ID: 1102964214

View in Genome Browser
Species Human (GRCh38)
Location 12:117113602-117113624
Sequence GGGACCTGCCCCCAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102964214_1102964225 30 Left 1102964214 12:117113602-117113624 CCTGTCTCCTGGGGGCAGGTCCC No data
Right 1102964225 12:117113655-117113677 CCTGAATATTTATGAAGCCTGGG No data
1102964214_1102964216 -9 Left 1102964214 12:117113602-117113624 CCTGTCTCCTGGGGGCAGGTCCC No data
Right 1102964216 12:117113616-117113638 GCAGGTCCCAGCCCCTCAGAAGG No data
1102964214_1102964222 7 Left 1102964214 12:117113602-117113624 CCTGTCTCCTGGGGGCAGGTCCC No data
Right 1102964222 12:117113632-117113654 CAGAAGGAAGAAGCATAGACAGG No data
1102964214_1102964223 29 Left 1102964214 12:117113602-117113624 CCTGTCTCCTGGGGGCAGGTCCC No data
Right 1102964223 12:117113654-117113676 GCCTGAATATTTATGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102964214 Original CRISPR GGGACCTGCCCCCAGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr