ID: 1102962340

View in Genome Browser
Species Human (GRCh38)
Location 12:117100714-117100736
Sequence CGGTGCCCACAGAGGGGACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102962340 Original CRISPR CGGTGCCCACAGAGGGGACT CGG Intergenic
900168598 1:1255163-1255185 CGGTGCCCTCAGTGGCGCCTTGG + Exonic
900946642 1:5834633-5834655 TGGTGCCCACAGAGGGCTCGGGG - Intergenic
901790854 1:11653230-11653252 CGGGGCCAGAAGAGGGGACTGGG - Intronic
902533164 1:17103363-17103385 TAGTGCCCACTGAGGGGACAGGG + Intronic
903121323 1:21218541-21218563 CGGTGCTCAGAGAGAGGATTTGG + Intronic
903180432 1:21602430-21602452 GGGTGGCCACAGATGGGCCTGGG - Intronic
903189842 1:21650459-21650481 AGGTGCCCTCAGAGGGCAGTAGG - Intronic
903334161 1:22613910-22613932 CGGGGCCCACATAGGGGTCCAGG + Intergenic
904207476 1:28864381-28864403 CGGTGGCCACAGTGGGGCTTGGG + Intergenic
905069188 1:35210449-35210471 TGGTGTCCACATAGAGGACTGGG - Intergenic
905284499 1:36870482-36870504 CTGGGCCCACAGAGGGCTCTGGG + Intronic
905703965 1:40040552-40040574 CGGCTCTCACAGAGGGCACTTGG - Exonic
907392170 1:54165351-54165373 CGGTACCCCCAGTAGGGACTCGG + Intronic
915725141 1:158011861-158011883 TGCTGACCACAGAGGGGACCCGG - Intronic
920092700 1:203465605-203465627 CGGTGCCCAGAGAGGGTAGCAGG - Intergenic
922585980 1:226735863-226735885 GGGTGCAATCAGAGGGGACTTGG - Exonic
922789945 1:228305958-228305980 GGGTGCCCACAGAAGGGAGGTGG + Intronic
922903188 1:229154356-229154378 TTGTGCCCACAGAGGGCTCTGGG - Intergenic
1064071180 10:12229333-12229355 GTGTGCCCACCCAGGGGACTTGG - Intronic
1075955499 10:126519886-126519908 CGGTGCTCACGGAGGGGATCTGG - Intronic
1076149250 10:128149771-128149793 CGGAGCCCACAGAGGAGGCTCGG + Intergenic
1076549870 10:131271429-131271451 AGGTGCCCACAGAAGGCACGTGG + Intronic
1076675145 10:132143819-132143841 CGGAGCCCACAGAGGGCTGTGGG - Intronic
1076730743 10:132437666-132437688 GGGTGCCCACAGAGGGAAGTGGG - Intergenic
1077049729 11:561222-561244 CGGTGCCCGCGGCGGGGACCGGG + Exonic
1077104271 11:835176-835198 TGGTGCCCACAGACAGGACAGGG - Intronic
1077292504 11:1804359-1804381 CTGTGCTCACAGGGCGGACTTGG + Intergenic
1077675601 11:4191137-4191159 AAGTGCCCACAGAGGGGAGAGGG - Intergenic
1078413957 11:11150062-11150084 CTGTTCTCACAGAGGGGACATGG + Intergenic
1079109492 11:17596477-17596499 CAGTGCACACAGAGGAGGCTGGG + Intronic
1081998319 11:47378299-47378321 CGGTACTCACAGGGGGGACGAGG + Exonic
1085645242 11:78218403-78218425 CGGGGGCCTCTGAGGGGACTGGG + Exonic
1088989808 11:114942957-114942979 CAGTGGCCACAGTGGGGACCCGG - Intergenic
1089218591 11:116851764-116851786 CAGTGCCCACTGAGAGGAATTGG - Intronic
1089660784 11:119983664-119983686 GGATGTCCACAGTGGGGACTTGG - Intergenic
1090245969 11:125216321-125216343 CGGGGCCCAGAGAGGGGCCCAGG - Intronic
1095585334 12:43843453-43843475 CGGTTCCCAAAGAGGGGAGAAGG + Intronic
1096218331 12:49810479-49810501 TGGTTCCCACAGTGGGGCCTAGG + Intronic
1096556426 12:52406778-52406800 AGGAGCCCACAGAGGGCACTTGG - Intergenic
1101207031 12:102498819-102498841 CAGTCTCCACAGAGAGGACTAGG - Intergenic
1101904495 12:108814691-108814713 CGGTGCCCACAGGTGGGCCGTGG + Intronic
1102962340 12:117100714-117100736 CGGTGCCCACAGAGGGGACTCGG + Intergenic
1103558293 12:121779007-121779029 CGGAGGCCACCGAGGGGGCTGGG - Exonic
1104961275 12:132489741-132489763 AGGTGCCCACGGAGGGGCCGCGG + Exonic
1105014373 12:132777228-132777250 TGGTGCCCACAGTGTGCACTCGG + Intronic
1105303002 13:19152029-19152051 CGGTGGCCCCAGAGGCGGCTGGG - Intergenic
1109944426 13:69414228-69414250 CAGAGCCAACAGAGCGGACTCGG + Intergenic
1112486605 13:99825886-99825908 TGGTGGGCAGAGAGGGGACTGGG - Intronic
1113630097 13:111876424-111876446 CGGTGCACACAGAGGGCAGTGGG + Intergenic
1113791062 13:113028547-113028569 GCGTGTCCACAGCGGGGACTGGG - Intronic
1113927455 13:113949723-113949745 AGCTGCCCACAGAGGGACCTCGG + Intergenic
1122059071 14:99124631-99124653 AGATGCCCACAGTGGGGTCTGGG - Intergenic
1124512570 15:30339675-30339697 CGGTGCCCACAGCTGGGCCTTGG - Intergenic
1124562070 15:30783276-30783298 CGGAGCCCACCGAGGGGAGAGGG + Intergenic
1124730345 15:32191075-32191097 CGGTGCCCACAGCTGGGCCTTGG + Intergenic
1126805240 15:52341430-52341452 CTGTGCCCACAGAGCAGACCAGG + Intronic
1129296548 15:74603274-74603296 CGTGGCCCTGAGAGGGGACTAGG - Intronic
1129760754 15:78128125-78128147 CTGTGGCCACACAAGGGACTGGG + Intronic
1130298863 15:82665462-82665484 CGTTGCGCACAGATGGGTCTGGG + Exonic
1132645768 16:998618-998640 CGGTGCCCACAGGAGGCCCTGGG + Intergenic
1132681586 16:1144646-1144668 TGGCGGCCTCAGAGGGGACTCGG - Intergenic
1133133946 16:3696240-3696262 CGGAGCACACAGAGGAGCCTAGG + Intronic
1137251798 16:46746796-46746818 CGGTGCAGACAGCGGGGGCTAGG + Intronic
1140558892 16:75954424-75954446 CGGTGCACACAGAGGGAGCCTGG + Intergenic
1141199190 16:81883907-81883929 CGATGCCCCCAGAGGACACTGGG + Intronic
1141629309 16:85277956-85277978 GGGTGCGCACAGAGGGGAATGGG + Intergenic
1142125387 16:88407700-88407722 CTGGGCCCACAGGTGGGACTTGG - Intergenic
1142253688 16:89003739-89003761 TGGAGCCCTCAGAGGGGGCTGGG + Intergenic
1143346725 17:6254995-6255017 CAGTGACCACAGAGGGGAGCTGG + Intergenic
1143614990 17:8044462-8044484 AGTTGCCTACAGAGGAGACTCGG - Intronic
1143978632 17:10848610-10848632 CAGTGACCACAGAAGGAACTTGG + Intergenic
1144638038 17:16923495-16923517 GGGTGACCACAGAGGGGACCAGG - Intergenic
1147249632 17:39145291-39145313 CAGTGCCAGCTGAGGGGACTGGG - Intronic
1148070470 17:44905816-44905838 CTGTGCCCAGAGATGGGACTGGG - Intronic
1148680998 17:49473399-49473421 ACGTGCCCACACAGGGGAGTTGG + Intronic
1151832887 17:76565987-76566009 CCTTGCCAACAGAGGGCACTGGG - Exonic
1152458688 17:80430243-80430265 CGGAGCCGACGAAGGGGACTCGG + Intronic
1152946827 17:83202543-83202565 GGCAGCTCACAGAGGGGACTGGG - Intergenic
1154315574 18:13300951-13300973 GGGCGCTCACAGCGGGGACTCGG - Intronic
1162175019 19:8823975-8823997 CAGTTACCACAGAGGGGACAGGG - Intronic
1162399029 19:10433461-10433483 CCGTGCCCACACAGGGGTCAGGG + Intronic
1162811236 19:13165326-13165348 CTGTGTAAACAGAGGGGACTTGG - Intergenic
1162927506 19:13937761-13937783 TGGGGCCCACGGAGGGGAGTGGG - Intronic
1162962961 19:14138827-14138849 GTGAGCCCACAGAGGTGACTGGG - Intergenic
1163424305 19:17232675-17232697 CAGAGCCCACAGGGGTGACTAGG + Intronic
1163761312 19:19138114-19138136 GTGGTCCCACAGAGGGGACTGGG - Intronic
1165170473 19:33888442-33888464 CTGTGCCCACACACGGGTCTAGG - Intergenic
1166533249 19:43554886-43554908 CAGGGCCCACACAGGGGACTGGG + Intronic
1166783893 19:45356444-45356466 TGATGCCCACAGTGGGGTCTGGG - Intronic
1167094838 19:47369635-47369657 CGGTGGGCACAGTGGGGGCTGGG + Intronic
1167665180 19:50819468-50819490 GGATTCCCACAGAGGGGACAGGG + Intronic
1167724330 19:51200354-51200376 CAGTTCCCACAGTGGGGTCTTGG + Intergenic
927024440 2:19050973-19050995 GGCTGACCACAGAGGGGACTGGG - Intergenic
927326635 2:21812755-21812777 AGGTGCCAACAGAGGGGAAATGG - Intergenic
934515632 2:94984846-94984868 CATTGCCCACAGAGGGAACCCGG - Intergenic
940492551 2:154382153-154382175 CTGTGTCCATAGAGGGGATTGGG - Intronic
941730336 2:168910478-168910500 CATTACCCTCAGAGGGGACTGGG + Intronic
1171371735 20:24666764-24666786 CTGTGTCCACTGAGGGGATTAGG - Intergenic
1171989632 20:31685854-31685876 AGGTGCCCCCAGAGGGGAAGTGG - Intronic
1172597245 20:36157825-36157847 CCGAGGCCACAGTGGGGACTGGG + Intronic
1172779702 20:37428916-37428938 GGGAGCCCACAGAGGAGGCTGGG - Intergenic
1173860039 20:46277372-46277394 CTGTGTCCACAGAGAGGACAAGG - Intronic
1174463530 20:50699722-50699744 CTGTGCCCAGAGTGGGGGCTTGG - Intergenic
1175108124 20:56628761-56628783 CTGTGCCCACGGAGGGAACTGGG + Intergenic
1175783589 20:61698497-61698519 AGGTGCCCGCAGAGGGCACGGGG + Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1175936531 20:62516792-62516814 CGGTGCCCACTGAGGGGCCCTGG + Intergenic
1176084301 20:63289094-63289116 TGGTGCCCACAGGGAGGACCGGG - Exonic
1176222056 20:63974425-63974447 CAAAGCACACAGAGGGGACTAGG + Exonic
1179728424 21:43353834-43353856 CGGGTGTCACAGAGGGGACTTGG - Intergenic
1180986071 22:19904550-19904572 TGGTGCCCACAGTGGGGCCTGGG - Intronic
1182053467 22:27331025-27331047 CAGTGGCCAAAGAGGGGGCTGGG + Intergenic
1182715690 22:32354688-32354710 CACTGCCCACAGAGGGGAGTGGG - Intergenic
1184606530 22:45577642-45577664 CTGTGCACACAGAGTGGCCTTGG - Intronic
1185294725 22:50047488-50047510 CGGTTTCCACAGAGGGGCCTCGG + Intronic
950261484 3:11545622-11545644 CGAGGCCCAGAGAGGGGACAGGG - Intronic
953750608 3:45605824-45605846 AGGAGCCCACGGAGAGGACTGGG - Intronic
955793753 3:62613936-62613958 CGGGGAGCACAGAGGGGAGTAGG - Intronic
958164570 3:89862995-89863017 CGGTGCACCCAGAGAGGACATGG + Intergenic
960713947 3:120557869-120557891 TGGAGCCCACAGAGGGCTCTGGG - Intergenic
961775234 3:129279324-129279346 CGCTGACCCCAGCGGGGACTGGG + Intronic
962328024 3:134451898-134451920 ATGTGCTCACAGAGGGGGCTGGG + Intergenic
966696466 3:182794109-182794131 CGGTGCCCCCAGAGGAAACAGGG + Intronic
968433679 4:574725-574747 CGGAGCCCGCAGAGGGGGCCAGG + Intergenic
968631341 4:1653765-1653787 CGGTGCCCTCAGCGTGGCCTAGG + Intronic
969674935 4:8609509-8609531 AAGTGCCCGCAGAGGTGACTGGG + Intronic
974982656 4:68979261-68979283 AGGGGCACACAGAGGAGACTAGG - Intergenic
975319100 4:72989769-72989791 TGGTGGTCACAGAGGGCACTGGG - Intergenic
985475373 5:75854-75876 AGGAGCCCAGAGAGGGCACTTGG + Intergenic
985580710 5:693895-693917 CGGGGCGCACCCAGGGGACTGGG + Intergenic
985595333 5:785227-785249 CGGGGCGCACCCAGGGGACTGGG + Intergenic
985975641 5:3417510-3417532 TGGTGCCCTCAGAGGTGCCTGGG - Intergenic
986402582 5:7395419-7395441 CGGTGCCCACCGCGGGGAGGCGG + Intergenic
990165103 5:52986246-52986268 CGGAGCCCACAGAGGTGAGTTGG + Intergenic
998388341 5:141771322-141771344 AGGTATCCCCAGAGGGGACTCGG - Intergenic
999245570 5:150152720-150152742 CTCTGCCCACAGAAGGGACCTGG - Intronic
1000325384 5:160168194-160168216 CCATGCCCACAGTGGGCACTTGG + Intergenic
1001605693 5:172958579-172958601 CGGTGCCCACGGAGGGGGCGTGG + Intergenic
1002297925 5:178241637-178241659 CGGTGCCCTGGGAGGGGGCTGGG - Intronic
1002323630 5:178390561-178390583 AGGTGCCCACAGATGGCACTGGG - Intronic
1002791639 6:441571-441593 CAGGACCCACAGAGGGGTCTCGG + Intergenic
1006228481 6:32561354-32561376 CGGGGTCCACAGAGGGGGATAGG + Intronic
1019183494 6:170207693-170207715 CAGGGCCCTCAGAGGGGACTCGG - Intergenic
1019217700 6:170454284-170454306 CAGTCCCCACTGAGGGCACTCGG + Intergenic
1022606685 7:31822251-31822273 GGGAGCCCAGTGAGGGGACTGGG - Intronic
1025830395 7:65044091-65044113 CAGGGCCCACAGTGTGGACTTGG - Intergenic
1028656747 7:93217599-93217621 GAGTGGCCACAGAGGAGACTGGG - Intronic
1031146492 7:118002801-118002823 CAGTGCCTACAGAAGGGAGTTGG + Intergenic
1034976985 7:155454618-155454640 CGCTGCACAAAGAGGGGCCTCGG - Intergenic
1035170468 7:157014686-157014708 CAGGGCCAACAGAGAGGACTTGG + Intergenic
1037705869 8:21314563-21314585 AGGTGTCCACAGAGGGCAATTGG - Intergenic
1037755369 8:21706713-21706735 CGATGCTGACAGAGGGGAATGGG - Intronic
1039735298 8:40324916-40324938 CTCTGCCCACTGAGGGGCCTTGG - Intergenic
1042200615 8:66276686-66276708 AGGTGCCCACAGAGGATGCTGGG + Intergenic
1042815389 8:72873020-72873042 CGGTGCACACAGTGGAGTCTAGG - Intronic
1049397494 8:142408092-142408114 ATGTGTCCACAGAGGGGAGTGGG - Intergenic
1049592962 8:143470982-143471004 CGGTGCCCAGAGCTGGCACTGGG - Intronic
1049598805 8:143497767-143497789 CGGAGACCACTGAGGGGACCTGG - Intronic
1058040002 9:100292898-100292920 CTCTGCCCAGAGAGGGGACCAGG - Exonic
1060245771 9:121945129-121945151 CTGTACCCACAGAGAGGAGTCGG + Intronic
1060732879 9:126049248-126049270 CGGTGACCTGAGAGGGGACAGGG + Intergenic
1060826363 9:126690336-126690358 AGGAGCCCAGAGAGGGGACCAGG + Intronic
1061119735 9:128635457-128635479 CGGTGCCTGCAGAGGAGGCTGGG + Intronic
1061216132 9:129223036-129223058 CGGCGGCCTCAGAGGGGACAGGG - Intergenic
1062145933 9:134989679-134989701 CGGTGCCCTCAGGGGTGAGTGGG - Intergenic
1186195639 X:7108373-7108395 CAGTGTCCACAGGGTGGACTGGG - Intronic
1187859332 X:23666488-23666510 CGGTGCCCACGGCGGGGAGATGG + Intronic
1190303949 X:49072065-49072087 CGGGGCCCACCGAAGGGAATTGG + Intronic
1190625720 X:52336747-52336769 GGGTCCCCACAGAAGGGACTAGG + Intergenic
1200073510 X:153540314-153540336 CGGTGCTGAGGGAGGGGACTGGG - Intronic
1200845953 Y:7832336-7832358 CTGATCCCCCAGAGGGGACTTGG - Intergenic