ID: 1102969852

View in Genome Browser
Species Human (GRCh38)
Location 12:117157776-117157798
Sequence CCTCCTCCACTGTGTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 362}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102969845_1102969852 17 Left 1102969845 12:117157736-117157758 CCCGCGGTGCGCACTCGGGGGAT 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1102969852 12:117157776-117157798 CCTCCTCCACTGTGTCCTGGGGG 0: 1
1: 0
2: 1
3: 37
4: 362
1102969846_1102969852 16 Left 1102969846 12:117157737-117157759 CCGCGGTGCGCACTCGGGGGATA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1102969852 12:117157776-117157798 CCTCCTCCACTGTGTCCTGGGGG 0: 1
1: 0
2: 1
3: 37
4: 362
1102969844_1102969852 18 Left 1102969844 12:117157735-117157757 CCCCGCGGTGCGCACTCGGGGGA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1102969852 12:117157776-117157798 CCTCCTCCACTGTGTCCTGGGGG 0: 1
1: 0
2: 1
3: 37
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102969852 Original CRISPR CCTCCTCCACTGTGTCCTGG GGG Intronic
900129588 1:1081711-1081733 ACTCCGCCACCGTGTGCTGGGGG - Intergenic
900697588 1:4021791-4021813 ACTCCTCCTCTGGGGCCTGGGGG - Intergenic
901000782 1:6147878-6147900 GCTCCTCCACTGGCTCTTGGGGG + Intronic
901757557 1:11450622-11450644 CCTGCTCAGCTGTGCCCTGGAGG - Intergenic
901800207 1:11704147-11704169 CCACCTCCTCCTTGTCCTGGGGG - Intronic
902251322 1:15155584-15155606 CTTCCTCCCCTGTTCCCTGGGGG - Intronic
902255599 1:15186933-15186955 CCTCCTCCCCTTTGTGCTTGGGG + Intronic
902326185 1:15702264-15702286 CTTGGTCCACTGAGTCCTGGAGG - Intronic
902966981 1:20012496-20012518 CCTGCCCCAGTGTGTCTTGGAGG - Intergenic
903183163 1:21615181-21615203 GCTCTCCCACTGTGTCCCGGGGG - Intronic
903292992 1:22326399-22326421 GCTGCTCCAGTGTGGCCTGGAGG - Intergenic
904277566 1:29394417-29394439 CCTCCTGCTCTGTGACCTGTGGG + Intergenic
904417332 1:30371392-30371414 CCTGCTCCACTCTCTCCTGAAGG - Intergenic
904812243 1:33170995-33171017 CATCCCTCACTGTGTCCAGGTGG + Intronic
904935572 1:34127487-34127509 CCTCCTCCCCTCACTCCTGGAGG - Intronic
905310814 1:37047589-37047611 CCCCATCAACTGGGTCCTGGAGG - Intergenic
905342607 1:37289632-37289654 CCTGCTTCACTGCGGCCTGGGGG + Intergenic
906064683 1:42971959-42971981 CATCCTCCTCTGTCTCCTGAAGG + Intergenic
906523565 1:46481027-46481049 CCTACTCCTCTGTGTCGGGGTGG + Intergenic
907108458 1:51905316-51905338 CTGCCTCCTCAGTGTCCTGGTGG - Intergenic
907279134 1:53334060-53334082 CCTCCTCCACTGTCTTATGTAGG + Intergenic
907390509 1:54155093-54155115 CAGTCTACACTGTGTCCTGGAGG - Intronic
908890544 1:68842650-68842672 CCACCTTTGCTGTGTCCTGGAGG + Intergenic
909433696 1:75616588-75616610 CCTCCTCCACAGCCTCCTCGAGG + Intergenic
910468340 1:87524162-87524184 CCCCCTCCACTGAGGCCTGAAGG - Intergenic
911392829 1:97268159-97268181 CCTGCCCCAGTGTGTCCAGGAGG - Intronic
912934138 1:113988051-113988073 CCTCCTCCCCTGTGGCCTCAGGG - Intergenic
915247573 1:154567639-154567661 ACTCCTCCACCGTGCCGTGGAGG + Intergenic
915328247 1:155092367-155092389 TCTCCTCCGGTGTGGCCTGGGGG + Intergenic
915484726 1:156212287-156212309 CCTTCCCCACTGTGCCATGGCGG - Exonic
916289641 1:163150744-163150766 CCTCCAACCCTGTGTCATGGAGG + Intronic
916889835 1:169104974-169104996 CCTCCCCCACTGGGGCTTGGTGG + Intergenic
917930883 1:179821736-179821758 CCTCCTCCCTCGTGTCCTGCCGG + Intergenic
917957675 1:180117165-180117187 CCTCCTGCACTGTCTCCTCTTGG - Intergenic
918243641 1:182640964-182640986 CCCCTTCCACTCTCTCCTGGAGG + Intergenic
918665874 1:187150340-187150362 CCTCCTCCTCTGTTTTTTGGAGG + Intergenic
918936706 1:190930379-190930401 CCCCCACCATTGTGTCTTGGAGG + Intergenic
920200300 1:204256137-204256159 CCTCCTCCACTCTGGCCTCCTGG + Intronic
920314737 1:205069505-205069527 CCTCCTCCGCTGAGTCCTGAGGG - Exonic
921449680 1:215290388-215290410 CATCCTCCACTGAGTCCTATGGG - Intergenic
922795284 1:228336693-228336715 CCTCGTCCACTGTCCACTGGCGG + Intronic
1063071924 10:2675417-2675439 CCTCCTCTTCTGTGACCAGGAGG + Intergenic
1063365656 10:5488740-5488762 CCCCCTGCACTGAGCCCTGGTGG - Intergenic
1063447289 10:6127458-6127480 CCTCCTCTTCTGTCTCCTGGAGG - Intergenic
1063447301 10:6127502-6127524 CCTCCTCTTCTGTCTCCTGGAGG - Intergenic
1063447312 10:6127546-6127568 CCTCCTCTTCTGTCTCCTGGAGG - Intergenic
1063447324 10:6127590-6127612 CCTCCTCTTCTGTCTCCTGGAGG - Intergenic
1063447347 10:6127678-6127700 CCTCCTCTTCTGTCTCCTGGAGG - Intergenic
1064015967 10:11772651-11772673 CCTACTCAACTATGTTCTGGAGG - Intergenic
1069945279 10:71981334-71981356 CCTCCTCCTCTGTAGCCTTGGGG + Intronic
1072793444 10:98336095-98336117 CCTCCTCCCGTGTGCCGTGGCGG - Intergenic
1073106539 10:101035569-101035591 CCTTCTCCCCTGTGTCCGGATGG - Exonic
1073509928 10:104036551-104036573 CCATCTCCACTGGCTCCTGGTGG + Exonic
1073522130 10:104142330-104142352 CCTCCTCAACTCTCTTCTGGAGG + Exonic
1075444143 10:122502121-122502143 CTTACTGCTCTGTGTCCTGGTGG + Intronic
1075664406 10:124220509-124220531 CCTCCTCCACTTTGTCTTTAGGG - Intergenic
1075871583 10:125775146-125775168 CCTCCTCCAGAGAGTCGTGGTGG - Intronic
1075941076 10:126390510-126390532 CCTACTTCACTGTGTGGTGGTGG - Intergenic
1076618533 10:131772163-131772185 CCTCCTTCACTCAGGCCTGGGGG - Intergenic
1076662434 10:132064586-132064608 CCTCCTCCCCTGTGACATAGAGG + Intergenic
1076760840 10:132605196-132605218 CCTCCCCCACTCCCTCCTGGGGG - Intronic
1076760861 10:132605244-132605266 CCTCCCCCACTCCCTCCTGGGGG - Intronic
1077802359 11:5552673-5552695 CTTCCTCCACTGCTTCCTAGGGG + Intronic
1080261025 11:30349842-30349864 CCTCCACCACTGAGACCTGGTGG + Intergenic
1081592731 11:44436140-44436162 CTTCCACCACTGTGTCTGGGAGG - Intergenic
1081914435 11:46721648-46721670 CCTCCTGCACTGTGTTCTGAAGG + Intronic
1082903893 11:58285345-58285367 CTGCCTCTACTGTGTCCTGCAGG - Intergenic
1083324298 11:61865698-61865720 CCTTCCCCACGGTGTCCCGGGGG - Exonic
1083814511 11:65125172-65125194 CCTCCTCCACTGGGTCAGGGAGG - Intronic
1084537349 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG + Intergenic
1086753545 11:90529744-90529766 CCTGCCCCACTGTGGCCTTGGGG + Intergenic
1087275502 11:96156510-96156532 CTTCCTCCTCAGTGTCTTGGAGG - Intronic
1088529119 11:110788775-110788797 CCTCCTCCACAGTGACATAGGGG + Intergenic
1089281426 11:117377360-117377382 CCCCCTGCTCTGTGGCCTGGGGG + Intronic
1089942289 11:122431120-122431142 CCTGATCCAGTGTATCCTGGAGG + Intergenic
1089965577 11:122652512-122652534 TCTCCTTCACTCTGTCCTTGAGG - Intergenic
1091703679 12:2679849-2679871 TCTCCTCCACTGTCTCCTGAGGG - Intronic
1091771999 12:3158166-3158188 CCTGCTTCCCTGTGTCCCGGAGG + Intronic
1094234757 12:28151029-28151051 CTTCCTCCATTGTGTCCTTTTGG + Intronic
1096226123 12:49867898-49867920 CCTCCTACTCTGGGTCCTGAGGG - Exonic
1096524930 12:52204903-52204925 CCTGCTCCACTGTCTCTGGGCGG + Intergenic
1096550974 12:52371338-52371360 CGTTCTCCAGTGTGTCATGGCGG + Intergenic
1097079599 12:56420484-56420506 CCTCCTCCTCACTGTCATGGTGG - Intronic
1097193604 12:57232025-57232047 CCTCATCCACTGTGACATGCAGG - Intronic
1097809854 12:64006754-64006776 CAACCACCAGTGTGTCCTGGGGG + Intronic
1097901688 12:64880146-64880168 CATCCATCACTGTATCCTGGTGG - Intronic
1099752920 12:86801383-86801405 TCTCTTCCACTGAGTCCTTGGGG - Intronic
1100438295 12:94592055-94592077 TTTCCCCCACTGTGTGCTGGAGG + Intronic
1100581412 12:95943330-95943352 CGTCCTCCACTGAGTCCTGCCGG + Exonic
1101718467 12:107331562-107331584 CCTCCTCCACCTGGTGCTGGTGG + Intronic
1101943946 12:109121670-109121692 CCTGCTCCACTGAGTCCTTGGGG - Intronic
1102118224 12:110419764-110419786 TCTCCTCCACTTTGCCGTGGGGG - Intergenic
1102519173 12:113468348-113468370 CGTCCTGCAGTGCGTCCTGGAGG + Exonic
1102631933 12:114288585-114288607 TCTCCTTCACTGTGTGGTGGTGG - Intergenic
1102969852 12:117157776-117157798 CCTCCTCCACTGTGTCCTGGGGG + Intronic
1103418112 12:120758245-120758267 ATTGCTTCACTGTGTCCTGGAGG + Intergenic
1104345497 12:127993086-127993108 TCTCCTCCACTGTGTCCATGTGG - Intergenic
1104528638 12:129548249-129548271 CCTCCTTCACTCGGTGCTGGAGG + Intronic
1106012486 13:25838125-25838147 CCTCCTGTGCTGTGTGCTGGTGG + Intronic
1106080651 13:26497750-26497772 CATCCTGCAGGGTGTCCTGGGGG - Intergenic
1108493560 13:51003787-51003809 TCTTCTCCACTTTGTCCTGAGGG - Intergenic
1109247304 13:59971057-59971079 CCGCCTCCACTGCCTTCTGGTGG - Exonic
1112841167 13:103579954-103579976 CCTTCTTGACTGTGTCCTTGAGG - Intergenic
1112860036 13:103819100-103819122 CCTCCTACACTGTGTGCTCCTGG - Intergenic
1113255027 13:108496366-108496388 CCTCCTCCTCTGTTTCTTTGGGG + Intergenic
1113857312 13:113454581-113454603 CACCCTCCACTGTCTGCTGGTGG + Intergenic
1116203481 14:41830764-41830786 GCTCCTGCTCTGTCTCCTGGTGG + Intronic
1117119651 14:52553402-52553424 CCTCTTCCTCTGTCTCCTGTGGG + Exonic
1118736449 14:68704786-68704808 CCTCCTCTAGTGTGTGTTGGGGG - Intronic
1120709891 14:87781954-87781976 CCCCCTCCACTGTTTGCTTGAGG + Intergenic
1121613136 14:95294696-95294718 CTCCCTGCCCTGTGTCCTGGGGG + Intronic
1122346988 14:101066912-101066934 CCAGCTCCACTCTGTTCTGGGGG + Intergenic
1122884747 14:104706023-104706045 CCTCCTGCACAGAGACCTGGAGG + Exonic
1122998612 14:105279586-105279608 TCTCCTACACTGCTTCCTGGTGG + Intronic
1124050209 15:26190084-26190106 CCTCATTCACTCTGTGCTGGAGG + Intergenic
1124364439 15:29062142-29062164 ACTACTCCACTGAGGCCTGGGGG - Intronic
1124796693 15:32788127-32788149 TCAACTCCCCTGTGTCCTGGGGG - Intronic
1125725067 15:41864009-41864031 CATCACCCACTGTGTCCTGCAGG + Exonic
1126870522 15:52982218-52982240 TGTCCTCCACTCTGACCTGGAGG + Intergenic
1127486317 15:59421037-59421059 CGTGCTCTACTGTGTTCTGGTGG + Intronic
1127969317 15:63946193-63946215 CGTGCTCCTTTGTGTCCTGGGGG + Intronic
1128315527 15:66657087-66657109 CCTCCTCCACTCTGTTTTTGTGG + Intronic
1129480834 15:75824333-75824355 CATCCTGCCCTCTGTCCTGGAGG + Intergenic
1129743976 15:78005238-78005260 CCTCCTCCACTGAGCTCTGGAGG + Intronic
1129973689 15:79803201-79803223 TCTCCTCCACTTTCTCCTCGTGG - Intergenic
1130221205 15:82021048-82021070 CCCTCTCCACTGTCTTCTGGAGG - Intergenic
1130923105 15:88365577-88365599 CCTCGGCCAGTGTGTCCTGGAGG - Intergenic
1131121809 15:89827696-89827718 CCTCCCCCTCTGTCTCCTTGTGG - Intergenic
1131259967 15:90883096-90883118 CCCCCAACACTGTGCCCTGGTGG + Exonic
1132399753 15:101498059-101498081 CAGCCTCCACTGTGTGCTTGGGG - Intronic
1132465361 16:75095-75117 CCTACTACTCTCTGTCCTGGTGG + Intronic
1132808953 16:1788547-1788569 CCGCCTCCACTGTGCCCTGCAGG + Exonic
1133038154 16:3046197-3046219 CCTGCCCCACGGGGTCCTGGGGG + Intergenic
1134018840 16:10907625-10907647 CCTCCTGCAATGCTTCCTGGGGG + Exonic
1136479741 16:30534068-30534090 CCTCCTCAACTGCGGCCAGGAGG - Intronic
1137262768 16:46844525-46844547 CCTCGGCCACTGGGTCTTGGTGG + Intergenic
1137556756 16:49475062-49475084 CCTCCCCCACGGTTTCCAGGAGG - Intergenic
1137960411 16:52876740-52876762 CCTCCTCCACTGTCTCTTCTTGG - Intergenic
1138229035 16:55324393-55324415 CCTCCTCCCCTGCGGCCCGGAGG - Exonic
1142492684 17:289016-289038 CCCCCTCCCCTGTGTTCTTGGGG - Intronic
1142741418 17:1934020-1934042 CCTGCTCCCCTGTGGCCTGCAGG - Intergenic
1144011591 17:11153459-11153481 CCACCTCCAGTGTGTTCTGAAGG - Intergenic
1144728655 17:17514471-17514493 CCTCTGCCACCGGGTCCTGGTGG - Intronic
1145016420 17:19401552-19401574 TCTCCTCCAGTCTGTCCCGGTGG + Intergenic
1145058160 17:19716525-19716547 CCAGGGCCACTGTGTCCTGGAGG + Exonic
1145761844 17:27429876-27429898 CGTCCTACACCCTGTCCTGGTGG + Intergenic
1145866838 17:28247249-28247271 CCTCCTAGACAGTGTGCTGGAGG - Intergenic
1145888321 17:28397738-28397760 CCTCCTCCACTGGGTTCAGAGGG + Exonic
1146918209 17:36691562-36691584 CCTCCTGAACTGGATCCTGGGGG + Intergenic
1147587799 17:41662716-41662738 CCTCCTCCACCCACTCCTGGTGG + Intergenic
1147648740 17:42050246-42050268 CCTCCTCCCCGGGCTCCTGGGGG + Intronic
1148388703 17:47254548-47254570 CCTCCTCCAGTGTCCCCAGGTGG + Intronic
1148450823 17:47777043-47777065 CCCTCTCCCCAGTGTCCTGGGGG - Intergenic
1150494192 17:65594693-65594715 CCTCCTGCAATGTGTCATGAAGG + Intronic
1150819943 17:68426989-68427011 CCCCCTTCACTGTTACCTGGGGG - Intronic
1150819960 17:68427033-68427055 CCCCCTTCACTGTTACCTGGGGG - Intronic
1151656565 17:75498972-75498994 CCACGTCCACTTTGGCCTGGAGG + Exonic
1151713216 17:75818344-75818366 CCTTCTCCACTGAGTCTAGGAGG - Intronic
1152261713 17:79270722-79270744 CCTCCTCCACTGGGCCTAGGGGG + Intronic
1152859804 17:82689527-82689549 CCACCTCGCCTGTGTCCTGCAGG - Intronic
1152934148 17:83126245-83126267 CCTGCTCCACTGAATGCTGGGGG + Intergenic
1153394830 18:4607167-4607189 CCTCCTCCCCTGTTCCCTAGTGG + Intergenic
1154383805 18:13875632-13875654 CCTCCTGGACTCCGTCCTGGTGG - Intergenic
1158230020 18:55244108-55244130 CCTCCTCCCCTGGGAGCTGGAGG - Intronic
1160187629 18:76687928-76687950 CCTCCTCCTGTGTGTCATGCGGG - Intergenic
1160878282 19:1308055-1308077 CCTCCTGCACGGTCGCCTGGTGG + Intergenic
1161058780 19:2203851-2203873 CCACCTCATCTGTATCCTGGCGG + Intronic
1161141566 19:2651178-2651200 CCCTCCCCACTGTGTCCTGGAGG + Intronic
1161333610 19:3699728-3699750 GCCCCACCAGTGTGTCCTGGGGG + Intronic
1161768000 19:6217386-6217408 GCTCTCCCACTGTGTCCTGCAGG + Intronic
1161864285 19:6822215-6822237 CCTCCTCCACCGTGTCGCTGTGG - Exonic
1161947124 19:7444379-7444401 CCTCCTCCAGGGACTCCTGGCGG - Exonic
1161984749 19:7647155-7647177 GGTCCTCCACGGCGTCCTGGCGG - Exonic
1162055104 19:8058014-8058036 CCACCTCTCCTGGGTCCTGGAGG - Intronic
1162461233 19:10815605-10815627 GCTCCTCCTCTGTGCACTGGGGG - Intronic
1162867566 19:13560424-13560446 CCTCCTCCAGTGCTTCCTGATGG + Intronic
1163233482 19:16018653-16018675 CCTCTCCCACTGTGCCCTGGTGG + Intergenic
1164267726 19:23636247-23636269 CCACCTTAGCTGTGTCCTGGAGG - Intronic
1165132656 19:33642259-33642281 ACTCATCCACGGGGTCCTGGGGG - Intronic
1165261549 19:34623465-34623487 CCATCTCCTCTGGGTCCTGGTGG + Intronic
1165403931 19:35618646-35618668 CCTCCTCCACCAGGCCCTGGAGG - Exonic
1166510827 19:43407782-43407804 CCTGCTGCACTGCGTCCTGTTGG - Intronic
1168244066 19:55101632-55101654 CTTCCACCCCTGAGTCCTGGGGG - Intronic
1168278334 19:55289393-55289415 CCACTTCCACTGGCTCCTGGTGG - Intronic
1168407681 19:56119537-56119559 CCACTCCCACTCTGTCCTGGTGG + Intronic
925350969 2:3200566-3200588 CCTCCTCCTCTGTGTGCTCCTGG - Intronic
925431796 2:3801171-3801193 CCTCCTTCAGTGAGTCCTGCTGG - Intronic
926062290 2:9812120-9812142 CCCCCTCCTGTGTGTCCTGCTGG + Intergenic
926268518 2:11346408-11346430 CCTCCTCCATTGAGCCCAGGAGG + Intronic
926650795 2:15342502-15342524 GCTTCTCCTCTGTCTCCTGGAGG - Intronic
928255623 2:29719825-29719847 CCTCAGCCATTGTGTCGTGGGGG - Intronic
928324942 2:30311785-30311807 CCTGCTCCACTGTTCCCTGCAGG - Intronic
928646597 2:33359951-33359973 CCAGCTCAACTGTGTCCTAGAGG - Intronic
932593238 2:73079617-73079639 CCTCCTGGACAGTGTTCTGGGGG + Intronic
933097108 2:78199099-78199121 CATCCTCCATTTTGCCCTGGAGG - Intergenic
936039055 2:109135305-109135327 CCTCCTTCCACGTGTCCTGGGGG - Intronic
936090708 2:109499711-109499733 CCTCCTCCTCTGTGGCTTGCAGG + Intronic
937169448 2:119851069-119851091 CATCCTCTACTGTTTTCTGGAGG + Intronic
937243595 2:120478007-120478029 CCTCATCCCCTGTGGCCTGCTGG + Intergenic
937474925 2:122206760-122206782 CCTCCTGCACTGTTTTCAGGAGG - Intergenic
937865960 2:126752049-126752071 CCTCCTCTACTCTGGCCTGTGGG - Intergenic
939332565 2:140783837-140783859 CCTTCTTCTCAGTGTCCTGGGGG - Intronic
941696674 2:168560260-168560282 CCTCCCCCGCTGGGTCCTGTGGG + Intronic
943308209 2:186293790-186293812 CCTACTCCACATTGTCCTGGTGG + Intergenic
943769738 2:191703607-191703629 CCTACTCCCCTGTGTCCCTGTGG - Intergenic
945916807 2:215712895-215712917 ACTCCTCTACTGAGTTCTGGAGG + Intergenic
945971461 2:216235439-216235461 CAGCCTCCACTGTGTCCAGTTGG + Intergenic
946386097 2:219385453-219385475 CCATCTCCACTATGTCCTTGGGG + Exonic
946499252 2:220228412-220228434 ATTCCTCTCCTGTGTCCTGGGGG + Intergenic
948304924 2:236939724-236939746 CCTCCTACCCAGTGTCATGGGGG - Intergenic
948317141 2:237036888-237036910 TCTGCTTCACTGTTTCCTGGAGG - Intergenic
948540631 2:238689418-238689440 CCTCCTCCTCTGTAGCCTGAAGG + Intergenic
1171360625 20:24584150-24584172 CCTTCTGCTCTGTGGCCTGGTGG - Intronic
1172289025 20:33761959-33761981 GTGCCACCACTGTGTCCTGGAGG - Exonic
1172329847 20:34067851-34067873 CCAGCTCCTCAGTGTCCTGGGGG + Intronic
1172505105 20:35455548-35455570 CCTCGCTCCCTGTGTCCTGGCGG + Exonic
1172801230 20:37577628-37577650 CCTCCTGCTATGTGGCCTGGGGG - Intergenic
1173810623 20:45953016-45953038 CCTCCTCCACTAGCTCCTGGTGG - Intronic
1174017357 20:47499732-47499754 CCTGAGCCACTGTGCCCTGGTGG + Intergenic
1175539461 20:59739187-59739209 CATCCTCCACTGTGTTTTTGAGG - Intronic
1175988051 20:62773999-62774021 CCTGCTCCACTGTCCCCTCGGGG - Intergenic
1177429536 21:20973927-20973949 ACTACTCCACTCTGTCCTTGAGG - Intergenic
1178408147 21:32342256-32342278 CATCCAACCCTGTGTCCTGGAGG - Intronic
1178768771 21:35482545-35482567 CCTTCTACACTGGGTCTTGGGGG - Intronic
1179118655 21:38521111-38521133 CCTCCTCGACTCTGTGCTGTCGG - Intronic
1180761961 22:18217333-18217355 CCTGCTCTACTGTGGTCTGGAGG + Intergenic
1180773706 22:18407277-18407299 CCTGCTCTACTGTGGTCTGGAGG - Intergenic
1180805055 22:18656821-18656843 CCTGCTCTACTGTGGTCTGGAGG - Intergenic
1180805688 22:18712587-18712609 CCTGCTCTACTGTGGTCTGGAGG + Intergenic
1180968428 22:19802445-19802467 CCTCCACCCCTATGTCCTTGGGG - Intronic
1181035101 22:20166138-20166160 CCGGGCCCACTGTGTCCTGGTGG + Intergenic
1181069762 22:20325994-20326016 CCTGCTCTACTGTGGTCTGGAGG - Intergenic
1181192805 22:21154202-21154224 CCTGCTCTACTGTGGTCTGGAGG - Intergenic
1181216637 22:21338372-21338394 CCTGCTCTACTGTGGTCTGGAGG + Intergenic
1181437918 22:22921137-22921159 CCTGCTACTCTCTGTCCTGGAGG - Intergenic
1181935574 22:26436104-26436126 CCTTTCCCACTGTTTCCTGGGGG - Intronic
1182042514 22:27249406-27249428 CATCCTCTCCTGTATCCTGGAGG - Intergenic
1183297316 22:37037870-37037892 CCTCCTCCCTTGGCTCCTGGCGG - Intergenic
1183306642 22:37086382-37086404 CCTCCACCACGGGCTCCTGGCGG + Exonic
1183540722 22:38427868-38427890 CTTCTTCCACGGTGACCTGGAGG - Exonic
1183621202 22:38973843-38973865 TCTCCTCCAGTGTGGCCTGGGGG - Intronic
1184041003 22:41943609-41943631 CCTGCTCTACTGTGACCTGGAGG - Exonic
1184187733 22:42876103-42876125 CCTCCTCCCCTGGATGCTGGGGG + Intronic
1184667796 22:45997721-45997743 CCTCCACCACTGGAACCTGGGGG + Intergenic
1203235536 22_KI270731v1_random:148251-148273 CCTGCTCTACTGTGGTCTGGAGG - Intergenic
951032758 3:17901262-17901284 CCTACTCAACATTGTCCTGGAGG - Intronic
952728895 3:36618703-36618725 CTTCCTCTCCTGTGTTCTGGAGG - Intergenic
952932276 3:38369512-38369534 CCTCCTCCACTGGGCCAAGGTGG - Intronic
954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG + Exonic
954684069 3:52361142-52361164 CCACCTCCTCTGTCTCCTGCAGG + Exonic
959849744 3:111072036-111072058 CCGTCCCCGCTGTGTCCTGGAGG + Exonic
961040685 3:123676037-123676059 CCTGATGCTCTGTGTCCTGGGGG - Intronic
961309054 3:125981848-125981870 TCTCCTCTACTGTGTCTTGCTGG + Intronic
961514833 3:127426020-127426042 CCACCTCCAGTGAGTCCTGGGGG + Intergenic
961586649 3:127933712-127933734 AGTCTTCCACTGTCTCCTGGTGG - Intronic
961656846 3:128447356-128447378 CCTCCTGCACTGAGCACTGGAGG - Intergenic
962342940 3:134600612-134600634 CCTTCTGCCCTGTGGCCTGGGGG + Intronic
962823009 3:139071143-139071165 CCTCCTCCACTGGGAATTGGTGG - Intronic
963146553 3:142000877-142000899 CCTGCTCCAGTGTGTCCAGAAGG - Intronic
964543384 3:157804492-157804514 ACCCCTCCACTGATTCCTGGTGG + Intergenic
966377129 3:179307757-179307779 CCTCCTCCACCCTCTCCTGACGG - Intergenic
966453257 3:180086127-180086149 CCTGCCCCAGTGTGTCCAGGAGG + Intergenic
967251111 3:187539835-187539857 CCTCCTCCCCTTTCTCCTTGGGG - Intergenic
968438126 4:606016-606038 CCTCCTGCTGTGTGGCCTGGGGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969553796 4:7892438-7892460 CCTCCCCCAGTGTCTCCTTGGGG - Intronic
970378316 4:15480757-15480779 CCTCCTGCACAGGCTCCTGGGGG - Exonic
970443769 4:16107407-16107429 CCTCCTCTACAGTCTCATGGTGG + Intergenic
971502843 4:27334972-27334994 GCTCTTTCACTGTGTCATGGTGG + Intergenic
973757796 4:54092389-54092411 CCTCCTGCCCTGTGTCCCCGGGG - Intronic
976136854 4:81947068-81947090 CGTCCTACTCTGTGTCCTGGAGG + Intronic
977562310 4:98544961-98544983 CCTCCTCCATTCTGACCTTGTGG + Intronic
977903967 4:102454982-102455004 CCTGCTCCAGCGTGTCCAGGAGG - Intergenic
979353710 4:119676792-119676814 CCTCCTCCACTATTACCTTGAGG + Intergenic
979671160 4:123361365-123361387 CCTACTCCACACTCTCCTGGAGG - Intergenic
981785563 4:148475236-148475258 CCTTCTCCACTGTGTGTTCGTGG - Intergenic
982380734 4:154744650-154744672 AGTCCTCCACTGTGTCCACGCGG - Exonic
983649166 4:170021287-170021309 ACTCTACCACTGAGTCCTGGTGG + Intronic
984784718 4:183556948-183556970 ACTCCTCCACTGTGTCAGAGAGG + Intergenic
984844871 4:184100646-184100668 TCTCCTGCAATGTGTGCTGGAGG + Intronic
985632638 5:1021981-1022003 CCTCCTTCCCTGTTTCCTGCTGG + Intronic
985635015 5:1031574-1031596 TCTCCTTCTCTGTGTCCTGAAGG + Intronic
985870200 5:2548426-2548448 CCTCCTGCACTGTGCCCATGCGG + Intergenic
985909703 5:2869292-2869314 CCTGCTGCACTGTGGTCTGGTGG - Intergenic
986022931 5:3821727-3821749 CCTGCTCACCTGTGCCCTGGGGG + Intergenic
986062303 5:4203022-4203044 CCCCCTGCACTGTGCCCTGAGGG + Intergenic
986264469 5:6180710-6180732 CCTCCTCCTCTGCATCCTGAGGG + Intergenic
986352796 5:6895873-6895895 CTTCCTCCACTGAGGCCAGGTGG + Intergenic
987058534 5:14219291-14219313 CCTACTCCACTGTGGGCGGGGGG - Intronic
987358736 5:17087447-17087469 CCACCTTCACTGTTTCCTGCTGG + Intronic
991024449 5:62014708-62014730 CCCCCTCCTCTGTGTGCTGGGGG + Intergenic
991665571 5:68996339-68996361 CCTCCTGCTGTGTGGCCTGGGGG - Intergenic
992155247 5:73948940-73948962 CCTGGTGGACTGTGTCCTGGTGG + Intergenic
992320495 5:75608798-75608820 CTTCATCCACTGTTTCCTGGTGG - Intergenic
992321821 5:75620978-75621000 CCTCCCCTACTTGGTCCTGGAGG - Intronic
992743355 5:79795669-79795691 CCCTCTTCACTGTGTCCTGCAGG - Intronic
993415379 5:87622768-87622790 TCTCTTCCACTGTTACCTGGCGG - Intergenic
996397346 5:123026653-123026675 CATCATCCTCTGTGTCCTGATGG - Intronic
997436645 5:133880476-133880498 CCTCCTCAACTGTACCATGGAGG + Intergenic
997872817 5:137520185-137520207 CCTCCCCTCCTGTGGCCTGGAGG - Intronic
997881755 5:137598237-137598259 TCTCCTCCACTGCGTGGTGGAGG - Intronic
999273756 5:150314560-150314582 CCTGCTCCACAGTGTCCTCAGGG + Intronic
999295621 5:150457979-150458001 CCTCCTCCCCTGGACCCTGGAGG - Intergenic
1001395841 5:171419409-171419431 CCTCCTCCTCCTTCTCCTGGCGG - Intergenic
1001433400 5:171681230-171681252 CAGCCACCACAGTGTCCTGGAGG + Intergenic
1001999886 5:176191687-176191709 ACTCCTCCACCGTGGCCTGTAGG - Intergenic
1002963702 6:1941811-1941833 CCTGCTCTCCTGTGCCCTGGAGG - Intronic
1003056397 6:2824694-2824716 CCACCTCCTCTGGCTCCTGGTGG + Intergenic
1003126877 6:3362774-3362796 CTTCCTCTCCTGGGTCCTGGAGG - Intronic
1003307481 6:4942846-4942868 CCTGCTCCACTGAGGGCTGGAGG - Intronic
1003470858 6:6430263-6430285 CCTCTTTCACTGTGTCCTATAGG - Intergenic
1004427121 6:15514026-15514048 CCTTCTCGACTGTGCCCTGCTGG + Intronic
1005214659 6:23511142-23511164 CCTCCTGCACTATATCCTAGGGG + Intergenic
1005926517 6:30449885-30449907 CCTCCAGCCCTGGGTCCTGGTGG - Intergenic
1005928232 6:30462457-30462479 CCTCCAGCCCTGGGTCCTGGTGG - Intergenic
1005932515 6:30494022-30494044 CCTGCTCCAGTGTGTCCGTGAGG + Exonic
1005990500 6:30899031-30899053 TCTCCTCCACTCTGACCTGCCGG - Exonic
1007259473 6:40553541-40553563 CTTTCCCCACTGTGTTCTGGTGG + Intronic
1007469934 6:42083084-42083106 CCTCCTCCCCTGTTTCCCAGAGG + Exonic
1007958940 6:45941364-45941386 CCTCCTCCCCTGTGTCAAGGGGG + Intronic
1009933719 6:70207191-70207213 CATCTTCCACTGGGTCCTGGGGG - Exonic
1011209228 6:84936712-84936734 CCTCCTCAAGTGTGTCCCTGAGG + Intergenic
1011772991 6:90695562-90695584 CCTCCTCCACTGTGACCTGAAGG - Intergenic
1015143114 6:129958118-129958140 ACTCCTCCACTGTGTCCCAGGGG + Intergenic
1017027968 6:150197860-150197882 CCTCCTCCACTGTGGCGGGCAGG - Intronic
1017690069 6:156955655-156955677 GCTCCTTCCCTGTGTCCAGGAGG + Intronic
1018076233 6:160216077-160216099 CCTGCTCCACTTTCGCCTGGTGG - Intronic
1019017938 6:168893574-168893596 TCTCCTCCTCTGTGTCCGGAAGG + Intergenic
1019539983 7:1547107-1547129 CGTCCTGCACGATGTCCTGGGGG + Exonic
1019768332 7:2867367-2867389 CCTCCTCCCCTGCAGCCTGGGGG + Intergenic
1019927002 7:4199812-4199834 CCTCCTCTTCTGTGTTCTTGAGG + Intronic
1020100836 7:5393594-5393616 CCTCCTCCCAGGTGTCCTGTAGG - Intronic
1021690207 7:23223606-23223628 CCTCCTCCTCTGTCTGCTGGTGG + Intergenic
1022410847 7:30137125-30137147 CCCTTTCCACTGTATCCTGGGGG - Intronic
1022521579 7:31011345-31011367 TCAACTCCACTGTGTCTTGGAGG + Intergenic
1022657268 7:32330954-32330976 CCTCCTCCTCTGTCTCCTTGGGG + Intergenic
1024624974 7:51199158-51199180 CCCTCTCCACTGTGGCCTGCTGG + Intronic
1026116200 7:67497718-67497740 CCTGCTCCCCTGTGTCTTGGAGG + Intergenic
1026329191 7:69337203-69337225 CCTCTTCCCTTGTGTCCTTGGGG + Intergenic
1026678078 7:72445264-72445286 CCTCTTCCTCTGTTGCCTGGTGG - Intronic
1027266609 7:76498299-76498321 CCTCCTCGCCTGTGGGCTGGAGG - Intronic
1027317990 7:76996417-76996439 CCTCCTCGCCTGTGGGCTGGAGG - Intergenic
1029821156 7:103149108-103149130 CCTCCTCCACGGTCTCTGGGCGG - Exonic
1030273080 7:107690925-107690947 TCTCTTCGACTGTGTCCTGCTGG - Intronic
1031341152 7:120603651-120603673 CCTCCTCCCCTGACTCCTTGGGG + Intronic
1031375861 7:121025180-121025202 CCTCTTACACTGTCTCTTGGTGG + Intronic
1032076523 7:128838649-128838671 CCACCTCCACTGTGTCCCGCCGG - Exonic
1033422586 7:141216933-141216955 CCTGTCCCGCTGTGTCCTGGAGG - Intronic
1033966153 7:146976951-146976973 CCTCCGCCTTTCTGTCCTGGAGG - Intronic
1034309143 7:150071654-150071676 CCACCTCCCCTCTGTCCTCGAGG - Intergenic
1034797712 7:154028982-154029004 CCACCTCCCCTCTGTCCTCGAGG + Intronic
1035056885 7:156041691-156041713 CATCCTCCACTGACTCCTTGGGG + Intergenic
1035075471 7:156174711-156174733 CCTTCGCCACGCTGTCCTGGAGG + Intergenic
1035238755 7:157516862-157516884 CATGCTCCACTCTGTCCTGTGGG - Intergenic
1035626817 8:1076907-1076929 CCTCCTCCTCTTGGTCTTGGGGG - Intergenic
1036926380 8:12909736-12909758 CCTCCTCCAGGGCCTCCTGGGGG + Intergenic
1043481486 8:80657132-80657154 CCTCCTCCTCCTTCTCCTGGTGG - Intronic
1044279901 8:90342288-90342310 CCTTCTCCACTGAGCCCTGAAGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045324051 8:101103634-101103656 CCGCCAACACTGTGTGCTGGGGG - Intergenic
1046652445 8:116852046-116852068 CCTCCATCACTGACTCCTGGAGG + Exonic
1047496993 8:125415567-125415589 CCTCCTCCAAGCTGTCCTGTGGG + Intergenic
1047550684 8:125869384-125869406 CCTCCATCACTGGCTCCTGGAGG - Intergenic
1048181738 8:132201655-132201677 TCTACTCCAGTGTGTCCAGGAGG - Intronic
1048303700 8:133268787-133268809 CCTCCTCCTGTGTGTGCTGGGGG - Intronic
1049233576 8:141496680-141496702 CCTACTCAACAGTGTCCTTGAGG - Intergenic
1049759105 8:144323897-144323919 CCTCCTCCACTCTGGCCTCTGGG + Intronic
1051338942 9:16093341-16093363 CCACCTCCACAGTGGCCTGTGGG - Intergenic
1051738204 9:20224986-20225008 CCTCCTCCACAATTTCCTGAGGG + Intergenic
1051823224 9:21192192-21192214 CCTCCACCACTGTTTTCTAGTGG + Intergenic
1051827034 9:21232792-21232814 CCTCCACCACTGTTTTCTAGTGG + Intronic
1053412031 9:37922128-37922150 CCTCCTCCACTCTGTCCCCCAGG - Intronic
1053475850 9:38381695-38381717 CCACCTCCACTCTGTCCTCACGG + Intergenic
1056975115 9:91245815-91245837 TCTCCTCCCCTGTGTTCTAGAGG + Intronic
1057375908 9:94522824-94522846 CCTCCTCTTCTGTTTTCTGGAGG + Intergenic
1059231540 9:112725740-112725762 CCCACTCCAGTGTGTCCAGGTGG - Intergenic
1059368712 9:113807720-113807742 CCTCTGCCACTGTGTCGTCGTGG - Intergenic
1060321714 9:122568042-122568064 CCACCACCACTGTGTCCTGCTGG - Exonic
1061009376 9:127946130-127946152 CCTCCAGCAATGTGTCCTGGAGG - Intronic
1061860403 9:133465019-133465041 CCTCCTCCTGTGTGACATGGAGG - Intronic
1062005181 9:134235340-134235362 CTGCCTCCACTGTGCCCTTGAGG + Intergenic
1062500801 9:136851218-136851240 CCTCCTCCAAGATGCCCTGGAGG - Intronic
1186733743 X:12439104-12439126 CCACCTGAACTTTGTCCTGGAGG - Intronic
1187182540 X:16956606-16956628 CCTCCTCCAGTCTGTCCTGCAGG + Intronic
1187228081 X:17393600-17393622 CCTCCTCCACTGTTTCCCCAAGG - Intronic
1189100737 X:38186746-38186768 CCTCCCCACCTGTTTCCTGGAGG + Intronic
1190260320 X:48793218-48793240 TCTCCGCCACAGTGTCGTGGTGG - Exonic
1192194004 X:69016623-69016645 CCACCTCCACTGTGCCCTAAGGG + Intergenic
1192245541 X:69368889-69368911 CCTGCTCTCCTGGGTCCTGGAGG - Intergenic
1195282582 X:103350346-103350368 CCTCCTCCTGAGTTTCCTGGAGG - Intergenic
1195364489 X:104113342-104113364 CCGCCTCCACTGTCGCCAGGCGG - Intronic
1199744416 X:150762746-150762768 GCTGCTCCACTGTCTCCCGGTGG + Intronic
1200684884 Y:6249222-6249244 CCTCTCCCACTCTGTCCTGTAGG - Intergenic
1200990414 Y:9340493-9340515 CCTCTCCCACTCTGTCCTGTAGG - Intergenic
1200993076 Y:9360810-9360832 CCTCTCCCACTCTGTCCTGTAGG - Intronic
1200995730 Y:9381080-9381102 CCTCTCCCACTCTGTCCTGTAGG - Intergenic
1200998395 Y:9401432-9401454 CCTCTCCCACTCTGTCCTGTAGG - Intergenic
1201000903 Y:9469962-9469984 CCTCTCCCACTCTGTCCTGTAGG - Intronic
1201006227 Y:9510572-9510594 CCTCTCCCACTCTGTCCTGTAGG - Intergenic
1201008885 Y:9530881-9530903 CCTCTCCCACTCTGTCCTGTAGG - Intergenic
1201011460 Y:9551070-9551092 CCTCCCCAACTCTGTCCTGTAGG - Intergenic