ID: 1102953854

View in Genome Browser
Species Human (GRCh38)
Location 12:117046946-117046968
Sequence TGCCAAAGCCAGAGGGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 329}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102953846_1102953854 27 Left 1102953846 12:117046896-117046918 CCTGAAATGTACACTAAACTAAG 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1102953854 12:117046946-117046968 TGCCAAAGCCAGAGGGGTCAGGG 0: 1
1: 0
2: 0
3: 26
4: 329
1102953843_1102953854 30 Left 1102953843 12:117046893-117046915 CCCCCTGAAATGTACACTAAACT 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1102953854 12:117046946-117046968 TGCCAAAGCCAGAGGGGTCAGGG 0: 1
1: 0
2: 0
3: 26
4: 329
1102953845_1102953854 28 Left 1102953845 12:117046895-117046917 CCCTGAAATGTACACTAAACTAA 0: 1
1: 0
2: 0
3: 15
4: 249
Right 1102953854 12:117046946-117046968 TGCCAAAGCCAGAGGGGTCAGGG 0: 1
1: 0
2: 0
3: 26
4: 329
1102953844_1102953854 29 Left 1102953844 12:117046894-117046916 CCCCTGAAATGTACACTAAACTA 0: 1
1: 0
2: 3
3: 76
4: 791
Right 1102953854 12:117046946-117046968 TGCCAAAGCCAGAGGGGTCAGGG 0: 1
1: 0
2: 0
3: 26
4: 329
1102953847_1102953854 -5 Left 1102953847 12:117046928-117046950 CCAATAACCAAACCTCAATGCCA 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1102953854 12:117046946-117046968 TGCCAAAGCCAGAGGGGTCAGGG 0: 1
1: 0
2: 0
3: 26
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102953854 Original CRISPR TGCCAAAGCCAGAGGGGTCA GGG Intronic
900080558 1:853898-853920 AGCCAAAGCCTAATGGGTCAGGG - Intergenic
900515955 1:3082343-3082365 GGCCAATGTCAGAGGGGTAACGG + Intronic
901850312 1:12010936-12010958 TGGCAGAGCCAGAGGGGAGATGG + Intronic
903545203 1:24119625-24119647 AGGCAAAGCCAGAGGGGTCTGGG - Intergenic
904288912 1:29471262-29471284 TGCAAAAGGGAGAGGGGCCAAGG + Intergenic
905348458 1:37327821-37327843 TGCCAGAGCCAGAGGGAGGAGGG - Intergenic
906102474 1:43272324-43272346 AGCCAGAGGCAGAGAGGTCAGGG + Exonic
906132692 1:43470315-43470337 TGCAAAAGCCAGATGGGGCATGG - Intergenic
907074718 1:51567820-51567842 TGCCAAAGCCACAAATGTCAGGG + Intergenic
907460412 1:54602203-54602225 TGCCAAGGCCACAGGGGTAAGGG - Intronic
907737430 1:57128332-57128354 TCCCAATGCCAAAGGGCTCATGG + Intronic
908705084 1:66944807-66944829 TGCCTGAGCCAGGGAGGTCAAGG - Intronic
909456437 1:75855119-75855141 TGCACAAGCCAGGGAGGTCAAGG - Intronic
912256733 1:108067270-108067292 TGCCAAAGACAGAGGTCTCAGGG - Intergenic
912789059 1:112633243-112633265 TACCAGAGGCTGAGGGGTCAGGG - Intronic
915631535 1:157156492-157156514 TGCCAGAGCCAGAAGGGCCTTGG - Intergenic
915724108 1:158005634-158005656 AGCCAAAGCCAACAGGGTCAAGG - Intronic
916170236 1:161996432-161996454 TGCCAGAGACAGAGCGGTGAAGG - Intronic
917541946 1:175922812-175922834 TGCCAAAACTATAGGGGCCAAGG - Intergenic
918151218 1:181799412-181799434 AGCCGAAGCGAAAGGGGTCAGGG + Intronic
918560083 1:185855168-185855190 AGCAAGAGCCAGAGGGGGCAGGG - Intronic
920507603 1:206527504-206527526 TTCCAGAGACAAAGGGGTCATGG + Intronic
920636472 1:207709320-207709342 TGCTTGAGCCAGAGAGGTCAAGG + Intronic
921343219 1:214154926-214154948 TGCGAAGGCCAGCAGGGTCAGGG - Intergenic
921437132 1:215136675-215136697 TCCCTAAGCCACAGGGATCATGG - Intronic
922358239 1:224796518-224796540 TGCCACTGCCTGAGGGGTAAGGG + Intergenic
923604755 1:235433092-235433114 GGCCAAGGCCAGTGAGGTCACGG + Intronic
1063374613 10:5546541-5546563 TGGCAAGGCTAGAGGAGTCAAGG + Intergenic
1064565406 10:16634068-16634090 CGCCAAAGACTGAGGAGTCATGG - Intronic
1065256309 10:23872216-23872238 TGGCAAAGGCAAAGGTGTCATGG + Intronic
1065574092 10:27101040-27101062 GGCCAAAGGCAGAGGGGTGGGGG - Intergenic
1066210000 10:33227300-33227322 TGCCAAAGACAGAGGGGAAATGG - Intronic
1070091132 10:73286637-73286659 TGCCAAGGCCAGCTCGGTCATGG + Intronic
1070799882 10:79239144-79239166 TGCCAACCTCTGAGGGGTCAGGG - Intronic
1071127536 10:82352695-82352717 TGCAAAGGCCTGAGGGGACATGG + Intronic
1071516337 10:86300445-86300467 TGACAGAGCCAGAGGGAACAGGG + Intronic
1073127543 10:101161094-101161116 GGCCAACGTCAGTGGGGTCAGGG - Intergenic
1073202560 10:101748148-101748170 GTCCAAAGCCAGAGTGGTGAAGG + Intergenic
1074090700 10:110250967-110250989 TGGCAAAGCTAGAAGGGCCAAGG + Intronic
1074211375 10:111338405-111338427 TGGCAGAGCCAAAGGGGACATGG - Intergenic
1074313808 10:112344332-112344354 AGCCAAAGCCAGTGGGGTTGGGG + Intergenic
1075138210 10:119806450-119806472 TGCCATCGCGAGAGTGGTCATGG + Exonic
1076570021 10:131426401-131426423 TAGCAAAGGCAGAGGGATCAGGG - Intergenic
1076658415 10:132039371-132039393 TGTCAAAACCGGAGGGGGCAAGG - Intergenic
1076701040 10:132272855-132272877 AGCCGAGGCCAGAGGGGTCTGGG - Intronic
1077231238 11:1459024-1459046 GGCCAGAGCCAGAGGGGGCGGGG - Intronic
1078567985 11:12433736-12433758 TGCCAAACCCAGAGAGGCCGGGG - Intronic
1078706255 11:13746921-13746943 TCCCAAAGCCTGAGGTGTCTGGG + Intergenic
1078853681 11:15188389-15188411 TGTCAAATTCAGAGGGGTCAGGG + Intronic
1083043775 11:59713597-59713619 TGCCAAGGCCAATGGGGTGATGG + Exonic
1083341010 11:61958329-61958351 AGGCATGGCCAGAGGGGTCATGG + Intronic
1084582286 11:70031636-70031658 TGCCCAAGCCAGGGGGATGAGGG + Intergenic
1084623893 11:70293531-70293553 TGCCAAAGGCAGTGGGGTAGGGG - Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085104901 11:73833938-73833960 TACCTGAGCCAGAGAGGTCAAGG - Intronic
1085361136 11:75888215-75888237 TGCCGGAGCCTGAGTGGTCAAGG - Intronic
1085531353 11:77194114-77194136 TGCCAGTGCCAGAGGGATCCAGG + Intronic
1088036795 11:105326862-105326884 TGCTGAAGCCAGAGGGGGAAAGG - Intergenic
1088500975 11:110481860-110481882 AGCCAAAAGCAGAGGGCTCATGG - Intergenic
1089149689 11:116355221-116355243 AGCAGAAGCCAGAGAGGTCAGGG - Intergenic
1089474303 11:118745956-118745978 TGCCAAACCCAAACAGGTCACGG + Intergenic
1089628169 11:119764924-119764946 TGGCTAAGCCAGAGGGTTCTGGG + Intergenic
1089689372 11:120177679-120177701 TGGAGAAGCCAGAAGGGTCAGGG - Intronic
1090289414 11:125528768-125528790 TGCCATACCCAGAGAGGGCATGG + Intergenic
1090406280 11:126477404-126477426 TGCCAAAGACAATGGGGTCTCGG + Intronic
1092002741 12:5045038-5045060 GGCCAACGGCAGCGGGGTCATGG + Exonic
1094163950 12:27422802-27422824 TGCCTAAGCCAGGGGTGGCAGGG + Intronic
1096281793 12:50261593-50261615 AGCCCAAGCTTGAGGGGTCAGGG - Intronic
1096886376 12:54723110-54723132 TGCCAAAACCGTAGGGGCCATGG - Intergenic
1097098965 12:56572728-56572750 TCTCAAAGCCAGAAGGATCAGGG - Intronic
1097264449 12:57737634-57737656 AGCCAAAGCCGGCGGGGGCAAGG - Exonic
1099676441 12:85766837-85766859 TGCCAAAGACGGAGGTTTCAAGG + Intergenic
1101572792 12:105970472-105970494 AGTAAAAGCCAGGGGGGTCAGGG - Intergenic
1102304119 12:111791816-111791838 TGCCAGAGCCTGAGAGGTCAAGG + Intronic
1102696299 12:114802333-114802355 TGCTTAAGCCTGAGAGGTCAAGG - Intergenic
1102953854 12:117046946-117046968 TGCCAAAGCCAGAGGGGTCAGGG + Intronic
1104427485 12:128690055-128690077 TGCCAAAGCCTGAGTGATAACGG + Intronic
1104492601 12:129208081-129208103 TGCTACAGCCAGGGCGGTCACGG - Intronic
1105655068 13:22427913-22427935 AGCCATAGCCAGAGAGCTCATGG + Intergenic
1105910479 13:24860959-24860981 TGCCTAAGCCCGGGAGGTCAAGG - Intronic
1106738166 13:32609454-32609476 AGCCAAAGACAGAGGGAACATGG - Intronic
1106942222 13:34791856-34791878 GGCCCAAGGCAGAGGGGTCAAGG + Intergenic
1107541483 13:41393334-41393356 TCCCAAAGGAAAAGGGGTCAGGG + Intergenic
1108162899 13:47661236-47661258 GCCCAAAGCCAGTGGGGGCAAGG - Intergenic
1108870328 13:54976677-54976699 TGCCAAAACCGTAGGGGCCAAGG + Intergenic
1110116668 13:71826012-71826034 TGCCAAAGGCAGTGGACTCAGGG - Intronic
1110220776 13:73070622-73070644 TGCCAAACCCAGAGAGGGAATGG - Intronic
1110839941 13:80130498-80130520 TGCTTGAGCCAGAGAGGTCAAGG - Intergenic
1112364392 13:98744155-98744177 TGCTTAAGCCAGGGAGGTCAAGG + Intronic
1114946314 14:27685843-27685865 TGCCAAAGACAAAAGTGTCATGG - Intergenic
1115776784 14:36724282-36724304 TGCCAAGACCTGAGGGGACAGGG - Intronic
1115797581 14:36956227-36956249 TGCCAAAGCCAGAGCAGACGGGG - Intronic
1115798340 14:36963774-36963796 TGCGCAACCCAGAGGGATCATGG + Intronic
1116624291 14:47245104-47245126 TGCCTAAGCCTGGGAGGTCAAGG - Intronic
1117467712 14:56010072-56010094 TGCCTGAGCCTGAGAGGTCAAGG - Intergenic
1118462780 14:66002138-66002160 TGTCAAAACCAGAGGCCTCAAGG + Intronic
1119853126 14:77880229-77880251 TGACAGAGCCAGGGGGGTGATGG + Intronic
1120125541 14:80737804-80737826 TGCTTGAGCCTGAGGGGTCAAGG + Intronic
1120160958 14:81143779-81143801 TGCCAGAGCAAGAGGGGTCTCGG - Exonic
1121248534 14:92482675-92482697 TGCAGAGGCCAGAGGGGACAAGG + Exonic
1121702175 14:95962811-95962833 TGCCAAAGCCAGGAAGGTCCTGG + Intergenic
1121780416 14:96618605-96618627 TGCCAAAGCCCAGGGGGACAAGG - Intergenic
1122398278 14:101450720-101450742 GGCCAGGCCCAGAGGGGTCAGGG - Intergenic
1123690707 15:22836506-22836528 AACCAAAACCAGAGTGGTCAGGG + Intergenic
1124944046 15:34246728-34246750 CGCCTGAGCCAGAGAGGTCAAGG - Intronic
1126717823 15:51539723-51539745 TGCCTGAGCCGGAGAGGTCAAGG + Intronic
1127267680 15:57374916-57374938 TGCCAAAGTGAGGGGGCTCAAGG - Intergenic
1128306622 15:66603234-66603256 TGCTTAAGCCAGGGAGGTCAAGG + Intronic
1132828168 16:1915105-1915127 TGCCAAAGCCAGAAAGTGCAGGG + Intronic
1134034831 16:11021711-11021733 TGCTTGAGCCAGAGAGGTCAAGG + Intronic
1134820578 16:17243792-17243814 TGAGAAAGTCAGAGGGGTGAGGG + Intronic
1135720552 16:24814063-24814085 TGCCAGAGCCAGAGGGGAAATGG + Intronic
1135892192 16:26367270-26367292 GGCCAAAGCCAGAATGGTCTGGG + Intergenic
1136280199 16:29203893-29203915 TGCCAGAGGCAGAGGAGCCACGG - Intergenic
1137378388 16:47974873-47974895 TGCCTGAGCCAGAGCGGTCAAGG + Intergenic
1137802495 16:51274215-51274237 TGAGAAAGCCAGTGGGGACAAGG - Intergenic
1138442355 16:57042632-57042654 GGCCAAAGCCAGAGGAGCCCAGG + Intronic
1141442902 16:84040920-84040942 GGCCAACGCCAGGGGTGTCATGG + Intronic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1142175029 16:88641142-88641164 TCCCAAAGCAAGAGGCCTCAGGG + Intergenic
1142264758 16:89058555-89058577 TGCCACTGGCAGAGGGGTCTGGG + Intergenic
1142469097 17:152827-152849 GGCCAAAGCTAGATGGGTCAAGG - Intronic
1144676687 17:17166577-17166599 GGCCAATGCCACATGGGTCAGGG + Intronic
1146353462 17:32115141-32115163 TGTCAAAGGCTGTGGGGTCAAGG + Intergenic
1147770868 17:42867089-42867111 CCCCAAGGGCAGAGGGGTCAGGG - Intergenic
1148644199 17:49210140-49210162 TGCGGCAGCAAGAGGGGTCAGGG - Intronic
1150725729 17:67649925-67649947 TGGCACACCCAGAGGGGGCACGG - Intronic
1151848809 17:76677362-76677384 AGCAGAAACCAGAGGGGTCAGGG + Exonic
1152210500 17:79000679-79000701 TGCCAGGGCCAGTGTGGTCAGGG - Intronic
1152600463 17:81259656-81259678 TGCCACAGACGGAGGCGTCAGGG + Intronic
1157660876 18:49442465-49442487 TGCCTGAGCCTGAGAGGTCAAGG + Intronic
1157896251 18:51471029-51471051 ACCCAGGGCCAGAGGGGTCATGG - Intergenic
1157947961 18:52002326-52002348 AGCAAAAGCCAGAGGACTCACGG - Intergenic
1158289063 18:55918357-55918379 TGCTGATGCCAGAGGGTTCAAGG + Intergenic
1158878064 18:61751972-61751994 AGGGAAAGGCAGAGGGGTCAGGG - Intergenic
1160009917 18:75099017-75099039 AGTCAATTCCAGAGGGGTCATGG - Intergenic
1160094839 18:75861882-75861904 TGCAGAAGGCTGAGGGGTCATGG + Intergenic
1160727014 19:621853-621875 TGCGACAGGCAGACGGGTCAGGG + Intronic
1161726593 19:5932953-5932975 TGCCAAAGGCAGATGGGACAAGG + Intronic
1162533362 19:11248583-11248605 TGCCCAGGCCTCAGGGGTCAGGG - Intronic
1163998732 19:21077444-21077466 TGCCAAAGCAAAAGGGCTCTGGG - Intergenic
1164729179 19:30489138-30489160 TTCCAAACCCAAAGGGGACAAGG + Intronic
1165328951 19:35130833-35130855 AGGCCCAGCCAGAGGGGTCAGGG - Intronic
1165759704 19:38313759-38313781 TTCAAAAGCCAGTGGGGGCAAGG - Intronic
1165806557 19:38584353-38584375 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806577 19:38584420-38584442 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806603 19:38584490-38584512 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806629 19:38584558-38584580 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806655 19:38584626-38584648 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806668 19:38584661-38584683 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165924107 19:39316521-39316543 TGCCAATGCCAGAGGCGGGAGGG - Intergenic
1165999192 19:39867795-39867817 GGGCATAGGCAGAGGGGTCAGGG + Intronic
1165999619 19:39870645-39870667 AGGCACAGGCAGAGGGGTCAGGG + Intronic
1165999630 19:39870679-39870701 GGGCAAAGGCAGAGGGGTCAGGG + Intronic
1165999723 19:39870950-39870972 GGGCAAAGGCAGAGGGGTCAGGG + Intronic
1165999749 19:39871018-39871040 GGGCACAGGCAGAGGGGTCAGGG + Intronic
1165999761 19:39871050-39871072 GGGCACAGGCAGAGGGGTCAGGG + Intronic
1166069126 19:40377296-40377318 GGGCACAGGCAGAGGGGTCAGGG + Intronic
1166069151 19:40377365-40377387 GGGCACAGGCAGAGGGGTCAGGG + Intronic
1166069178 19:40377434-40377456 GGGCACAGGCAGAGGGGTCAGGG + Intronic
1166120134 19:40681315-40681337 AGGCACAGGCAGAGGGGTCAGGG + Intronic
1166410576 19:42553583-42553605 TCAGAAAGCCACAGGGGTCAAGG - Intronic
1167697812 19:51025393-51025415 TGCCAAAGGAGGAGAGGTCAAGG - Intronic
1168406123 19:56111558-56111580 TTCCATAGCCAGAGGGGCCGGGG + Intronic
925115063 2:1371648-1371670 TGTCAAAACCAGAGGAGCCAAGG + Intergenic
926297743 2:11580879-11580901 GGCCAAGGCCAGAGGGGGCATGG + Intronic
926546410 2:14246091-14246113 TGCAAAAGCCAGATGTGGCATGG + Intergenic
927205753 2:20609324-20609346 TCCCCAAGCCAAAGGGGTCCTGG + Intronic
927666161 2:25034441-25034463 TGCCAAACCCTGAGGGGGCTCGG + Intergenic
928542856 2:32299726-32299748 TGCCTGAGCCTGAGGGGTTATGG + Intronic
929211026 2:39357433-39357455 TGCCAAGGCCAGAAATGTCAGGG - Intronic
931215092 2:60234613-60234635 TGCAAAAGCCACAGGCCTCAAGG + Intergenic
932115859 2:69046303-69046325 TGACAGGGTCAGAGGGGTCAGGG + Intronic
932202547 2:69844733-69844755 TGCTTAAGCCATAGAGGTCAAGG + Intronic
932312562 2:70755382-70755404 TGCTTTAGCCAGAGTGGTCAGGG - Intronic
932592319 2:73074840-73074862 TGGAAAGGTCAGAGGGGTCAGGG + Exonic
932918578 2:75883584-75883606 TGCCAAGGGCAAAGGGGTCAAGG + Intergenic
934047501 2:88185033-88185055 TGCCACAGCCAGAAGGCTCGGGG - Intronic
934792477 2:97073402-97073424 TGCCAAAACCACAGGAGTCCAGG + Intergenic
934814138 2:97310302-97310324 TGCCAAAACCACAGGAGTCCGGG - Intergenic
934823557 2:97398179-97398201 TGCCAAAACCACAGGAGTCCGGG + Intergenic
936083162 2:109448954-109448976 TTCCAAAGCCCAAGGGATCAGGG - Intronic
936250137 2:110862105-110862127 TGCCAAAGCGTGAGGGTTCTCGG - Intronic
936279023 2:111122173-111122195 TGCCACAGCCAGGGCGGTGACGG + Intronic
936530895 2:113276781-113276803 TGCCACCGCCGGAAGGGTCAGGG + Intronic
937008687 2:118542372-118542394 TCATAAAGCAAGAGGGGTCATGG - Intergenic
937536681 2:122897248-122897270 TGCAAAACACAGAAGGGTCATGG + Intergenic
937851710 2:126642147-126642169 TGCCAGAGCCACAGGGGTCTGGG - Intergenic
938719915 2:134057743-134057765 TGCACAAGAAAGAGGGGTCAGGG - Intergenic
939071826 2:137553339-137553361 TGTCAGAGCCATAGGGTTCAAGG - Intronic
939945894 2:148410511-148410533 TGCTTGAGCCAGAGTGGTCAAGG - Intronic
940122407 2:150281471-150281493 TGCTAGAGCCTGAGGGGCCAGGG + Intergenic
940310458 2:152273628-152273650 TGCCAAGGCCAGCTCGGTCAGGG + Intergenic
940326573 2:152431878-152431900 TGCTTGAGCCAGAGAGGTCAAGG + Intronic
940666119 2:156612073-156612095 TGCTTAAGTCCGAGGGGTCAAGG - Intronic
940835600 2:158517830-158517852 TGCCTGAGCCTGAGAGGTCAAGG + Intronic
940866907 2:158826302-158826324 TGCCAGAGCCACGGGGGACAAGG + Intronic
941151525 2:161920111-161920133 TGCCAAAGGCACAGAGGTGAGGG - Intronic
941637571 2:167951708-167951730 TGCCTGAGCCTGAGAGGTCAAGG + Intergenic
941978123 2:171427673-171427695 TGCTTTAGCCAGAGTGGTCAGGG - Intronic
946100982 2:217322943-217322965 TGCCTGAGCCTGAGAGGTCAAGG - Intronic
947009606 2:225551215-225551237 GGCCAAAGCCAGAGTGGACGTGG - Intronic
947283262 2:228480426-228480448 CGCCTAAGCCAGGGAGGTCAAGG - Intergenic
947709977 2:232307870-232307892 TGCCAAGGCCACAGAGGTCAAGG + Intronic
948740538 2:240043157-240043179 TTCCAAGGCCAGAGGAGACATGG - Intergenic
948880775 2:240856172-240856194 TGCCACAGCCAGAGGCGCCTGGG + Intergenic
1168996999 20:2140703-2140725 TGCCAGAGCTAGAGGGAGCAGGG + Intronic
1169471264 20:5887621-5887643 TGCTAAGGCCCGAGGGGGCATGG + Intergenic
1171422920 20:25030850-25030872 TGCCACAGCCAATGGGGACACGG + Exonic
1174174969 20:48638821-48638843 AGCTAAGGCCAGAGGCGTCAAGG + Intronic
1174354864 20:49990815-49990837 TGAGAAAGCCAGAGGGGGCCAGG + Intergenic
1175255088 20:57638600-57638622 TGCTTGAGCCAGAGAGGTCAAGG - Intergenic
1176167528 20:63681878-63681900 AGCCACAGACAGAGGGGTCTGGG - Intronic
1176173229 20:63705811-63705833 TGGCCAAGTCAGAGAGGTCAGGG - Intronic
1176341780 21:5705596-5705618 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1176474034 21:7137748-7137770 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1176503047 21:7618860-7618882 TGCCTGAGCCTGAGTGGTCAAGG - Intergenic
1176536101 21:8103665-8103687 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1179275606 21:39889119-39889141 TGCCAGATCCACAGGGGACAAGG - Intronic
1179654090 21:42834473-42834495 GGGCAAAGCCTGAGGGGTGATGG - Intergenic
1179906193 21:44424477-44424499 CGCCAAAGCCAGAGGCTTCCAGG - Intronic
1183147827 22:36010890-36010912 TTCCACAGACAGAGGGGTTAAGG + Intronic
1183719203 22:39552576-39552598 GGTCAAAGCCAGAGGGGTCCAGG - Intergenic
1183946737 22:41330612-41330634 TGCCCACCCCAGAGGGCTCATGG + Intronic
1184431608 22:44444430-44444452 TCCCAAAGCCAGACGGGTCTAGG - Intergenic
1184513440 22:44946129-44946151 TGCTGGAGCCAGAGTGGTCACGG + Intronic
1184816750 22:46877976-46877998 GGCCAGAGGCAGAGGGGTCCTGG - Intronic
1185124984 22:49004960-49004982 GGGCAAAGCCGGAGGGGCCAAGG - Intergenic
1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG + Intergenic
1185216198 22:49601249-49601271 GGCCAAGGCCAGGGGGCTCAGGG + Intronic
1203241047 22_KI270733v1_random:20062-20084 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
950305927 3:11915368-11915390 GGCCACAGGCAGAGGGGTCCTGG + Intergenic
950784627 3:15423798-15423820 TGCTTGAGCCAGGGGGGTCAAGG + Intronic
950876908 3:16283864-16283886 TACCAAATTCAGAGAGGTCAGGG + Intronic
952090445 3:29878510-29878532 TGCTACAACCAGAAGGGTCAAGG - Intronic
953604887 3:44405587-44405609 TGCCTAAGCCTGGGTGGTCAAGG + Intronic
954898263 3:53996110-53996132 TCCCAAAGCTAGAGGGGCTAGGG - Intergenic
958719548 3:97827092-97827114 TTGCAAAGCCTGAAGGGTCAAGG - Intronic
958889811 3:99770926-99770948 TGCCTTCGCCAGAGTGGTCAAGG + Intronic
960210212 3:114955715-114955737 AGCCAAAGTCAGAGAGGTGATGG - Intronic
960274254 3:115709226-115709248 TGCAAAAGCAAGAGGAGGCAGGG - Intronic
960303628 3:116034405-116034427 TGCCAAAGGCAGAGGGAGGATGG - Intronic
960873732 3:122276156-122276178 TGCAAAGGCCAGAGAGTTCAGGG - Intronic
961663029 3:128480471-128480493 AGCCAAAGCCAGAGTGGCCACGG - Exonic
962616394 3:137130892-137130914 TGGAGAAGCCAGAGGGATCAAGG + Intergenic
962772665 3:138627763-138627785 AGAGAAAGCCAGAGGGGTCCAGG - Intronic
963894737 3:150673269-150673291 TGCTTGAGCCCGAGGGGTCAAGG - Intronic
968054370 3:195679976-195679998 TGCCAAGACCAGCTGGGTCATGG - Intergenic
968101522 3:195969182-195969204 TGCCAAGACCAGCTGGGTCATGG + Intergenic
970184111 4:13431075-13431097 TGTGAAAGCCTGAGTGGTCATGG - Intronic
971684188 4:29743590-29743612 AGCCAAAGAGAGAGGGCTCAGGG + Intergenic
976377897 4:84365717-84365739 TGCAAAAGCCAAAGGGATCAAGG + Intergenic
977123831 4:93139208-93139230 TCCTAAACCCAGAGGGGTGAGGG + Intronic
977337456 4:95716961-95716983 TGCAAAAGCCAGATGGATCTTGG - Intergenic
977729954 4:100339242-100339264 TGGAAAAGCCAGAAGTGTCATGG + Intergenic
978752097 4:112261346-112261368 TGCTTGAGCCAGAGAGGTCAAGG + Intronic
978886590 4:113772610-113772632 CGCCAAAGCCCACGGGGTCAGGG - Intergenic
980283484 4:130752978-130753000 TGCCAAAGGCAGAGTGGACCTGG + Intergenic
985689802 5:1300917-1300939 TGCCAGAGGGAGAGGAGTCAAGG - Intergenic
985782842 5:1880082-1880104 TTCCCAAGCCAGAGAGGTCCAGG + Intronic
985992866 5:3577889-3577911 TGCCCAAGGGAGAGGGGCCATGG - Intergenic
988616148 5:32777093-32777115 TGCCAAAGCCCGAGAGGTAATGG + Intronic
989577279 5:43000269-43000291 TGCCAAACTCGGAGGGGACACGG - Intergenic
991735018 5:69623947-69623969 TGCTTGAGCCAGAGAGGTCAAGG - Intergenic
991779960 5:70122771-70122793 TGCTTGAGCCAGAGAGGTCAAGG + Intergenic
991811452 5:70479082-70479104 TGCTTGAGCCAGAGAGGTCAAGG - Intergenic
991859247 5:70998201-70998223 TGCTTGAGCCAGAGAGGTCAAGG + Intronic
991872407 5:71123094-71123116 TGCTTGAGCCAGAGAGGTCAAGG + Intergenic
992173191 5:74124160-74124182 TGCCAAAGACAGTGAGCTCATGG + Intergenic
993324690 5:86518672-86518694 TGTCAAAGCCAAAAGGATCAAGG + Intergenic
993638972 5:90379903-90379925 TGCCACTGCCTGAGGAGTCAAGG - Intergenic
994017913 5:94989894-94989916 TGTCACAGCCAGAGAGGGCATGG + Intronic
997845058 5:137278591-137278613 TCCCAAAGGCTGCGGGGTCAAGG + Intronic
998704251 5:144740600-144740622 TGCCAAAGCCTAAGGATTCAAGG + Intergenic
1001054055 5:168434909-168434931 TGCCAAAGTGAGAGGAGGCAAGG - Intronic
1001986335 5:176076629-176076651 TGCCCAGGCCAGAGGCATCAGGG + Intronic
1002230533 5:177761495-177761517 TGCCCAGGCCAGAGGCATCAGGG - Intronic
1002264803 5:178022253-178022275 TGCCCAGGCCAGAGGCATCAGGG + Intronic
1002476991 5:179472668-179472690 TGGCAAAGCCAGAAGGGAGATGG + Intergenic
1002907543 6:1462986-1463008 TGCCCAAGCCAGAGGTGCAATGG - Intergenic
1003468029 6:6400032-6400054 TGCAAAAACCAGATGGATCATGG + Intergenic
1004590853 6:17050392-17050414 TGCCAGAGGCAGAGGAGCCAGGG - Intergenic
1005392129 6:25344390-25344412 TGACCAAGCCTGAGGGGTCAAGG - Intronic
1006408162 6:33857035-33857057 TGCCAAGACCAGAGAGGGCAAGG + Intergenic
1007335394 6:41151685-41151707 TGATAAGGCCAGAGGGGTGAGGG - Intronic
1009424942 6:63503830-63503852 CACCAGAGCCTGAGGGGTCAAGG + Intergenic
1010008363 6:71021884-71021906 TGCCATAGGCAGAGGGGTATAGG - Intergenic
1011197224 6:84793979-84794001 TGCAAAAACCAGATGGATCATGG + Intergenic
1013343288 6:109236293-109236315 AGCCCAGGCCAGAGGAGTCATGG + Intergenic
1013470614 6:110460770-110460792 TGCCAAAGTCAGAGTGGTTGTGG - Intronic
1014912691 6:127113202-127113224 TCCCTAAGCCCGAGGAGTCAAGG + Intergenic
1018465002 6:164035823-164035845 TCCCAGAGCCACAGTGGTCAGGG + Intergenic
1020126425 7:5534995-5535017 TGCCTGAGCCTGAGGGGTCGAGG + Intronic
1020219251 7:6222215-6222237 TTCCAAAGGCAGAGATGTCAAGG + Intronic
1020694105 7:11393068-11393090 AGTCAAAGACACAGGGGTCAGGG - Intronic
1021009408 7:15443034-15443056 TGGCGAAGCCAGAGGGGAGATGG - Intronic
1021941989 7:25687100-25687122 AGCCAAAACCAGAAGGGTGATGG + Intergenic
1022108810 7:27215158-27215180 TTCCCAAGCAAGAGGGGACAGGG + Intergenic
1022279495 7:28891630-28891652 TGACAAAGCCTGAGGGATGAAGG - Intergenic
1022446281 7:30473248-30473270 GGCCAAAGCCACTGGGGTAAAGG + Intronic
1023611486 7:41976101-41976123 TGCCAAAAGCAGAGGGGAGAGGG - Intronic
1023665804 7:42522213-42522235 CACCAAAGCCAGAGGGGTTTGGG - Intergenic
1025077515 7:55955846-55955868 TGCTAGAGCCAGGGAGGTCAAGG - Exonic
1025818924 7:64945511-64945533 AGCCAGAACCAGAGGGGGCAGGG - Intergenic
1027254895 7:76425028-76425050 TGCAAGAGCCAGAGGGGTTGGGG - Exonic
1029312191 7:99677728-99677750 TGCCAAAGCCAGGGTGGCCTTGG + Intronic
1029961130 7:104690143-104690165 TGCCAAAGACAGATGGATCTTGG + Intronic
1030874319 7:114794380-114794402 TGCCAAAGCCAGATGGTGAATGG + Intergenic
1033636405 7:143215386-143215408 TGCAGAAGCCAGAGACGTCAAGG + Intergenic
1034510435 7:151530042-151530064 TGCTTGAGCCAGAGAGGTCAAGG - Intergenic
1035082306 7:156226943-156226965 GGCAAGTGCCAGAGGGGTCAGGG + Intergenic
1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG + Intronic
1037244485 8:16817295-16817317 TGCCTTAGCCAGGGAGGTCAAGG - Intergenic
1037340051 8:17834961-17834983 TGTGAAAGACAGAGAGGTCAAGG - Intergenic
1037581722 8:20249490-20249512 TGGGAAAGCCAGAGGAGTCAGGG + Exonic
1037953469 8:23034850-23034872 TGCCAAAGACAGATGGATCTTGG + Intronic
1039789962 8:40867620-40867642 TGCCAAATCCAGTGGCCTCAAGG - Intronic
1040422375 8:47252235-47252257 TGGCAAAGCCACAGGGATGAAGG + Intergenic
1042541789 8:69914815-69914837 CGCCAGAGCCTGAGAGGTCAGGG + Intergenic
1043598836 8:81915660-81915682 CGCCTAAGCCACAGTGGTCAGGG + Intergenic
1045391636 8:101721003-101721025 TGCCCAACCCAAAGGGGGCATGG + Intronic
1045623109 8:104005865-104005887 TGACAAAGCTAGTGGAGTCATGG + Intronic
1049028555 8:140014817-140014839 TGCCAATGTCAGAGGGTTCTCGG + Intronic
1049257636 8:141622405-141622427 TGCCAGAGACAGAGGGGTGGTGG - Intergenic
1049487685 8:142875016-142875038 TGCCAAAGCCAAAGGGCACGTGG + Exonic
1049492458 8:142912589-142912611 TGCCAAAGCCAAAGGGCACGTGG + Exonic
1050916376 9:11139969-11139991 TACCAAAGGCTGAGGGGGCAGGG - Intergenic
1050974624 9:11921529-11921551 TGCCTATGCCAGAGGTGTCCTGG - Intergenic
1051631988 9:19149004-19149026 TGCCAAAGCCAGAGGGCCACAGG - Intronic
1051679875 9:19596110-19596132 TGCAAAAGCCAGAGTGGAGAGGG + Intronic
1051995556 9:23212050-23212072 TGGCAAAGCTGTAGGGGTCAAGG - Intergenic
1053131570 9:35618511-35618533 GGCCAGGGCCAGAGGGGCCACGG + Intronic
1053206869 9:36193756-36193778 GGCAAAAACCAGAGGGGTTAGGG + Intronic
1057428176 9:94971093-94971115 CCCCAGAGCCAGAGGGCTCAGGG - Intronic
1057820872 9:98329566-98329588 GGCCCAAGCCACAGGGCTCAGGG - Intronic
1058538987 9:105992504-105992526 CTACCAAGCCAGAGGGGTCATGG + Intergenic
1060005140 9:119993105-119993127 TGCCAAAGCCAGACCGCTTAGGG - Intergenic
1060541308 9:124432302-124432324 TGCAAAAGCCACATGGATCATGG - Intergenic
1060553297 9:124495736-124495758 GGCCAAAAGCAGATGGGTCACGG + Intronic
1060613850 9:124993180-124993202 TTATAAAGCCAGAGGGGTCCAGG - Intronic
1062285182 9:135769670-135769692 TGCCCAAGGCACAGGGGCCAGGG + Intronic
1203457373 Un_GL000220v1:3149-3171 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1185956889 X:4500847-4500869 AGACAAACCCAGATGGGTCATGG - Intergenic
1187257149 X:17654044-17654066 TCCCAAAGCCTTAGGGGTCCAGG + Intronic
1188020974 X:25157257-25157279 TGCTTAAGCCAGGGAGGTCAAGG - Intergenic
1188056545 X:25547701-25547723 GGCCAAGGCTAGAGAGGTCATGG + Intergenic
1189237874 X:39502174-39502196 TGCTGTAGGCAGAGGGGTCAGGG + Intergenic
1191255337 X:58277209-58277231 TGCCTGACCCAGGGGGGTCATGG - Intergenic
1194424602 X:93721134-93721156 TGCAAAAGCCAGATGGATGATGG - Intergenic
1195683487 X:107565609-107565631 TGCCTGGGCCAGAGAGGTCAAGG + Intronic
1195953152 X:110299705-110299727 TGCCAAGGTCTGAGGGGTGAGGG - Intronic
1197703997 X:129620673-129620695 TGCCAAGGCCTCAGGGGGCAGGG - Intergenic
1199033117 X:143024233-143024255 TGCCAAAGATAGAGGAGGCATGG - Intergenic
1200117308 X:153775000-153775022 AGCCCAAGCCTGAGGGGCCAGGG + Exonic
1201745302 Y:17365772-17365794 TGACAAACCCAAATGGGTCATGG - Intergenic