ID: 1102965955

View in Genome Browser
Species Human (GRCh38)
Location 12:117125561-117125583
Sequence CTGGTTACACAGTACTGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102965947_1102965955 19 Left 1102965947 12:117125519-117125541 CCTTGCTCTCCCTCACCCTGGGC No data
Right 1102965955 12:117125561-117125583 CTGGTTACACAGTACTGTCAGGG No data
1102965948_1102965955 10 Left 1102965948 12:117125528-117125550 CCCTCACCCTGGGCCATCTGTTT No data
Right 1102965955 12:117125561-117125583 CTGGTTACACAGTACTGTCAGGG No data
1102965945_1102965955 20 Left 1102965945 12:117125518-117125540 CCCTTGCTCTCCCTCACCCTGGG No data
Right 1102965955 12:117125561-117125583 CTGGTTACACAGTACTGTCAGGG No data
1102965952_1102965955 -3 Left 1102965952 12:117125541-117125563 CCATCTGTTTGTCTCTATTACTG No data
Right 1102965955 12:117125561-117125583 CTGGTTACACAGTACTGTCAGGG No data
1102965950_1102965955 4 Left 1102965950 12:117125534-117125556 CCCTGGGCCATCTGTTTGTCTCT No data
Right 1102965955 12:117125561-117125583 CTGGTTACACAGTACTGTCAGGG No data
1102965949_1102965955 9 Left 1102965949 12:117125529-117125551 CCTCACCCTGGGCCATCTGTTTG No data
Right 1102965955 12:117125561-117125583 CTGGTTACACAGTACTGTCAGGG No data
1102965951_1102965955 3 Left 1102965951 12:117125535-117125557 CCTGGGCCATCTGTTTGTCTCTA No data
Right 1102965955 12:117125561-117125583 CTGGTTACACAGTACTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102965955 Original CRISPR CTGGTTACACAGTACTGTCA GGG Intergenic
No off target data available for this crispr