ID: 1102960256

View in Genome Browser
Species Human (GRCh38)
Location 12:117088130-117088152
Sequence CTGTATGCCCAAACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102960249_1102960256 23 Left 1102960249 12:117088084-117088106 CCGAGGTCCATGACTTTAGATTC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1102960256 12:117088130-117088152 CTGTATGCCCAAACTGAGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 135
1102960250_1102960256 16 Left 1102960250 12:117088091-117088113 CCATGACTTTAGATTCTATTTGC 0: 1
1: 0
2: 0
3: 17
4: 261
Right 1102960256 12:117088130-117088152 CTGTATGCCCAAACTGAGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102960256 Original CRISPR CTGTATGCCCAAACTGAGGA GGG Intronic
901970509 1:12903910-12903932 CTGTCTCCCCAATCTGGGGATGG + Intronic
902014656 1:13297859-13297881 CTGTCTCCCCAATCTGGGGATGG - Intergenic
902135190 1:14299105-14299127 CTGTATCCCAGAACTGAGGATGG - Intergenic
902324611 1:15691550-15691572 CTGTCTGCCCAAACCGAAGTGGG - Intronic
903766392 1:25737564-25737586 CTCTGTGCCCAGCCTGAGGATGG + Intronic
904656166 1:32049310-32049332 CTGTAATCCCAAACTTTGGAAGG - Intronic
907007313 1:50928478-50928500 CTGTATTTAAAAACTGAGGAAGG + Intronic
913647593 1:120873862-120873884 CTGTATCCCCATACTTTGGAAGG - Intergenic
914079045 1:144388998-144389020 CTGTATCCCCATACTTTGGAAGG + Intergenic
914100134 1:144577504-144577526 CTGTATCCCCATACTTTGGAAGG - Intergenic
914173949 1:145257545-145257567 CTGTATCCCCATACTTTGGAAGG + Intergenic
914298856 1:146360178-146360200 CTGTATCCCCATACTTTGGAAGG + Intergenic
914528609 1:148498730-148498752 CTGTATCCCCATACTTTGGAAGG + Intergenic
914637783 1:149568377-149568399 CTGTATCCCCATACTTTGGAAGG - Intergenic
914755430 1:150559331-150559353 CTGTGTATCCAAACTGGGGACGG + Exonic
917967361 1:180187062-180187084 CTGCAGACCCACACTGAGGAGGG - Intronic
920045537 1:203129931-203129953 CTGGACACCCACACTGAGGACGG - Intronic
920732711 1:208502994-208503016 CTTTATGCCTAAAATGAAGATGG + Intergenic
1062895700 10:1101582-1101604 CTGTGTGAACAAACTGCGGAGGG - Intronic
1062900313 10:1139458-1139480 ATGTATGACCAAAGTGGGGAAGG + Intergenic
1063494605 10:6495304-6495326 CTGGAAGCCCACACTGGGGAAGG - Intronic
1067981217 10:51087648-51087670 CTGTATACCCATACTCATGATGG + Intronic
1068252548 10:54462634-54462656 CTGTATTTCCAGACTGGGGAAGG - Intronic
1070431103 10:76338536-76338558 CTTGATGCCTAAACTAAGGATGG - Intronic
1070452752 10:76578547-76578569 GTGTATGCCCAACCTAAGGGAGG - Intergenic
1077098675 11:811209-811231 CTGTAGTCCCAGACTGAGGTGGG + Intronic
1077621301 11:3727144-3727166 CTTTATACCCAAACTGGGTAGGG + Intronic
1083144227 11:60746705-60746727 CTGTAGGCCCAGACTAAGCAAGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1093010406 12:14101338-14101360 CTGAGTGCCCAAACTGTGGAAGG + Intergenic
1094866858 12:34544232-34544254 CAGTATTTCCAAACTGATGAAGG + Intergenic
1098204918 12:68098496-68098518 ATGTATCCACAAACCGAGGAAGG - Intergenic
1098368110 12:69727100-69727122 GTCTTTGCCCAAACTGATGACGG + Intergenic
1100264016 12:92958731-92958753 TTGTATGCCCATACTGATCAAGG + Intergenic
1102960256 12:117088130-117088152 CTGTATGCCCAAACTGAGGAGGG + Intronic
1103228148 12:119305532-119305554 GTGCCTGCCCACACTGAGGATGG - Intergenic
1104455833 12:128911446-128911468 CTGTATCCCTACACCGAGGAAGG + Intronic
1105627833 13:22130522-22130544 CTGCATGCCCAAAATGATGGTGG + Intergenic
1106401821 13:29438506-29438528 CTGTATCCTCACACGGAGGAAGG + Intronic
1108613955 13:52112752-52112774 CTTTATGCCCAAATTCAAGAAGG - Intronic
1111017280 13:82397876-82397898 CTGTCTGCCCAAACCAAGAAAGG + Intergenic
1111727728 13:92033745-92033767 ATCAATGCTCAAACTGAGGAAGG - Intronic
1111795057 13:92908809-92908831 CTGTAGTCCGAAACTGGGGAGGG + Intergenic
1114388239 14:22278199-22278221 TTGGATGCCCACACTGAAGATGG + Intergenic
1115855160 14:37622655-37622677 CTGCATGGCCAAAGAGAGGAAGG + Intronic
1116277323 14:42852278-42852300 TTGTATCCCCAAAATAAGGAGGG + Intergenic
1120622988 14:86789047-86789069 CTGTATTCCAAAAGGGAGGAGGG - Intergenic
1124137953 15:27051580-27051602 CTGTGTCCCCACACAGAGGAAGG - Intronic
1124878502 15:33619695-33619717 CTGCAGGCCCAAGCTGGGGAAGG - Intronic
1128224408 15:65992007-65992029 CTGTCTGCTAAAACTGGGGAGGG + Intronic
1128643129 15:69354794-69354816 GTGTCTGCCCACACTGAGGGTGG - Intronic
1133097828 16:3458937-3458959 CTGTGTGCCCAAACGGAGACAGG + Intronic
1141336064 16:83156501-83156523 CTGTGTGTCCAAGCTGATGAAGG + Intronic
1142715590 17:1745373-1745395 CTGGTTGCCCAACTTGAGGAGGG - Exonic
1143115817 17:4581452-4581474 CTGAATCCCCCAACTGAGGTGGG - Intergenic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1143609707 17:8010962-8010984 CTGTCTTCCCTAACTGAGGGAGG + Intronic
1147212185 17:38878076-38878098 CTTTATGCCAGAACTGGGGATGG - Exonic
1148961032 17:51392940-51392962 CTGTGTGCCCAAATTGACTACGG - Intergenic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1150468750 17:65417767-65417789 CTCAGTGCCCAAACTAAGGATGG + Intergenic
1150481918 17:65517325-65517347 CTGTAACCCCAGCCTGAGGAAGG - Intergenic
1152589273 17:81203435-81203457 CTACATGCCCTAACTGAGGTCGG + Intronic
1153057076 18:956363-956385 CTGGATGGCTAAACTGGGGAAGG + Intergenic
1153454247 18:5262396-5262418 GTGAATGCCCATAGTGAGGATGG + Intergenic
1157544441 18:48538323-48538345 CTGTATGCCCCAACAGGGAAGGG - Intergenic
1157693425 18:49701759-49701781 CTTTCTGCCTAGACTGAGGAAGG - Intergenic
1159915836 18:74186982-74187004 GTGTCAGCCCCAACTGAGGATGG - Intergenic
1160879515 19:1313115-1313137 CTGTATGCCCATGCTGCAGAGGG - Intergenic
1162566271 19:11447075-11447097 CTGTGTGTCCCCACTGAGGAGGG - Exonic
1162874422 19:13610217-13610239 CTGTTTGCCCAACCTCAGCACGG + Intronic
1164064751 19:21706357-21706379 CTGGCTCCACAAACTGAGGAGGG - Intergenic
1165003838 19:32788232-32788254 CTGTAATCCCAGACTGAGGCAGG - Intronic
925993758 2:9275190-9275212 CTGTAATCCCAGGCTGAGGAGGG - Intronic
934781939 2:96975868-96975890 CTGTATTCCCAAACTTTGGGAGG - Intronic
934983784 2:98869549-98869571 CTGCATTCCCCATCTGAGGAAGG + Intronic
937651813 2:124327475-124327497 CTGAATTACAAAACTGAGGAGGG - Intronic
940716679 2:157233769-157233791 CTGTAGGCACAAAGTGATGATGG - Intergenic
944876547 2:203968227-203968249 GTGAAAGCTCAAACTGAGGATGG - Intergenic
945000229 2:205342117-205342139 CTGTATGACTAAAGGGAGGAAGG + Intronic
946699804 2:222401102-222401124 CTTTTTGCACAAAGTGAGGAAGG + Intergenic
948116521 2:235497527-235497549 GTGTATGCACATACAGAGGAAGG - Intronic
948315572 2:237026067-237026089 CGGGCTGCCCAATCTGAGGAAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169110642 20:3031050-3031072 CTGTCTGCCCAGGCTGATGATGG - Intronic
1170823772 20:19776206-19776228 CTGAATTCCCAAAGGGAGGAGGG - Intergenic
1171486259 20:25488620-25488642 CTGGCTGGCCAAACAGAGGACGG - Intronic
1172861395 20:38056014-38056036 TAGTATGCGCAAAGTGAGGACGG + Intronic
1173899442 20:46576399-46576421 CAGTAAGCCAAGACTGAGGAAGG - Intronic
1174327605 20:49791687-49791709 CTGTAGTCCCAGGCTGAGGAGGG + Intergenic
1176161023 20:63648844-63648866 CTGTAGGCTCATACAGAGGAAGG + Intronic
1178243044 21:30924402-30924424 ATGTATGCTGAAACTGAGAAAGG - Intergenic
1182371601 22:29815036-29815058 CTGTATCCCCAAACTTTGGGAGG + Intronic
1183306588 22:37086181-37086203 TTTTTTGCCCAAATTGAGGATGG - Intronic
1183578489 22:38707468-38707490 CTGTAAGGCCATAATGAGGATGG + Intronic
949403329 3:3688436-3688458 CTGTATTCCAAAAGGGAGGAGGG + Intergenic
949560592 3:5198303-5198325 CTGTAAGCCCATACTTAGGGAGG - Intronic
952067873 3:29593693-29593715 CTGTAGGCTCAAACTGAAGCAGG + Intronic
955008535 3:54992391-54992413 CTGAGTGCCCACACTCAGGAGGG - Intronic
956187056 3:66572816-66572838 TTATAAGCCTAAACTGAGGATGG + Intergenic
961004255 3:123394016-123394038 CTGTAATCCCAAGCTGAGGCAGG + Intronic
964763906 3:160159960-160159982 CTGTAGGCAGAAGCTGAGGATGG - Intergenic
966308195 3:178561700-178561722 CTTTATGCCAAAACTCAGAAGGG + Intronic
968356000 3:198107959-198107981 CTTTCTGGCCAAACTGGGGAGGG + Intergenic
968356014 3:198108039-198108061 CTTTCTGGCCAAACTGGGGAAGG + Intergenic
968790990 4:2661740-2661762 CTGTGTGCCCAGGCTGAAGATGG + Intronic
971006893 4:22384788-22384810 CAGAATGCCCAAACTGAAGTTGG - Intronic
973639548 4:52889175-52889197 GGGTATGGCCAAACTGCGGATGG - Intronic
974638037 4:64590723-64590745 CTGTAAGTCCAAACTCAGCAGGG + Intergenic
975042079 4:69758335-69758357 CTTTATATCCAAACTGAGAAGGG - Intronic
975533621 4:75426179-75426201 CTGTAAGCCCAAGCCTAGGATGG + Intergenic
975808317 4:78136915-78136937 CTGTATCCCAAAACCGAGCACGG - Intronic
976028849 4:80725866-80725888 CTGTGTGCCAAAGCTGAGGAGGG + Intronic
979500043 4:121429357-121429379 CAGAATGCCTAAACTGTGGAGGG + Intergenic
991042573 5:62191213-62191235 GTGTCTGCCCACACTGAGGATGG - Intergenic
995596985 5:113757784-113757806 CTGTATCACCAAGCTGAGTAAGG + Intergenic
1009249770 6:61283706-61283728 CAGTGTTCCCAAACTGATGAAGG + Intergenic
1011927768 6:92669195-92669217 CTGTATGTCAAAAATGTGGATGG + Intergenic
1021744682 7:23726979-23727001 CTGCATCTCCAAAATGAGGAGGG - Intronic
1024918009 7:54525256-54525278 GTGAGTGCCCAAACTGTGGAAGG - Intergenic
1026914200 7:74110089-74110111 CTGAATTCCCAAACTTTGGAAGG + Intronic
1027341786 7:77216489-77216511 CTATATTCCCAAACTCAAGATGG - Intronic
1028114310 7:86980624-86980646 GTGCATGCCCAAACAGAAGATGG - Intronic
1032617335 7:133488432-133488454 CTGGGTGCCCACACAGAGGAAGG - Intronic
1038279359 8:26149821-26149843 CTGTATACTCAAACTGTGGTGGG + Intergenic
1039162984 8:34643438-34643460 CTGTCTCCCTGAACTGAGGATGG + Intergenic
1044238164 8:89855807-89855829 GTGTATGCAGAAACTGAGGGTGG - Intergenic
1044776725 8:95697150-95697172 CTGTAGGCCCAAATGGTGGAGGG + Intergenic
1048120744 8:131578841-131578863 ATGTATGCCCTAGCTCAGGATGG + Intergenic
1050665874 9:7936240-7936262 ATGGTTGCCCACACTGAGGAAGG + Intergenic
1053130767 9:35614039-35614061 CTGTATGGCCAAATGGAAGAGGG + Intronic
1062310754 9:135935183-135935205 CACCATGCCCAACCTGAGGAAGG + Intronic
1186630749 X:11346089-11346111 ATATATGCCTAAACTGAGCATGG - Intronic
1190881267 X:54494506-54494528 CTGCTTCCCCAAACTGAGGCTGG - Intronic
1194013125 X:88585604-88585626 CTGCATGCTCAAACTCTGGAGGG - Intergenic
1196006964 X:110847061-110847083 CTGAATCCCCAAACTGAGATGGG + Intergenic
1196844001 X:119884111-119884133 ATGTTTGCTCGAACTGAGGAAGG - Intergenic
1198183194 X:134230027-134230049 GTGTATGCACAAATTAAGGAGGG - Intergenic
1199234590 X:145476366-145476388 CTGTATGCCTGAACTTAGCATGG + Intergenic
1201329910 Y:12806944-12806966 CTGAATGTCCAAACTCAAGAAGG - Intronic