ID: 1102965255

View in Genome Browser
Species Human (GRCh38)
Location 12:117120666-117120688
Sequence GATTCCCTGGTGACTTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102965250_1102965255 23 Left 1102965250 12:117120620-117120642 CCTCCAGGTCACCTTGGGGACTT No data
Right 1102965255 12:117120666-117120688 GATTCCCTGGTGACTTGAGCTGG No data
1102965249_1102965255 24 Left 1102965249 12:117120619-117120641 CCCTCCAGGTCACCTTGGGGACT No data
Right 1102965255 12:117120666-117120688 GATTCCCTGGTGACTTGAGCTGG No data
1102965251_1102965255 20 Left 1102965251 12:117120623-117120645 CCAGGTCACCTTGGGGACTTCTC No data
Right 1102965255 12:117120666-117120688 GATTCCCTGGTGACTTGAGCTGG No data
1102965252_1102965255 12 Left 1102965252 12:117120631-117120653 CCTTGGGGACTTCTCAAAACTTC No data
Right 1102965255 12:117120666-117120688 GATTCCCTGGTGACTTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102965255 Original CRISPR GATTCCCTGGTGACTTGAGC TGG Intergenic
No off target data available for this crispr