ID: 1102971111

View in Genome Browser
Species Human (GRCh38)
Location 12:117167573-117167595
Sequence CCAATTTTTTTGTAGAGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12009
Summary {0: 1, 1: 6, 2: 176, 3: 1988, 4: 9838}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102971111_1102971122 27 Left 1102971111 12:117167573-117167595 CCCGGTCTCTACAAAAAAATTGG 0: 1
1: 6
2: 176
3: 1988
4: 9838
Right 1102971122 12:117167623-117167645 CCCAGCTACTCGGGAGGCTGAGG 0: 97626
1: 275854
2: 227041
3: 130261
4: 162635
1102971111_1102971117 17 Left 1102971111 12:117167573-117167595 CCCGGTCTCTACAAAAAAATTGG 0: 1
1: 6
2: 176
3: 1988
4: 9838
Right 1102971117 12:117167613-117167635 CACCTGTAGTCCCAGCTACTCGG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
1102971111_1102971120 21 Left 1102971111 12:117167573-117167595 CCCGGTCTCTACAAAAAAATTGG 0: 1
1: 6
2: 176
3: 1988
4: 9838
Right 1102971120 12:117167617-117167639 TGTAGTCCCAGCTACTCGGGAGG 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
1102971111_1102971118 18 Left 1102971111 12:117167573-117167595 CCCGGTCTCTACAAAAAAATTGG 0: 1
1: 6
2: 176
3: 1988
4: 9838
Right 1102971118 12:117167614-117167636 ACCTGTAGTCCCAGCTACTCGGG 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102971111 Original CRISPR CCAATTTTTTTGTAGAGACC GGG (reversed) Intronic
Too many off-targets to display for this crispr