ID: 1102962558

View in Genome Browser
Species Human (GRCh38)
Location 12:117102052-117102074
Sequence CAGGGCTTGGAGAAGTAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102962558 Original CRISPR CAGGGCTTGGAGAAGTAATC AGG Intergenic
901123872 1:6915839-6915861 ACGGTCTTGGAGAAGTCATCAGG - Intronic
902805689 1:18859905-18859927 CAGGGCATGGCCAAGTTATCAGG - Intronic
902842063 1:19081033-19081055 CAGGGCTAAGAACAGTAATCAGG - Intronic
904553199 1:31338688-31338710 CATGGCTTGTGGAAGTAACCAGG - Intronic
905154138 1:35959519-35959541 CAGTGCTTGGGAAAGTAATTTGG - Intronic
908144710 1:61227615-61227637 CAGGGGTTAGAGAAGTAGTGGGG - Intronic
908394234 1:63710905-63710927 CAGGGCTGGGAGAAGGAAAATGG - Intergenic
910399092 1:86820786-86820808 CAGGGCTTTGGGAGGTAATTAGG - Intergenic
911050147 1:93664069-93664091 CAGGCATTTTAGAAGTAATCAGG - Intronic
913554726 1:119953755-119953777 CAGGACTTGGTGAAGAAATGGGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
922158464 1:223059610-223059632 CAGGGCTTGGAGAACCCATGAGG + Intergenic
922784646 1:228276873-228276895 AAGGGCTTGGAGAAGCCTTCAGG - Intronic
1064476894 10:15700304-15700326 CTGAGATTGGAGAAGCAATCAGG - Intronic
1064481324 10:15743629-15743651 CAGTGCTTGGAGTGGTATTCTGG + Intergenic
1065853456 10:29810845-29810867 CAGGCCTAGTAGAAGCAATCAGG - Intergenic
1067309819 10:45102316-45102338 CAGGGTTGGGAGCAGAAATCTGG + Intergenic
1074713099 10:116193707-116193729 CAGGGCTGGCACAGGTAATCTGG - Intronic
1074853640 10:117457792-117457814 CACGGCTTCCAGAAGTAAGCTGG - Intergenic
1075717798 10:124566970-124566992 CAGTGCCTGGAGATGTCATCTGG - Intronic
1076449186 10:130544562-130544584 CAGGCCTTGGAGTAGGAACCGGG - Intergenic
1076520048 10:131075760-131075782 CTGAGCTTGGAGTATTAATCAGG - Intergenic
1076821477 10:132942140-132942162 CTGGGCTGGGAGAAGTGAGCCGG + Intronic
1077774053 11:5252177-5252199 GAGGCTTTGGAAAAGTAATCAGG - Intronic
1078438338 11:11344040-11344062 AAGAGCTTGGAGAAGGAATATGG - Intronic
1078725789 11:13929781-13929803 CAGGGCTGGGAAAAGCATTCAGG + Intergenic
1081773761 11:45664715-45664737 CAGGGCTGGGAGCAGGAAGCAGG + Intronic
1081858090 11:46316543-46316565 ATGGGCTTGGAGAAGGAGTCTGG - Intronic
1083364006 11:62130386-62130408 GTGGGCGTGGAGAAGTTATCCGG - Exonic
1083537198 11:63480383-63480405 CAGGGATTGGAGAAGGAAAGAGG + Intronic
1084044193 11:66559653-66559675 GAGGGTTTGGAGCAGTAAGCCGG - Intronic
1084323029 11:68384149-68384171 CGGGGCTTGGAGCAGGAGTCAGG + Intronic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1087124077 11:94606155-94606177 CAGGGGCTGGACAAGTAAGCAGG - Intronic
1090593203 11:128293838-128293860 CAGGGGTTGGGGAGGTAATGAGG - Intergenic
1091940726 12:4478205-4478227 AAGGAGTTGGAGAGGTAATCAGG + Intergenic
1093174645 12:15899255-15899277 AAGGGCTTTGAGAACTAATAAGG + Intronic
1096884799 12:54706476-54706498 CAGGGCAAGGAGAAGCAATGAGG - Intergenic
1102870280 12:116408805-116408827 CAGGCCTTTGGGATGTAATCAGG + Intergenic
1102962558 12:117102052-117102074 CAGGGCTTGGAGAAGTAATCAGG + Intergenic
1103272149 12:119682205-119682227 CAGGGCTTGGAGAACTCATGGGG - Intergenic
1103587794 12:121969015-121969037 AGGGGCTTGGAGAAGTGGTCAGG - Intronic
1103968737 12:124656212-124656234 CAGGGCTTTGAGAAGGGAACAGG + Intergenic
1107994429 13:45846842-45846864 CAGAGCCTGGAGCAGTAATTTGG - Intronic
1111709059 13:91788340-91788362 GAGGACTTGGGGAAGTAATTAGG - Intronic
1111909705 13:94297199-94297221 GAGGGTTTGGAGAAGAAATCAGG - Intronic
1112117721 13:96375216-96375238 CAGGTCTTTACGAAGTAATCAGG - Intronic
1112347721 13:98604846-98604868 CAGGGCTTTGGGAGGTAATTAGG - Intergenic
1113901715 13:113801544-113801566 CAGGGCTGGGGGAGGAAATCAGG - Intronic
1114914179 14:27241190-27241212 GGGGGCTTTGAGAAGTAATTAGG - Intergenic
1116039813 14:39672336-39672358 CAAGGCTTGGAGAGGTAGTAGGG + Intergenic
1117570926 14:57048555-57048577 CAGGCCTTTGGGAGGTAATCAGG - Intergenic
1118852050 14:69591674-69591696 CAGAGCTTGGAAAAGATATCTGG - Intergenic
1119480327 14:74954600-74954622 CAGGGCCTGGGGAAGTGAGCAGG - Intronic
1120563023 14:86019683-86019705 CAGGGCTTGGGGAAGTAGGGTGG - Intergenic
1121017488 14:90557296-90557318 CAGGGCTGGGAGAAGTCACGTGG + Intronic
1121896042 14:97648775-97648797 CAGGGATTAGAGAGGAAATCAGG - Intergenic
1125528554 15:40395418-40395440 GAGGGTTTGGAGAAGAAATTAGG - Intergenic
1126265814 15:46752733-46752755 CAAGGCATGTAGAAGTAGTCAGG + Intergenic
1127068628 15:55266119-55266141 CAGGTCTTTGGGAAGTAATTAGG + Intronic
1128095385 15:64950089-64950111 CAGGGCTAGGGGTAGGAATCTGG - Intronic
1130673424 15:85932281-85932303 CAGGGCTCGGAGAAGTAAAGAGG + Intergenic
1134215749 16:12315897-12315919 CAGGGGCTGGAGATGTAATGGGG + Intronic
1138066190 16:53943909-53943931 CAGGTCTTGGAAAAGTAAATGGG - Intronic
1138559790 16:57794708-57794730 CAGAGCTTGGAGAAGGTATTGGG - Intronic
1139531980 16:67546932-67546954 CTGGGCTTGGAGAAGAGAGCAGG + Intergenic
1141642378 16:85348814-85348836 CAGGGCTTGAAGAAATAAAAAGG - Intergenic
1142480297 17:214840-214862 CAGGGCTGGGACAAGAACTCGGG + Intronic
1144620975 17:16818354-16818376 CAGGGAGTGAAGCAGTAATCAGG - Intergenic
1145922934 17:28624801-28624823 GAGGGCCTGGAGACATAATCAGG - Intronic
1147572955 17:41582647-41582669 CAGGGAGTGAAGCAGTAATCAGG - Intronic
1152469505 17:80482970-80482992 CAGGGCTTGCAGAAGAGACCTGG + Intergenic
1153203092 18:2666530-2666552 CAGGTCTTGGAAAACTAATTAGG - Intronic
1153953025 18:10072863-10072885 CAGGGCATGAAGAAATAATGTGG - Intergenic
1156203472 18:34859804-34859826 CAGGCCTTGGAAAAGAAATGTGG + Intronic
1156472413 18:37385625-37385647 CAGGGTTTGCAGAATGAATCAGG - Intronic
1162856211 19:13470389-13470411 AAGGGCATGGTCAAGTAATCTGG - Intronic
1166900283 19:46056152-46056174 TAGGACTTGCAGAAGTAATAGGG + Intronic
1167628554 19:50608443-50608465 CAGTGCTTGCGGAAGAAATCCGG - Intergenic
1167695136 19:51010632-51010654 CAGGGCTTGCAGAAGTCCTCAGG + Intergenic
925970653 2:9104546-9104568 GAGGGCTTGGTGATGTAATAGGG - Intergenic
926689035 2:15720118-15720140 CAGTGCTTGGACAAGGAATTGGG - Intronic
928849516 2:35728014-35728036 TAGGGTTAGGGGAAGTAATCAGG - Intergenic
929561681 2:42960263-42960285 CAGGGCTTTGAGAAGCAAGCTGG + Intergenic
929720095 2:44359680-44359702 CAAAGCTTGGAGAAATAATTTGG + Exonic
930058756 2:47272018-47272040 CAGAGCCTGCAGAAGTAAACAGG + Intergenic
930501565 2:52226390-52226412 CAGGGTTTGAAGAATGAATCAGG + Intergenic
930942478 2:57029017-57029039 AAAGGCTTGGAGAAGTCATGTGG - Intergenic
931677895 2:64716391-64716413 CTGGGTTTTTAGAAGTAATCTGG + Intronic
932226782 2:70047691-70047713 GAGGGATTGGAGAAGAGATCAGG + Intergenic
932467680 2:71934050-71934072 CAGGGCTTGCAGAAGGCACCAGG + Intergenic
932836638 2:75044124-75044146 AAGGGCTTTGGGAAGTAATTAGG - Intergenic
932882793 2:75519296-75519318 CAAGGCTTGGAGAATGAACCTGG + Intronic
933884285 2:86703437-86703459 TAGGGATTGGAGAAGTACCCCGG + Intronic
935067504 2:99662749-99662771 CAGGAGTTGAAGCAGTAATCAGG - Intronic
936789160 2:116129870-116129892 CAGGACTTAGAATAGTAATCAGG - Intergenic
937480403 2:122252386-122252408 CAGGGCTTGGAGAAGCACAATGG + Intergenic
938108497 2:128549197-128549219 CAATGCCTGGAGAAGTAATCAGG - Intergenic
938398478 2:130967965-130967987 CAAGGCTTGGGGAACTTATCTGG - Intronic
943394739 2:187320261-187320283 CAGGGTTTGGGGAAAGAATCTGG - Intergenic
946324251 2:218975916-218975938 CAAGGCTTGGAGAAGTGAAGTGG - Intergenic
1168741977 20:199900-199922 CAGGGCCTTGAGAAGTAGCCAGG - Intergenic
1169048017 20:2552048-2552070 CAGGGCTTTGAGAACAACTCAGG + Intronic
1172408495 20:34705884-34705906 CAGGGCTGGGAAAGGAAATCTGG + Intronic
1174266790 20:49337816-49337838 CAGGTCTAGGACAAGTAAGCGGG - Intergenic
1178460676 21:32799441-32799463 CAGGACTTGGAGAGGTAAGCAGG - Intronic
1178627183 21:34227915-34227937 CTGGGCCTGGAGAAGCAACCAGG + Intergenic
1180200463 21:46220911-46220933 CAGGGCTTGGGGAGGTAGCCAGG + Intronic
1180719861 22:17899849-17899871 GAGGGCTTGGATTAGTTATCGGG + Intronic
1181853311 22:25765428-25765450 CAAGGCTTGGGGAAGTGACCTGG + Intronic
1182372141 22:29818862-29818884 CAGGGCTTGGTGAGGTCAGCTGG - Intronic
951967000 3:28398568-28398590 CAGGTCTTGCAGGAGCAATCTGG - Intronic
952569024 3:34691977-34691999 GGGGGCTTTGAGAAGTAATTAGG + Intergenic
954978429 3:54721221-54721243 CATGGCTTGGAGGATTAATATGG - Intronic
955742304 3:62104394-62104416 CAGGGATTAAAGAAGTATTCTGG - Intronic
956043635 3:65172540-65172562 CAGAGGTTGGACAAGTAAGCCGG - Intergenic
958767845 3:98392240-98392262 CTGGGCTTGGCACAGTAATCTGG + Intergenic
963074754 3:141335495-141335517 CAGGGCTGGGAAAAGTTATGAGG - Intronic
964431321 3:156609361-156609383 AAAGGCTTGGAGCAATAATCTGG + Intergenic
968753477 4:2402294-2402316 CAGGGCTTGGATCAGTAAGTCGG + Intronic
970447477 4:16136255-16136277 CAGGGCTTGGATGAGAAAGCAGG - Intergenic
981927184 4:150153033-150153055 CAGGGCTTTGACAAGTGAGCAGG + Intronic
982403706 4:154997613-154997635 GAGGACTTCGAGAAGTAATTAGG - Intergenic
982860901 4:160447717-160447739 CAGGGCTTTGGGAAATAATTAGG + Intergenic
985532496 5:442497-442519 CAGGTCTTGGAGAATGAATGTGG - Exonic
985752400 5:1688078-1688100 CAGGGCTTGCAGAGGTTAACAGG + Intergenic
986707985 5:10467147-10467169 GAGGGCTGGGAGAAGTAATGTGG - Intronic
987825656 5:23027190-23027212 GAGGCCTAGGAGAAGTATTCAGG - Intergenic
989280597 5:39638481-39638503 GAGAGCTTGGAGAAGGAAGCAGG - Intergenic
990503647 5:56423154-56423176 AAGGGCATGGAGAAGTGAGCTGG - Intergenic
990531421 5:56677380-56677402 GAGAGCTGGGAGAAGTAATGTGG - Intergenic
990984334 5:61626910-61626932 CAGGGCTTGGACCAGTACTGGGG + Intergenic
991943845 5:71881114-71881136 TAGGGCTTGGAGGAGAAAACAGG + Intergenic
995380332 5:111524615-111524637 GAGGGCTTAGAGATGTAATTAGG + Intergenic
996580356 5:125025516-125025538 CAGAGCTTGGAAAAGTGATCTGG + Intergenic
996854088 5:127985372-127985394 CAGGGCTTGCAGAAGGCATAAGG + Intergenic
997235858 5:132271625-132271647 CAGGGGGTGGAGAGGGAATCGGG - Intronic
997293521 5:132754841-132754863 CAGGGATTGGTGAAGGAATGAGG + Intronic
998324029 5:141262793-141262815 CAGGGCCTTGAGAAGTATTATGG - Intergenic
999693741 5:154170450-154170472 ATGGGCCTGGAGAAGTAAGCCGG + Intronic
1007078628 6:39083577-39083599 CAGGGCTGGGACAAGCACTCAGG - Intronic
1008122199 6:47631613-47631635 CTTAGCTTGGGGAAGTAATCAGG - Intergenic
1010557821 6:77306559-77306581 CATGGCATGGATAAATAATCTGG - Intergenic
1012491501 6:99787619-99787641 CAGGGCCTGGAGAAGTGTCCAGG + Intergenic
1014014717 6:116517149-116517171 CAGAGCCTTGAGAAGTAATTGGG - Exonic
1018095923 6:160386959-160386981 CAGTGCTTGGAGCAGGGATCTGG - Intronic
1019280305 7:196449-196471 CAGTGCTTGGAGAGGTAGTGAGG + Intronic
1019711769 7:2521195-2521217 CAGGGCTTGGTGAGGTCATGAGG + Intronic
1019984480 7:4645582-4645604 CAGGGCTTGGAGGCAAAATCTGG - Intergenic
1020135436 7:5585587-5585609 CAGGGCTTGGGGCAGGCATCTGG - Intergenic
1021085901 7:16421057-16421079 CAGGCCCTGGAGAGGTAATGCGG - Exonic
1021704310 7:23351605-23351627 CAGGGGTGGGAAAAGGAATCAGG + Intronic
1023177176 7:37446653-37446675 CAGGGCCTGGAGCAGTCATTGGG - Intronic
1023178171 7:37453800-37453822 TGGGGCTTTGAGAAGTAATTAGG - Intergenic
1023237163 7:38101440-38101462 CAGGGCCTTGAGAAGTAGTATGG + Intergenic
1023572448 7:41586219-41586241 GAGGGCATGGAGGAGTGATCTGG - Intergenic
1025224142 7:57142125-57142147 CACAGCTTGGAGAAGAAATTGGG - Intergenic
1025742316 7:64207530-64207552 CAGGGATTGGGAAAGTTATCAGG + Intronic
1026106298 7:67423502-67423524 GAGGGCTTGGAGCAGTACCCTGG + Intergenic
1027359277 7:77391869-77391891 AAGGGATTGTAGAAGTAATCTGG - Intronic
1028513899 7:91655607-91655629 GAAGGCGTGGAGAAGGAATCAGG - Intergenic
1030693357 7:112557573-112557595 CAGCATTTGGAGAAATAATCTGG - Intergenic
1032299445 7:130673071-130673093 CAGGTTTTGGACAAGTAATCTGG - Intronic
1032456075 7:132074557-132074579 CAGGACATGGAGGAGTAAACTGG + Intergenic
1033607253 7:142936424-142936446 AAGGGCATGGACAAGTAACCTGG + Intergenic
1034544124 7:151778546-151778568 CAGGGCTTGGAGAAGGCATGGGG - Intronic
1036116629 8:5966824-5966846 AAGGGCCTGGAGAGCTAATCTGG - Intergenic
1037220287 8:16511044-16511066 AAGAGTTTGGAGAAGTAATGTGG - Intronic
1037405256 8:18535820-18535842 CAGTGATTGGAGAAGTATCCGGG + Exonic
1037751038 8:21682626-21682648 CAGGCCCTGGAGAAGGAAACGGG - Intergenic
1041396640 8:57398378-57398400 GAGGGCTGGGAGGAGTAATTTGG + Intergenic
1044505905 8:93018988-93019010 CAGTGATGGGAGAAATAATCTGG + Intergenic
1047182427 8:122602342-122602364 CAGGCCTTTGAGAGGTAATTAGG + Intergenic
1048422319 8:134289282-134289304 AAGGGCTTGGAGAAGGAAAGGGG - Intergenic
1049282494 8:141757169-141757191 GAGGGCTTGGGGCAGGAATCGGG + Intergenic
1049405616 8:142450683-142450705 GAGGGCTTCGAGAAGGAGTCTGG - Intronic
1050426539 9:5517417-5517439 CAGGGCTGAGAGATGTTATCTGG - Intronic
1050782535 9:9355670-9355692 CAGGGCCTGGAGATGTAAATTGG + Intronic
1058032131 9:100211620-100211642 CAAGGCTTGGAGAAGGCATTGGG + Intronic
1060028307 9:120191800-120191822 CAGGGCATGGAGAATACATCTGG + Intergenic
1060914732 9:127380764-127380786 CAGGGCTAGGGGAAGAAATGGGG + Intronic
1060915783 9:127389547-127389569 TAGGGCTGGGAGAAGTAATAAGG - Intronic
1185939784 X:4303575-4303597 CATGGCTTAGAGAAGTAACTGGG - Intergenic
1186542215 X:10412087-10412109 CTTGGCTTTGAGAAGAAATCTGG + Intergenic
1187184995 X:16976079-16976101 CAGGGGCTGGAGAAGGAATTGGG - Intronic
1193428699 X:81373315-81373337 TTGGGCTTGGAAAAGTTATCTGG + Intergenic
1199713392 X:150488299-150488321 CAGGGCCTGGAGAGCTAATCTGG + Intronic
1201256162 Y:12110280-12110302 CAGGGTTTGCAGAAGGAATGAGG - Intergenic