ID: 1102955239

View in Genome Browser
Species Human (GRCh38)
Location 12:117054636-117054658
Sequence GAAACTGGGGTGCTGCTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102955239_1102955252 13 Left 1102955239 12:117054636-117054658 CCCGTGAGCAGCACCCCAGTTTC 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1102955252 12:117054672-117054694 GGAGGCTCAGCACCTTGTCCAGG 0: 1
1: 0
2: 4
3: 27
4: 429
1102955239_1102955245 -9 Left 1102955239 12:117054636-117054658 CCCGTGAGCAGCACCCCAGTTTC 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1102955245 12:117054650-117054672 CCCAGTTTCCAGTGGGACCCTGG 0: 1
1: 0
2: 2
3: 12
4: 212
1102955239_1102955248 -5 Left 1102955239 12:117054636-117054658 CCCGTGAGCAGCACCCCAGTTTC 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1102955248 12:117054654-117054676 GTTTCCAGTGGGACCCTGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 177
1102955239_1102955253 14 Left 1102955239 12:117054636-117054658 CCCGTGAGCAGCACCCCAGTTTC 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1102955253 12:117054673-117054695 GAGGCTCAGCACCTTGTCCAGGG 0: 1
1: 1
2: 9
3: 145
4: 825
1102955239_1102955247 -8 Left 1102955239 12:117054636-117054658 CCCGTGAGCAGCACCCCAGTTTC 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1102955247 12:117054651-117054673 CCAGTTTCCAGTGGGACCCTGGG 0: 1
1: 1
2: 2
3: 12
4: 169
1102955239_1102955255 28 Left 1102955239 12:117054636-117054658 CCCGTGAGCAGCACCCCAGTTTC 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1102955255 12:117054687-117054709 TGTCCAGGGTCCCACATCCCTGG 0: 1
1: 0
2: 3
3: 40
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102955239 Original CRISPR GAAACTGGGGTGCTGCTCAC GGG (reversed) Intronic
901336127 1:8450793-8450815 GAGACTTTGGTGCTGGTCACAGG - Intronic
902695959 1:18141035-18141057 GAGACTGGGGTGCTTCACTCTGG - Intronic
902741861 1:18444364-18444386 GAAACTGGGGTGATACACAAGGG - Intergenic
902826224 1:18976198-18976220 GAAACTGGGGAGGTGATCCCAGG + Intergenic
903115881 1:21177645-21177667 GACATTGGGGAGCTGATCACTGG - Intergenic
908935004 1:69364271-69364293 GAAACTGGCCTACAGCTCACAGG + Intergenic
913697702 1:121343744-121343766 GGAATTGAGGTGCTGCTCCCTGG + Intronic
914139854 1:144936307-144936329 GGAATTGAGGTGCTGCTCCCTGG - Intronic
916505684 1:165426248-165426270 GAAACTGGGGTGAAGATTACTGG + Intronic
920485094 1:206362394-206362416 GGAATTGAGGTGCTGCTCCCTGG + Intronic
920556934 1:206910677-206910699 GAAACTAAGGTGCTGAACACCGG - Intronic
920570255 1:207010995-207011017 GATACTGGAGTGGTTCTCACAGG + Intronic
924281348 1:242440306-242440328 GAAAGTTGGTTGCTGGTCACAGG + Intronic
1064148969 10:12847625-12847647 GACACTGAGGTGCTGCTATCTGG - Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1068645753 10:59465233-59465255 GAAACTGCTGTGCTGCCCTCTGG + Intergenic
1069684296 10:70307952-70307974 GCATCTGGGCTGCTGCTCAGCGG - Intronic
1071509128 10:86250338-86250360 GAAACGGAGGGGCTGCTCAAAGG - Intronic
1073500404 10:103931913-103931935 GAAGCTGGGTCGCTGCTGACTGG + Intergenic
1074529792 10:114289267-114289289 AAAGCTGTGGTGGTGCTCACAGG + Exonic
1074745901 10:116532030-116532052 GAAAATGGGATGGTGCTAACAGG + Intergenic
1076370406 10:129949379-129949401 GAGCCTGGGATGCTGCTCACTGG - Intronic
1076501692 10:130942182-130942204 GACCCTGGTGTGCTGGTCACAGG - Intergenic
1076887248 10:133268423-133268445 GAAACTGGCAGGGTGCTCACGGG + Intronic
1078413432 11:11146572-11146594 GCAAATGGTGTGCTGCTCCCTGG - Intergenic
1078421924 11:11219539-11219561 GAAACTGGGGGGACGCTCACTGG - Intergenic
1079172850 11:18112792-18112814 GAAGGTGGGCTGTTGCTCACTGG - Intronic
1081655551 11:44854709-44854731 GAAACAGGGCTCCTGCACACAGG - Intronic
1083158817 11:60842179-60842201 GAAACTGAGGTGAGGCTCTCGGG - Exonic
1084671888 11:70611894-70611916 GAAACTGGGCTGCTGCTGAAAGG + Intronic
1089215158 11:116830533-116830555 GGACCTGGGGTGCCCCTCACAGG + Intronic
1089920086 11:122201385-122201407 GAAAATTGGGTTCTGCACACTGG - Intergenic
1091772437 12:3161628-3161650 GGGGCTGGGGAGCTGCTCACTGG - Intronic
1092302449 12:7264807-7264829 GCACCTGGGGTTCTGCCCACTGG + Intergenic
1096111252 12:49030632-49030654 GGAAGTGGGGCGCTGCCCACTGG - Exonic
1102955239 12:117054636-117054658 GAAACTGGGGTGCTGCTCACGGG - Intronic
1105631038 13:22168655-22168677 GAACCTGGGCTGCTGCGCAGAGG + Intergenic
1106895903 13:34302226-34302248 GAAACTGGAGTTCTGACCACTGG - Intergenic
1108845149 13:54669344-54669366 GAAACTGGGCTGCAACACACAGG + Intergenic
1112327249 13:98450085-98450107 GAAGCAGAGGTGCTGGTCACAGG - Intronic
1112568424 13:100570819-100570841 GAGACTGGGGTGCTGCTATAAGG + Intronic
1117313436 14:54551049-54551071 GAGGCTGGGGTGATGCTCACAGG - Intergenic
1120847006 14:89134916-89134938 GAAACTGGGGTGCTGATTTCTGG + Intronic
1122599065 14:102912357-102912379 GACCCTGGGGTGCTGCTCCTAGG - Intergenic
1124624009 15:31297838-31297860 GAGACTGGAGTGGTGCACACAGG - Intergenic
1131067777 15:89444912-89444934 GGAAGTGGGATGCTGCTCAAAGG - Intergenic
1132675333 16:1119021-1119043 GAGGCTGGGCAGCTGCTCACAGG - Intergenic
1132949184 16:2551023-2551045 GAATCTGGTGGGCAGCTCACAGG - Intronic
1132965404 16:2651105-2651127 GAATCTGGTGGGCAGCTCACAGG + Intergenic
1135665679 16:24333914-24333936 GAGGCTGGGGTTCTGCTCCCAGG - Intronic
1141152028 16:81570818-81570840 GAAACAGAGGTCCTGATCACTGG - Intronic
1146126066 17:30232599-30232621 GAAGCTGGGGAGCTGCTGCCAGG + Intronic
1147185471 17:38711078-38711100 AACACTGGGGAGCTGCCCACTGG + Intronic
1148213912 17:45824236-45824258 GAAACAGGGCTGGTGCTCAGAGG + Intronic
1149659432 17:58326650-58326672 GAGACTGGGGTGCTGCGTTCTGG - Intronic
1151808644 17:76422656-76422678 GAAACTTGGGTGCAGCTATCTGG - Intronic
1153341593 18:3980320-3980342 GGAACTGGGCTGCTCCTCCCAGG - Intronic
1153468298 18:5414777-5414799 GAAACTGCTGGGCTGTTCACTGG + Intronic
1157589983 18:48830594-48830616 TAAACTGAAGTGCTGCTTACTGG + Intronic
1158093309 18:53740900-53740922 GTAATTGGGGTGCTGCTCCCTGG + Intergenic
1158385677 18:56988343-56988365 TCAACTGGAGTGCTGCACACAGG - Intronic
1164146577 19:22516290-22516312 GACACAGAGGTGCTGCCCACTGG + Intronic
1164841262 19:31394193-31394215 GAAACTGAGGTGCTGGCCAGGGG + Intergenic
1165662665 19:37595146-37595168 GATACCGGGTTGCTGCTCAACGG + Intronic
1165687156 19:37831631-37831653 GAAGCTGAGTTGCTGCTCTCTGG - Intergenic
1166556104 19:43700726-43700748 GAAACTGGGTTGCTCACCACAGG + Intergenic
1167529050 19:50003433-50003455 GACCCTGAGCTGCTGCTCACGGG + Intronic
1167600316 19:50451153-50451175 GGAACTGGGGTGCTGGAGACAGG - Intronic
925184123 2:1835674-1835696 CAAACAGGGCTGCTGGTCACCGG + Intronic
925770221 2:7274876-7274898 GAAAATGGAGTGGTGGTCACTGG - Intergenic
927932755 2:27055813-27055835 GGAACTGGGCTGGTGCTCAGAGG - Exonic
930817882 2:55617679-55617701 GAAGCGGAGGTGCTGCTCATGGG - Intronic
932750203 2:74366651-74366673 GAAACTGTGGTGCTGAACCCAGG - Intronic
934607889 2:95711785-95711807 GTAACTGGGAGTCTGCTCACAGG + Intergenic
934656374 2:96118518-96118540 GAGTCTGGGGAGCTGCTCACTGG - Intergenic
936397870 2:112142642-112142664 GAGACTGCGGTGCTCCTCATGGG + Intronic
936541231 2:113353673-113353695 GTAACTGGGAGTCTGCTCACAGG + Intergenic
936686861 2:114837618-114837640 GAAACTGGGGAGCAGCTAAGTGG + Intronic
938199306 2:129360179-129360201 GAAGCTGGGCTGCTGGTCACAGG + Intergenic
939128539 2:138205916-138205938 GAGACGGGGGTGCTGCTGAAAGG - Intergenic
948428376 2:237902494-237902516 GAAAGTGGGGTCCTGCCCCCAGG + Intronic
948602290 2:239114224-239114246 GAAGCTGGGGAGGTGCTCAACGG + Intronic
948813687 2:240499096-240499118 GCACCTGGGGTGTTGCTCAGTGG + Intronic
1169266071 20:4168049-4168071 GAAGCTGGGGAGCTGCTCCAGGG - Intronic
1169473411 20:5908509-5908531 GAAAGTGTGGTGCTGCTTCCAGG + Intergenic
1171049283 20:21840352-21840374 GCATCTGGGGTGCTGTTCCCTGG - Intergenic
1173528414 20:43750186-43750208 GACAGTGGGGTGCTGGTCAGGGG + Intergenic
1174454430 20:50639387-50639409 GAAAGAGGGGTTCTGCTCAGCGG - Intronic
1174467458 20:50729262-50729284 AGAGCTGGGGTGCTGCTCCCAGG + Intergenic
1176027110 20:62991433-62991455 GAACCTGAGCTGCTGCTCAGAGG + Intergenic
1179622832 21:42630150-42630172 GCAACTTGGGTGCTTCTCAGTGG + Intergenic
1179959857 21:44762107-44762129 GAGACTGGGGTGCTGGCCAATGG - Intergenic
1180891852 22:19294492-19294514 CTAGCTGGGGTGATGCTCACAGG + Intergenic
953339762 3:42123483-42123505 GATCCTGGGGTGCTCCACACGGG - Intronic
953916110 3:46922196-46922218 GAAGGTGGGGTCCTGCCCACTGG - Intronic
955066186 3:55535517-55535539 GAAACTGAGGTTCTGATGACTGG + Intronic
956158913 3:66326849-66326871 GAGTCTGTGGTGCTGCTGACAGG + Intronic
956571162 3:70696868-70696890 GAAAGTGGGGTGCTGCTATAGGG - Intergenic
957855914 3:85877891-85877913 GAAACAAGGTTCCTGCTCACAGG + Intronic
959704547 3:109327908-109327930 GATTCTGCGGTGCTGCTGACAGG - Exonic
961510393 3:127397780-127397802 GAAACTGACTTGCTGCTCAGGGG + Intergenic
966512647 3:180781489-180781511 CTAACTGGGGTGCTTCTCAGTGG - Intronic
968672575 4:1859642-1859664 GAAAGTGGGATGCTCCACACAGG + Intergenic
968834964 4:2956645-2956667 GAGGCTGGGGTGCTGTGCACGGG - Intronic
970758802 4:19457282-19457304 GAAAGGGGACTGCTGCTCACCGG + Intergenic
983702502 4:170615061-170615083 GAAGCTGGGGTGCTGGTATCTGG + Intergenic
985513136 5:323066-323088 GACTCCTGGGTGCTGCTCACGGG - Intronic
985515500 5:342847-342869 GATACTGGGCTGCTCCTCAGGGG + Intronic
985547431 5:516850-516872 GAAGTAGGTGTGCTGCTCACTGG + Intronic
985892486 5:2726436-2726458 GAAACTGGGCTTCTGGTCCCAGG + Intergenic
986086251 5:4453284-4453306 GATACCTGGCTGCTGCTCACCGG + Intergenic
987104025 5:14619133-14619155 GAAACTGTGGTTCTGCTCTGGGG - Intergenic
987622100 5:20347584-20347606 TAAGCCAGGGTGCTGCTCACAGG + Intronic
988688687 5:33550114-33550136 GAACCTGGGCTGCTGCACAAGGG - Intronic
990188783 5:53234758-53234780 GAAACTGGCTTCCTGCTCAAAGG + Intergenic
992110010 5:73484062-73484084 GAAACTGGGGAAATGATCACAGG + Intergenic
993607427 5:90009900-90009922 GGAATGGGGGTGGTGCTCACTGG + Intergenic
996597904 5:125226391-125226413 GAAAGTGGGGTGCTTCTATCTGG + Intergenic
998037663 5:138930652-138930674 GGGGCCGGGGTGCTGCTCACCGG - Exonic
999787531 5:154905443-154905465 GAAACTGGAGTGCAGATAACTGG + Exonic
999928522 5:156405801-156405823 GAAACTGTGGTCCTGCCCCCAGG - Intronic
1001949439 5:175806016-175806038 GAATCTGGGGTGCTCTTAACAGG - Intronic
1002445469 5:179287673-179287695 GAGACTGGGGACCTGCTCTCCGG - Intronic
1003173946 6:3741074-3741096 GAGACTGGGGTGCTGCCCAAGGG - Intronic
1004329823 6:14711168-14711190 AGTACTGGGGTGCTGCACACAGG + Intergenic
1006148172 6:31971513-31971535 GGAACTGGGCTGCTTCTCCCTGG - Exonic
1006181182 6:32154269-32154291 GGGCCTGGGCTGCTGCTCACGGG + Exonic
1006583321 6:35089038-35089060 GGAACTTGGGTGCAGCTCAGTGG + Exonic
1006781307 6:36634250-36634272 GAAATGGATGTGCTGCTCACAGG - Intergenic
1009306639 6:62099323-62099345 GAAACTGTGGTAGTGATCACAGG - Intronic
1009344045 6:62591554-62591576 GAAAATGGGGGGCTGTTCTCTGG - Intergenic
1013416991 6:109934139-109934161 GAACCTGGTGTGCTCCTCAGGGG + Intergenic
1014230926 6:118901176-118901198 GATACTGAGGTGCTATTCACAGG - Intronic
1015360340 6:132332294-132332316 CAAACTTGGGTACTGATCACGGG + Intronic
1019049647 6:169173275-169173297 GAAACTGGGGTGTGGACCACGGG + Intergenic
1021292562 7:18864377-18864399 GAAAATGGGGAGTTGCTCAAAGG + Intronic
1021292571 7:18864452-18864474 GAAAATGGGGAGTTGCTCAAAGG + Intronic
1023705517 7:42937472-42937494 GAGACTGTGGTGCTGTACACGGG + Exonic
1024296069 7:47843350-47843372 GCTTGTGGGGTGCTGCTCACTGG - Intronic
1029270392 7:99374152-99374174 GAAACAGGGGTGCTGTCCCCGGG - Intronic
1033497849 7:141917589-141917611 GAAACTGGGGTGTTGAGAACTGG + Intronic
1035236484 7:157500789-157500811 GAACCCGGGGTGCTGGCCACTGG - Intergenic
1036967072 8:13311754-13311776 GATATTTTGGTGCTGCTCACAGG + Intronic
1039350203 8:36755999-36756021 GAGACAGAGGTGTTGCTCACAGG + Intergenic
1039759944 8:40563843-40563865 GAAACTGGGGTGATGCTGGTAGG + Intronic
1040510029 8:48085108-48085130 CAGGCTGGGGTACTGCTCACAGG + Intergenic
1045703736 8:104896616-104896638 GAAACTGGGGTGCAGAGCAGTGG - Intronic
1047497498 8:125419055-125419077 GAGACTTGGGAGATGCTCACTGG + Intergenic
1049379830 8:142306448-142306470 GGGACTGGGATGCTGCTCACTGG + Intronic
1056678435 9:88696583-88696605 TAAACTCTGGTGCTGATCACTGG - Intergenic
1058397557 9:104572083-104572105 AAAGCTGGGGTGATGCTGACAGG - Intergenic
1059710266 9:116861576-116861598 AAAACTGGGGTGCTGGCAACAGG - Intronic
1061276500 9:129571922-129571944 GAATAGCGGGTGCTGCTCACAGG - Intergenic
1062502863 9:136858736-136858758 GAAACTGGCGTGCTGGGCCCCGG + Exonic
1189478647 X:41376344-41376366 GGTCCTGGGATGCTGCTCACAGG - Intergenic
1196930530 X:120676960-120676982 GAGAGTGGGGTGCTGCTCTAAGG - Intergenic