTTCCCAG 0: 1
1: 0
2: 6
3: 30
4: 344
Right 1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
1102953493_1102953498 0 Left 1102953493 12:117045288-117045310 CCTCTGCTTCCCAGGCTGCGGGG 0: 1
1: 0
2: 4
3: 192
4: 3838
Right 1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
1102953483_1102953498 21 Left 1102953483 12:117045267-117045289 CCCGGCCTCCGCCCCGAGATGCC 0: 1
1: 1
2: 3
3: 23
4: 229
Right 1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
1102953485_1102953498 16 Left 1102953485 12:117045272-117045294 CCTCCGCCCCGAGATGCCTCTGC 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
1102953484_1102953498 20 Left 1102953484 12:117045268-117045290 CCGGCCTCCGCCCCGAGATGCCT 0: 1
1: 0
2: 1
3: 20
4: 187
Right 1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
1102953497_1102953498 -10 Left 1102953497 12:117045298-117045320 CCAGGCTGCGGGGGTTTTATGCA 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
1102953482_1102953498 27 Left 1102953482 12:117045261-117045283 CCGGAGCCCGGCCTCCGCCCCGA 0: 1
1: 0
2: 4
3: 39
4: 450
Right 1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
1102953496_1102953498 -9 Left 1102953496 12:117045297-117045319 CCCAGGCTGCGGGGGTTTTATGC 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
1102953480_1102953498 29 Left 1102953480 12:117045259-117045281 CCCCGGAGCCCGGCCTCCGCCCC 0: 1
1: 0
2: 5
3: 90
4: 882
Right 1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
1102953487_1102953498 10 Left 1102953487 12:117045278-117045300 CCCCGAGATGCCTCTGCTTCCCA 0: 1
1: 0
2: 1
3: 16
4: 230
Right 1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102953498 Original CRISPR GTTTTATGCAGATCAGCAGC TGG Intronic
901249629 1:7766635-7766657 GTTTTGGGGAGATCAGCTGCAGG + Exonic
903598442 1:24515268-24515290 GTTTTATGTAAATCAGCCCCAGG - Intronic
905907729 1:41630587-41630609 GTTTTTTGCTGGTCATCAGCCGG - Intronic
906374002 1:45279685-45279707 TTTTTTTCCAGATCTGCAGCAGG + Intronic
910326552 1:86014893-86014915 GCTTTATGCAAAGCAGCAGGGGG - Intronic
910484765 1:87700974-87700996 GTTATATGCAGATCTTCAACTGG - Intergenic
919365274 1:196651789-196651811 GGTATGTGCAAATCAGCAGCTGG - Intergenic
920317858 1:205092004-205092026 GCCATATGCAAATCAGCAGCAGG + Intronic
920565141 1:206967101-206967123 GTTTTTTGCAGGTCACCAGCAGG - Exonic
922420560 1:225458521-225458543 GTATTATTCAGTTGAGCAGCTGG + Intergenic
1065753719 10:28912044-28912066 GTGTTATGAAGACCAGCAGATGG + Intergenic
1066530534 10:36333277-36333299 GTTTTATATTGATCAGCTGCTGG - Intergenic
1068311221 10:55278582-55278604 GTTTTATCCATATCAACAGTAGG + Intronic
1068492613 10:57742873-57742895 TTTTTATCCACATCACCAGCAGG + Intergenic
1069265767 10:66455512-66455534 GTCTTATGCTGATGAGCAGTGGG - Intronic
1071777408 10:88804627-88804649 GTCTTATGCTAATGAGCAGCCGG - Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1088039982 11:105368930-105368952 GTTTTCTGGAGGTCAGCAGCTGG - Intergenic
1096243469 12:49971875-49971897 GTTTTCTGCAGCTCAGCTGGTGG - Intronic
1096478969 12:51925384-51925406 GGTTTGTGCAGAACAGCAGATGG - Intergenic
1098154858 12:67587295-67587317 GTCTTTTGCAGATCAGGAGATGG - Intergenic
1098857268 12:75666933-75666955 GATTTCTGTAGATCAGCATCAGG - Intergenic
1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG + Intronic
1110102251 13:71623005-71623027 TTTTGATGCAGATAAGCAGAAGG - Intronic
1118289284 14:64504885-64504907 GTTTAAGGCAAATCAGCCGCGGG - Exonic
1120125924 14:80743180-80743202 GTTGTCTGCAGAGCATCAGCTGG + Exonic
1124208459 15:27743069-27743091 GTGCTATGCAGAGAAGCAGCAGG - Intergenic
1125100368 15:35905292-35905314 GATTTGTGAAGACCAGCAGCAGG - Intergenic
1125819863 15:42619937-42619959 CCTTTATTCAGATCAGCAGGAGG + Intronic
1127215503 15:56819405-56819427 GTGTTATTCAAAGCAGCAGCAGG - Intronic
1130340084 15:82992891-82992913 GTTTTAAGCAGATCAGGGGCAGG - Intronic
1130747954 15:86676230-86676252 GTTTGGTGTAGATCAGCAGGAGG + Intronic
1130952767 15:88605394-88605416 GTTGCATGCAGAAGAGCAGCTGG + Intergenic
1131451013 15:92539943-92539965 GCTTTATGCAGATCAAGATCTGG + Intergenic
1136734868 16:32457120-32457142 GTACTATATAGATCAGCAGCTGG + Intergenic
1141310608 16:82910163-82910185 GCTGCATGCAGGTCAGCAGCAGG - Intronic
1203018210 16_KI270728v1_random:372473-372495 GTACTATATAGATCAGCAGCTGG - Intergenic
1203036545 16_KI270728v1_random:645631-645653 GTACTATATAGATCAGCAGCTGG - Intergenic
1142951315 17:3483057-3483079 TTTTCATGCAGATAAGCAGGAGG + Intronic
1143598595 17:7929914-7929936 GGCTTATGCAGATGAGCGGCAGG - Intronic
1143865292 17:9918795-9918817 GTTGTATGCAGAGTAACAGCCGG - Intronic
1146460828 17:33044933-33044955 TTTTTAGGCAGATCAGGAGTGGG + Intronic
1146477509 17:33174790-33174812 GTCCTATGTAGATCAACAGCAGG - Intronic
1150796180 17:68239156-68239178 GCTCTATGCAAAGCAGCAGCAGG - Intergenic
1152732502 17:81979244-81979266 GTTTGCTCCAGCTCAGCAGCAGG + Intronic
1155854783 18:30819638-30819660 GTTGTGTTCAGATCAGCTGCAGG + Intergenic
1157486099 18:48088389-48088411 GTTTTAGGCAGAGAAGGAGCAGG + Intronic
1159976139 18:74714293-74714315 GTTTTTTGCAGTTCAGCATCTGG + Intronic
1162493479 19:11009458-11009480 GTTCTATGATGATCAGCATCTGG + Intronic
1166826615 19:45613827-45613849 GTTTTAAGCAGAGCAGGGGCAGG - Intronic
925453059 2:3987651-3987673 CTTTTATGAAGATCAATAGCAGG - Intergenic
927199300 2:20568491-20568513 GTTTTAAGCAGAGCAGCAACAGG + Intronic
929650471 2:43675662-43675684 GTTATCTGAAGATAAGCAGCTGG - Intronic
932759961 2:74432777-74432799 GTTTTAGGCAGTTCAAGAGCAGG + Intronic
933724949 2:85421335-85421357 GTTTTCAGCAGATAAACAGCCGG + Intronic
934310859 2:91862326-91862348 GTACTATATAGATCAGCAGCTGG - Intergenic
939432756 2:142131508-142131530 CTTTTATGCTGAGCAGCACCTGG + Exonic
939892199 2:147749779-147749801 GTTTTATCTTGATCAGCTGCTGG + Intergenic
946335076 2:219030802-219030824 GCTTTATGCTCACCAGCAGCTGG + Exonic
948570752 2:238915726-238915748 GTCTCTTGCAGATCATCAGCCGG - Intergenic
1170363723 20:15576916-15576938 GTTTTATGCATAACGGCAGTTGG + Intronic
1174301273 20:49584301-49584323 GTTTTAGGAAGAAGAGCAGCAGG + Intergenic
1178085059 21:29104135-29104157 GTTTTTTGCAAATCAGTATCAGG + Intronic
1181949544 22:26544106-26544128 CTTTTGTCCAGATCACCAGCTGG - Intronic
949541711 3:5037698-5037720 ATTTTAGGCAGCTCACCAGCTGG + Intergenic
949894676 3:8760357-8760379 CATTTATGCATGTCAGCAGCTGG + Intronic
949968365 3:9379513-9379535 GTTCTATGCAGATTAACAGAAGG - Intronic
951706436 3:25548592-25548614 GTTCCATTCAGATCATCAGCAGG - Intronic
951804956 3:26633743-26633765 GTTTTATGCAGCTGAGCATGAGG + Intronic
952041343 3:29265608-29265630 GTTTTGTGCAGATCATCAGTAGG - Intergenic
952053312 3:29412911-29412933 ATTTTATATAGAACAGCAGCAGG + Intronic
956685939 3:71827389-71827411 CTCTCATGCTGATCAGCAGCAGG + Intergenic
960871358 3:122253020-122253042 GTTTTACAAAGATCAACAGCTGG - Intronic
963678216 3:148341188-148341210 GCTTTATGCCCCTCAGCAGCTGG + Intergenic
966609112 3:181850540-181850562 CCCTTATGAAGATCAGCAGCAGG - Intergenic
968861782 4:3177243-3177265 AATTTATGCAGATAAGCAGGAGG + Intronic
969442025 4:7222849-7222871 GTTTTCTGCAGAGGAGCTGCAGG + Intronic
976666730 4:87602560-87602582 GTTTTATTCAGACCTTCAGCTGG + Intergenic
977944018 4:102890276-102890298 GTACTATATAGATCAGCAGCTGG - Intronic
978259469 4:106736844-106736866 TTTTCATGCAGGTCAGCAGAAGG + Intergenic
981398047 4:144277721-144277743 ATTTTAGGCAGAAGAGCAGCAGG - Intergenic
981433508 4:144690950-144690972 GTTTTAACCAGCTCAGCAGCAGG + Intronic
981916541 4:150040014-150040036 GTCTTATGGTGATGAGCAGCAGG + Intergenic
982037124 4:151356705-151356727 GGTTATTACAGATCAGCAGCTGG - Intergenic
986785264 5:11108365-11108387 GTTTTATGCATAAAAGCAGTAGG - Intronic
993993563 5:94690513-94690535 ATTTTAGGCAGAACAGCAGAAGG + Intronic
997216127 5:132112463-132112485 GTTTTATCCAGATTATCAGTAGG - Intergenic
1000382180 5:160639041-160639063 GTTTTGTGCAGAGGAGCAGTTGG - Intronic
1001055959 5:168450133-168450155 GTCTCATGCTGATCAGAAGCCGG + Intronic
1004003878 6:11621608-11621630 GTATTTTGCAGAGTAGCAGCTGG + Intergenic
1004076422 6:12347951-12347973 GTTACATGCAGAACAGCAACAGG - Intergenic
1007839811 6:44706572-44706594 GTTTTCTGCACATCAACTGCAGG + Intergenic
1008252522 6:49257785-49257807 CTTCTATGCAGATTAGCTGCTGG - Intergenic
1011951468 6:92971233-92971255 GTTTTGTGGAGTGCAGCAGCAGG + Intergenic
1013280409 6:108631195-108631217 GTTTTATGTAGATGGGCACCTGG + Intronic
1014835729 6:126158371-126158393 ATTTTCTGCAAATTAGCAGCTGG + Intergenic
1016145186 6:140662586-140662608 CGTTTATGCAGATCAGCTGTAGG - Intergenic
1021510676 7:21428666-21428688 GTTTGTTGCAGATCAGAAGAAGG + Exonic
1024874250 7:54003851-54003873 CTTTTATACTGATCAGCTGCTGG - Intergenic
1030789361 7:113705056-113705078 GTTTTATTCAGGACATCAGCTGG - Intergenic
1033324862 7:140368986-140369008 GTTTTGTGCAGAGCAGCGGCAGG - Intronic
1037812699 8:22096401-22096423 GGTGTATGAAGAGCAGCAGCAGG + Exonic
1039239645 8:35542232-35542254 ATTTAATGCAGAACAGCAGCCGG - Intronic
1042369256 8:67972239-67972261 GTTTTATGGAGATCACCAATGGG - Intronic
1042881861 8:73502010-73502032 GTTTTTTGAATATCAGCAGAAGG - Intronic
1044632129 8:94290220-94290242 TTTTAATGTAGTTCAGCAGCAGG - Intergenic
1044668637 8:94656125-94656147 CTCTTGTGCTGATCAGCAGCGGG + Intronic
1044768621 8:95605075-95605097 CTTTTCTGCAGATCTGAAGCAGG - Intergenic
1047861490 8:128972021-128972043 CTGTTTTTCAGATCAGCAGCTGG - Intergenic
1048837088 8:138530143-138530165 GTTTTATGTATCTCAGCAGTGGG - Intergenic
1049758014 8:144319377-144319399 GATGTGAGCAGATCAGCAGCTGG - Intronic
1060902430 9:127271759-127271781 GTTTTATGAGAGTCAGCAGCTGG - Intronic
1062559843 9:137136632-137136654 ATTTTGGGCAGATCAGAAGCAGG - Intergenic
1185471751 X:387865-387887 GATTTATGCAGCTCAGAAGTAGG - Intergenic
1187871105 X:23766191-23766213 GTTCTATGCAAGTCTGCAGCTGG + Intronic
1188243320 X:27813935-27813957 GTTTTATGCACATCAGCTCCAGG + Intronic
1196465351 X:115966930-115966952 GATTTATGCAGCTCAGCACTAGG - Intergenic
1199408628 X:147493337-147493359 GTCTTATACATATCAGCAACTGG - Intergenic
1199709306 X:150457241-150457263 GTGTGGTGCAGACCAGCAGCAGG + Intronic
1202349109 Y:23968588-23968610 GCTTTATGCAAATTAGCACCAGG + Intergenic
1202521666 Y:25701516-25701538 GCTTTATGCAAATTAGCACCAGG - Intergenic