ID: 1102974978

View in Genome Browser
Species Human (GRCh38)
Location 12:117200190-117200212
Sequence AAGGAGAAGAAGAAAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102974978_1102974980 -2 Left 1102974978 12:117200190-117200212 CCTTCTTCTTTCTTCTTCTCCTT No data
Right 1102974980 12:117200211-117200233 TTCTAGCTTCCTTATGAACCAGG No data
1102974978_1102974981 6 Left 1102974978 12:117200190-117200212 CCTTCTTCTTTCTTCTTCTCCTT No data
Right 1102974981 12:117200219-117200241 TCCTTATGAACCAGGCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102974978 Original CRISPR AAGGAGAAGAAGAAAGAAGA AGG (reversed) Intergenic
No off target data available for this crispr