ID: 1102975931

View in Genome Browser
Species Human (GRCh38)
Location 12:117207299-117207321
Sequence CAGCTGTGCTGGAGGAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 407}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102975925_1102975931 -8 Left 1102975925 12:117207284-117207306 CCCTGGCTATGGATGCAGCTGTG 0: 1
1: 0
2: 0
3: 19
4: 254
Right 1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG 0: 1
1: 0
2: 5
3: 49
4: 407
1102975926_1102975931 -9 Left 1102975926 12:117207285-117207307 CCTGGCTATGGATGCAGCTGTGC 0: 1
1: 0
2: 1
3: 19
4: 160
Right 1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG 0: 1
1: 0
2: 5
3: 49
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102975931 Original CRISPR CAGCTGTGCTGGAGGAAAAG GGG Intergenic
900013465 1:134411-134433 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
900043533 1:490394-490416 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
900064971 1:725397-725419 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
901153899 1:7122818-7122840 CAGGTGTGATGGAGGGAGAGAGG - Intronic
901706362 1:11076488-11076510 CAGTGGTGGTGGAGGAAAAACGG - Intronic
902225683 1:14995093-14995115 CAGCTGCCCTGGAGGAAGAGGGG + Intronic
903577066 1:24345596-24345618 AAGCTGTGCTGGAGGCTTAGGGG + Intronic
903959011 1:27044910-27044932 CTCCAGTGCTGGAGGGAAAGGGG - Intergenic
904599640 1:31666321-31666343 GAGCTATGCTGGAGGAGAAGAGG - Intronic
905696793 1:39980614-39980636 CAGCTGCCCTGGAGGGAAAAAGG - Intergenic
905794718 1:40809220-40809242 CAGCGGTGCAGCAGGAACAGAGG - Intronic
905821743 1:40998032-40998054 CAGCTGAGCTGGTGGAATGGTGG + Intronic
906203714 1:43975774-43975796 CAGCAGTGAGGGAGAAAAAGGGG - Intronic
907430047 1:54406341-54406363 CAGCGGTGCTGGAGGCGCAGAGG - Exonic
907707188 1:56842733-56842755 CCTCTATCCTGGAGGAAAAGAGG - Intergenic
907831793 1:58071141-58071163 CAGATGGGCAGGAGGAAACGAGG + Intronic
908487390 1:64608323-64608345 GAGCTGTACAGGAGGAAAAGGGG - Intronic
908877927 1:68698918-68698940 CAGCTATGCTGGAGGCTGAGGGG + Intergenic
910143293 1:84050984-84051006 CAACTGTGCGATAGGAAAAGAGG + Intergenic
910640502 1:89456218-89456240 AAGCTGTGCTTGGGCAAAAGAGG + Intergenic
911401133 1:97376938-97376960 CAGCTAGGATGGAGTAAAAGTGG - Intronic
912360642 1:109091824-109091846 CAGTTTTACTGGAGGAAGAGAGG + Intronic
912466410 1:109877752-109877774 CGGGTGTGCTGGAGGACAGGCGG + Intergenic
912557951 1:110529836-110529858 CTGCTGTTCTCGAGGTAAAGAGG + Intergenic
912709935 1:111942982-111943004 ATGCTGTGCTGGAGGGAATGCGG + Intronic
913211886 1:116589179-116589201 GAACTGTGCTGGAGGAAACCTGG - Intronic
913563479 1:120047125-120047147 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
913676086 1:121141905-121141927 CAGCAGTGGTGGAGTAAAAAAGG - Intergenic
914027979 1:143929849-143929871 CAGCAGTGGTGGAGTAAAAAAGG - Intergenic
914284073 1:146206489-146206511 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914545104 1:148657228-148657250 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
915148822 1:153812488-153812510 CAGCTTTCCTGGAGAAAGAGAGG - Intronic
915248661 1:154573029-154573051 CAGCTGTCCTAGAGGAAACCTGG - Intronic
915341257 1:155178054-155178076 GGGCTGTGCTGGAGGAGAAGCGG + Exonic
915957939 1:160238838-160238860 CAGCTGTCATGTAAGAAAAGGGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917645593 1:177025896-177025918 CAGCTCCCCTGGAGGAATAGAGG + Intronic
917965796 1:180177756-180177778 CCGCTGGGGTGGAGGAAAAGAGG - Intronic
918065902 1:181101654-181101676 CAGCTGGGCTGCAGGAAGTGTGG - Intergenic
919313787 1:195946602-195946624 CAGCTATGCTGGAGAGAAAAAGG + Intergenic
919500374 1:198330705-198330727 CAGGGATGCTGGAGGAAAGGTGG - Intergenic
920550962 1:206860403-206860425 CAGCCTTGTTGGAGGATAAGAGG - Intergenic
921098976 1:211911957-211911979 CAGCTTTGGTGGAGGAAAGAAGG - Intergenic
921801261 1:219405095-219405117 TACCTGTGGGGGAGGAAAAGAGG + Intergenic
922261905 1:223950904-223950926 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
922735169 1:227974836-227974858 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
922740960 1:228014011-228014033 CAGCTGTGCTGGAGCCAGAGGGG + Intronic
922774975 1:228210460-228210482 CAGCTCTTCTGTAGGAACAGCGG - Intronic
923006567 1:230054536-230054558 CAGCTGTGGTGGAGGAGGATAGG - Intergenic
923777203 1:236990394-236990416 CAGCTGTGATGGGGGGAAAAGGG - Intergenic
924343075 1:243053081-243053103 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1063559342 10:7112049-7112071 CAGGTGGACTGGAGGAAATGTGG + Intergenic
1064141265 10:12792552-12792574 CAGCATTCCTGGAGGAGAAGAGG - Intronic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1066288140 10:33988518-33988540 CAGTTGGTCTGGAAGAAAAGAGG - Intergenic
1066491969 10:35902557-35902579 TAGCTCTGCTGGTGGAAATGTGG + Intergenic
1066733412 10:38452493-38452515 CAGCTGTGCCGGGGGAAAACTGG - Intergenic
1066995597 10:42560131-42560153 GAGCTGTGCTGGATGAAGTGAGG + Intergenic
1067710622 10:48648675-48648697 CAGCTGTCCTGGGGGGAAAATGG + Intronic
1068599268 10:58938228-58938250 AAGCACTGCTGGGGGAAAAGTGG - Intergenic
1069821101 10:71229284-71229306 CAGCTGGTCTGCTGGAAAAGAGG + Intronic
1070038109 10:72747721-72747743 CAGCTATTCTGGAGGCAGAGTGG + Intronic
1070650487 10:78231973-78231995 CAGCTGTGCTCTAGGTACAGGGG - Intergenic
1071427211 10:85571240-85571262 CAGCTGGCTTTGAGGAAAAGAGG + Intergenic
1071453876 10:85826755-85826777 CTGCTGTGCTGGAGGAACTGAGG - Intronic
1071724826 10:88187622-88187644 CAGCTGTCCTGGAGGACAAGTGG + Intergenic
1071914847 10:90282042-90282064 CAGCTAAGCTGGAGAAAAATTGG + Intergenic
1072221959 10:93334275-93334297 CAGAGGTGCTACAGGAAAAGCGG - Intronic
1072641541 10:97214821-97214843 CATCTGGTGTGGAGGAAAAGGGG - Intronic
1072675340 10:97461535-97461557 CAGCAGCGGTGGAAGAAAAGGGG + Exonic
1072727967 10:97826310-97826332 CTGCTGTGCTGGAGGCAATCAGG + Intergenic
1072742155 10:97915870-97915892 CAGCTTTGGTGGAGGAACAGAGG - Intronic
1073245692 10:102088503-102088525 GAGCTGAGCTGGGGGAAAAGAGG - Intergenic
1075759705 10:124846632-124846654 GAGGTGTGCTTGGGGAAAAGGGG - Intergenic
1075904832 10:126072172-126072194 CAACTGTGCTGGGGGAAGATAGG - Intronic
1076033334 10:127177636-127177658 CAGCTGGGCTGGGGGCAATGTGG - Intronic
1076121352 10:127939535-127939557 CAGGTGTGCTGGAGGATACATGG + Intronic
1076969805 11:126625-126647 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1077082150 11:728964-728986 CAGCTGTGCAGGTGGCAGAGTGG - Intergenic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078403133 11:11045239-11045261 TAGCTGTGCTAGAGAAGAAGAGG - Intergenic
1078406780 11:11077057-11077079 CAACAGTGCTGGAGTGAAAGAGG - Intergenic
1078576773 11:12509488-12509510 CAGCTGTGCTGGAGAAAAGATGG - Intronic
1078781283 11:14441525-14441547 CAGCTACCCTGGAGGAGAAGAGG + Intergenic
1078857772 11:15220422-15220444 AAGATTTGCTGGAGAAAAAGAGG - Intronic
1079361699 11:19775854-19775876 CAGCTGTGTTGCAGCAACAGTGG - Intronic
1080925424 11:36751354-36751376 CAGCTGGGCTGGGGGCCAAGGGG - Intergenic
1084503035 11:69546101-69546123 CAGCTGTGCTGGTGGAGCACAGG - Intergenic
1084515997 11:69638286-69638308 CAGCCGCCCTGGTGGAAAAGCGG + Intergenic
1085678325 11:78546569-78546591 GACATGTGCTGGAGGAAAAGTGG - Intronic
1085725443 11:78950992-78951014 CAGGTGTGCTGGAATCAAAGAGG - Intronic
1088797222 11:113274147-113274169 CTGATGTGCAGGAAGAAAAGAGG + Intronic
1089088154 11:115841459-115841481 CACCTGTGCTGGAGGAAGGGAGG - Intergenic
1089195624 11:116692641-116692663 CAGCAGTGCTGGGAGAAGAGAGG - Intergenic
1089695258 11:120212438-120212460 CAGGAAAGCTGGAGGAAAAGAGG + Intronic
1090718049 11:129447548-129447570 CAGGTGTGCTGGAAGGCAAGGGG + Intronic
1090833797 11:130439159-130439181 CACCTGTGCTCTAGGAAATGTGG - Intergenic
1091236384 11:134025073-134025095 GAGCGGGGCTCGAGGAAAAGAGG - Intergenic
1091499934 12:1006494-1006516 CAGCTATGCAGGAGGCAAGGTGG - Intronic
1092875268 12:12842303-12842325 GAGTTCTGCGGGAGGAAAAGTGG + Intergenic
1093459814 12:19397808-19397830 GAGCTGTGCTGAAGGATAACAGG + Intergenic
1094323369 12:29209556-29209578 CAGTTCTGCTGGAGGAAAACTGG + Intronic
1095378940 12:41565922-41565944 GAGCTGAGCTGCAGGAAAAGAGG - Intronic
1095775373 12:46004186-46004208 CAGCCATTCTGGAGGAGAAGAGG - Intergenic
1095852961 12:46831015-46831037 CTGCTGACTTGGAGGAAAAGGGG - Intronic
1097284732 12:57868755-57868777 AAGCTGAGATGGAGGGAAAGGGG - Intergenic
1098135616 12:67398635-67398657 CAGCTGTGGTACAGGAAAATGGG + Intergenic
1099618578 12:84972614-84972636 CAGATCTGCTGGATGAAGAGAGG - Intergenic
1100351777 12:93790697-93790719 CAGCTGTGCTAGAAGAATGGAGG + Intronic
1100404786 12:94263563-94263585 GATCTGTGCTGGAGGAAAAGAGG + Intronic
1100715202 12:97298348-97298370 CAGCTGTTCTGGAGGGAATATGG + Intergenic
1100839971 12:98602993-98603015 TACCTGTGCTGCAGGAAAAAAGG + Intronic
1101446964 12:104743420-104743442 CAGCTGGGCTGGAGGCAGTGGGG + Intronic
1101966990 12:109288205-109288227 CTGCTGGGCTGGAGGAATGGTGG + Intronic
1102223999 12:111215167-111215189 CAGGTGTGCTGGAGGAAGGTGGG + Intronic
1102580603 12:113884391-113884413 CAGATGTCCTGCAGGAATAGAGG - Intronic
1102918537 12:116774182-116774204 CAGCTTTGCAAGATGAAAAGAGG + Intronic
1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG + Intergenic
1104603700 12:130171486-130171508 CAGATGAGCTGCAGGAAGAGAGG - Intergenic
1105596785 13:21846688-21846710 GAGCTGTGCTCCAGGAAACGGGG - Intergenic
1105838672 13:24233837-24233859 CAGCAGTGCTGGAGGAGACTCGG - Intronic
1106043460 13:26116055-26116077 GAGCTGTGAGGTAGGAAAAGGGG + Intergenic
1107111722 13:36705035-36705057 CAGCTGAACTGGAGGCACAGTGG - Intergenic
1107305490 13:39014012-39014034 CAGAAGAGCTGGTGGAAAAGGGG + Exonic
1108090726 13:46846953-46846975 CAGCTGTGCTGGCAAAAATGGGG + Intronic
1108523799 13:51268116-51268138 CAGCTGGGCTACAGGATAAGTGG - Intronic
1109266374 13:60205442-60205464 CAGCTGTGCTGGAAGAGAATAGG + Intergenic
1110645133 13:77873849-77873871 CTGCTGTGCTTGAGTAGAAGTGG + Intergenic
1111534060 13:89578363-89578385 TATCTTTGCTTGAGGAAAAGAGG - Intergenic
1113145589 13:107203986-107204008 CAGGTGAGCTGGAGGCAGAGAGG + Intronic
1113145600 13:107204035-107204057 CAGGTGAGCTGGAGGCAGAGAGG + Intronic
1113145611 13:107204084-107204106 CAGGTGAGCTGGAGGCAGAGAGG + Intronic
1113145624 13:107204147-107204169 CAGGTGAGCTGGAGGCAGAGAGG + Intronic
1113597289 13:111542313-111542335 CATCTGTCCTGGTGGAAAACAGG + Intergenic
1114120697 14:19668487-19668509 CAGCGGTGCTGGAGGCGCAGAGG + Intergenic
1114472575 14:22974009-22974031 CAGCGGTGCTGGAGAAGAAGTGG - Intronic
1115257054 14:31414561-31414583 CTGATGTGCTGGAGGAATAATGG - Intronic
1115291119 14:31774095-31774117 GAGCTCTGCTGGAGTCAAAGTGG - Intronic
1115729563 14:36254062-36254084 CAGCTGTGCTGTAGGTATGGTGG + Intergenic
1117585645 14:57200167-57200189 CATCAGTGGTGGAGGAGAAGGGG - Intergenic
1117938217 14:60931503-60931525 CAGCTGGGCTGGACCAAAATAGG + Intronic
1118912634 14:70074411-70074433 CAGCTCGGCTGCAGGAATAGTGG + Intronic
1119042927 14:71291301-71291323 CAGCAGTGCAGTTGGAAAAGAGG - Intergenic
1119149267 14:72343359-72343381 CAGATGTGATGATGGAAAAGGGG - Intronic
1119703212 14:76768887-76768909 CTACTGTGCTGGTGGACAAGGGG + Intronic
1120827060 14:88965709-88965731 AAACTCTGCTCGAGGAAAAGTGG - Intergenic
1121232833 14:92370901-92370923 CAGCAGTGCTGGATGCTAAGAGG + Intronic
1121698262 14:95930448-95930470 CAACTTTTCTGGAGGAAAATGGG - Intergenic
1122746670 14:103901168-103901190 CTGCGCTGCTGGAGGAAAAGTGG - Intergenic
1123550213 15:21370443-21370465 CTCCTGTACTGGAGGAAGAGTGG + Intergenic
1125205039 15:37144528-37144550 AAGCTGAGTGGGAGGAAAAGTGG - Intergenic
1126416695 15:48425200-48425222 CTCCTGTGCTGGAGGGAAGGAGG - Intronic
1127301163 15:57655194-57655216 CAGTTTTTCTGGTGGAAAAGGGG + Intronic
1128041557 15:64579125-64579147 GGGCTGTGATGGAGGGAAAGAGG - Intronic
1128063449 15:64749448-64749470 CAGCCGTGCAGGAGCAGAAGCGG - Exonic
1128092246 15:64926881-64926903 CAGCTGGCCGGGAGGAGAAGCGG - Exonic
1128219683 15:65959455-65959477 CTGTTTTGATGGAGGAAAAGTGG - Intronic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1128569776 15:68725823-68725845 GAGCTGGGGTGGAGGAAGAGAGG - Exonic
1202958554 15_KI270727v1_random:97698-97720 CTCCTGTACTGGAGGAAGAGTGG + Intergenic
1132691378 16:1183274-1183296 CCTCTGTGCTGGGGGAAAACTGG - Intronic
1132851789 16:2028107-2028129 CAGGGGACCTGGAGGAAAAGGGG - Intronic
1132888783 16:2194333-2194355 CAGCTGTCCTTGAGGGGAAGAGG - Intronic
1133888493 16:9854775-9854797 AAGCACTGCTGGAGGAAATGCGG - Intronic
1134151262 16:11806924-11806946 CAGCTTTGCAGAAGGGAAAGTGG - Intergenic
1134328312 16:13227394-13227416 CAGTTGTGCTGCAAGAGAAGAGG + Intronic
1134328697 16:13230447-13230469 CAGTTGTGCTGCAAGAGAAGAGG + Intronic
1134784241 16:16926368-16926390 CAGCTGAGCTGGAGAAAGTGGGG - Intergenic
1135413192 16:22250423-22250445 CAGCTGGGGTGGAGGAATGGGGG + Intronic
1136059833 16:27718889-27718911 CAGCTGCGGTGGAGGACAAAGGG - Intronic
1136547513 16:30964108-30964130 CAGCTGTGTCAGAGGAAGAGCGG - Exonic
1136701359 16:32146981-32147003 CATATGTGCTTGAGGTAAAGAGG - Intergenic
1136747952 16:32608618-32608640 CAGCTGTGGTGGAGGATGAATGG - Intergenic
1136766305 16:32780483-32780505 CATATGTGCTTGAGGTAAAGAGG + Intergenic
1136801793 16:33089895-33089917 CATATGTGCTTGAGGTAAAGAGG - Intergenic
1137943338 16:52710174-52710196 CAGCTGTGCTGGGAGTAAAGTGG + Intergenic
1138461046 16:57147794-57147816 CAGCTGGGCTGGAGGAAGTTGGG - Exonic
1138545498 16:57716922-57716944 CAGGTGGGCTGGGTGAAAAGAGG + Intronic
1139158206 16:64470305-64470327 GATCTTTGTTGGAGGAAAAGTGG + Intergenic
1139749392 16:69100012-69100034 CTGCTCTGCTGGAGGCAAAGCGG - Intergenic
1140148183 16:72332862-72332884 CTGCTGTGCTGGAGGGACTGAGG + Intergenic
1141004329 16:80337998-80338020 CAGCTGTCCTCCAGGAAAAGTGG + Intergenic
1141609374 16:85172438-85172460 CAGCTGTGCAGGAGGCAGACGGG + Intronic
1142450874 16:90172507-90172529 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1203050089 16_KI270728v1_random:867825-867847 CAGCTGTGGTGGAGGATGAATGG - Intergenic
1203068691 16_KI270728v1_random:1042729-1042751 CATATGTGCTTGAGGTAAAGAGG + Intergenic
1142456692 17:61184-61206 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1143831293 17:9653787-9653809 CAGCTGAGCTATAGGAAAATTGG + Intronic
1144777079 17:17790222-17790244 CAGCTCTGCTGGGAGAAAAGGGG - Intronic
1145990685 17:29077681-29077703 CAGCTTTCCTGGTGGAAAAGAGG + Exonic
1146055411 17:29578364-29578386 TTGCTGAGCTGGAGGAAGAGAGG + Exonic
1146352525 17:32106848-32106870 CAGCTGTGCTGGTGGCTAATGGG + Intergenic
1146377483 17:32304286-32304308 TAGCTGGGCTGGAGGAAGGGTGG + Intronic
1147791963 17:43019642-43019664 CCTCTGTGCAGGAGGGAAAGGGG + Intronic
1147976807 17:44252715-44252737 CAGCTGAGCTGGAAGAGAACTGG + Intronic
1148714661 17:49707623-49707645 CAGCCGGGCAGGAGGACAAGAGG + Intronic
1149696596 17:58621162-58621184 CAGCTGTGATGGGAGAAGAGGGG + Intronic
1149816394 17:59728942-59728964 CAGATGAGCTGGAGAAAAATGGG - Intronic
1150004217 17:61459866-61459888 CAGCTATGAAGGAGGAAATGGGG - Intronic
1150301846 17:64053750-64053772 CAGGTTTCCTGGAGGCAAAGAGG + Intronic
1150465717 17:65391107-65391129 CATCTGTGCCGTAGGCAAAGGGG + Intergenic
1150757524 17:67928951-67928973 CAGCTGTGCTGGTGGCTAATGGG - Intronic
1151027845 17:70700051-70700073 CAGATGTGATGGAGGGAAAATGG - Intergenic
1151349367 17:73522543-73522565 CATCTGTGGTAGAGGAAAGGTGG + Intronic
1152283648 17:79399996-79400018 CAGGAGTGCTGGAGGGACAGTGG + Intronic
1152625684 17:81387001-81387023 CCGCTGTGCTGGAGGCAGCGGGG + Intergenic
1152687423 17:81701488-81701510 CATCTGTGCAGGAGGAAAGCAGG - Exonic
1153711996 18:7809474-7809496 CACCTGGGCTGGAGAAGAAGGGG - Intronic
1155073770 18:22338026-22338048 CAGCTGATATGGAGCAAAAGAGG + Intergenic
1155272515 18:24154319-24154341 CAGATGTGCTGGTGGATAAAAGG + Intronic
1157298414 18:46462329-46462351 AAGCTGTGAAGGAGGGAAAGGGG - Exonic
1157423979 18:47569553-47569575 CAGTTGTGCTGGAGAAACAGAGG - Intergenic
1157722417 18:49935568-49935590 CAGATGTGCTGAAGGCAAGGTGG + Intronic
1158325363 18:56307983-56308005 CAGCTGGGCCAGAGGAAATGAGG - Intergenic
1159995747 18:74962417-74962439 CCTCTGTGCTGGAGAAACAGGGG - Intronic
1160571891 18:79823048-79823070 TGGCTGTGCAGGAGGAACAGAGG - Intergenic
1160646608 19:196543-196565 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1161345437 19:3766825-3766847 CTGGTGTGCTGGAGGAACAGCGG + Intronic
1161734776 19:5984876-5984898 CAGCTGGGCTTCAGGAAAAGGGG + Intergenic
1163127477 19:15251994-15252016 CAGCTGTCCTGGCGGGAAGGAGG - Intronic
1164575639 19:29403934-29403956 GAGCTGTGCTGGAGGGAACGAGG + Intergenic
1165373194 19:35423160-35423182 CACCGGTGTTGGAGGAACAGCGG + Intergenic
1165608958 19:37133919-37133941 CTCCGGTGGTGGAGGAAAAGAGG + Intronic
1166783529 19:45354404-45354426 CATCTGTGCTGGAGGATAACAGG + Intronic
1167109465 19:47450559-47450581 CAGCTCTGTGGGAGGAAGAGAGG + Intronic
1167710390 19:51106999-51107021 CAGATGGGCTGGATGAAAGGTGG - Intronic
925696350 2:6584092-6584114 CAGCTGTGCTGAAAAATAAGGGG - Intergenic
928203768 2:29269475-29269497 CAGCTGTGCTCCAGGAAGAGAGG - Intronic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
930942946 2:57035672-57035694 CAGCAGTGCTTGAGGTAAAGGGG - Intergenic
930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG + Intergenic
930977795 2:57485342-57485364 CAGCTGTGCTCCAAGAACAGAGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932758611 2:74425397-74425419 TAGCTGTGGAGGAGGAAGAGGGG - Exonic
932861904 2:75302862-75302884 CAGCTGTGCAGCAGGCAAAAGGG + Intergenic
933327218 2:80853060-80853082 CAGCTGAACTGTGGGAAAAGAGG - Intergenic
934893110 2:98087626-98087648 CAGCCGCTCTGGTGGAAAAGCGG + Intronic
935704079 2:105840838-105840860 CAGCTGTTCATTAGGAAAAGGGG - Intronic
936938181 2:117858556-117858578 CAGCCGTGCTGGAAGCAAAGCGG + Intergenic
938415447 2:131100259-131100281 CAGGTGGGCTGGAGGAGAAAGGG + Intergenic
938648596 2:133356438-133356460 CAGCAGAGCTGTAGGGAAAGTGG - Intronic
938660025 2:133476885-133476907 AAGCTGTTCTGAAAGAAAAGAGG - Intronic
940834509 2:158505880-158505902 CAGATCTGCTGGTGGAAAGGTGG - Intronic
941736472 2:168982165-168982187 TGGGTGTGCTGGAGAAAAAGGGG + Intronic
942593129 2:177567387-177567409 GAGCAGTGCTGGAGGAAGAGGGG - Intergenic
942624867 2:177889227-177889249 CTCCTGTGCTGGAGGACAATGGG - Intronic
944061582 2:195574487-195574509 AAGCTCTGCTGGAACAAAAGAGG + Intergenic
944448131 2:199812682-199812704 CAGTTGTGTTGGAAGAAAATTGG - Intronic
944874574 2:203949171-203949193 AAGCTGAGATGGAGGAGAAGTGG + Intronic
945168601 2:206972222-206972244 AAGATGTGCAGGAGAAAAAGAGG + Intergenic
945662319 2:212701730-212701752 CTTCTTTGCTGGAGAAAAAGAGG - Intergenic
945920253 2:215748536-215748558 CAGCTGTGCTGGAGGAACTAAGG + Intergenic
946401584 2:219471409-219471431 CAGCTGTGCTGGAGACAGAATGG + Intronic
946999601 2:225438980-225439002 GAGATGTGCTGGAGGGAAAGCGG + Intronic
947370959 2:229445129-229445151 CAATTGTGCTGGAAGAACAGAGG - Intronic
947978550 2:234388167-234388189 CAGCTGTGCCAGAGGAGAAAGGG + Intergenic
948337434 2:237221499-237221521 AGCCTGTGCTGGAGGAACAGGGG - Intergenic
1169609445 20:7362651-7362673 CAGCTGTACTGGAACAAAAAAGG - Intergenic
1169982663 20:11404015-11404037 CAGCAGTGCTAGAAGATAAGAGG - Intergenic
1170435363 20:16321695-16321717 CAGATGTGCAGAAGGAAAATGGG + Intronic
1171493640 20:25539122-25539144 CAACTGTGCTGCAGGGAAATTGG - Intronic
1172330447 20:34072283-34072305 CAGCTGTGCTGGGAGAGAATGGG + Exonic
1173229168 20:41180798-41180820 CAGAGTGGCTGGAGGAAAAGTGG - Exonic
1174348440 20:49949152-49949174 AAGCTGTCCTGGAAGAAAGGAGG + Intronic
1175215528 20:57390154-57390176 CCTCGGTGCTGGAGGAAACGAGG + Intergenic
1175222537 20:57425669-57425691 CAGCTGTGCTGGGGGAGGGGAGG - Intergenic
1175924354 20:62464748-62464770 CTGCTGTGCTGGAGCAAAGCAGG + Exonic
1176212623 20:63932443-63932465 CAGGTGTGCTGGAAGGAATGTGG - Exonic
1176250871 20:64119260-64119282 CAGCCATGCTGGAGGAACTGGGG - Intergenic
1176278898 20:64289679-64289701 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1178227898 21:30745413-30745435 CAATTGTGCTGAAAGAAAAGGGG + Intergenic
1178539226 21:33435315-33435337 CAGCTGTGATGGGGAAAAAGAGG - Intronic
1180840544 22:18956993-18957015 CAGCCCTGCTGGAGGCAAGGTGG + Intergenic
1181060949 22:20281781-20281803 CAGCCCTGCTGGAGGCAAGGTGG - Intronic
1182744512 22:32595209-32595231 CAGAGGTGCTGGACAAAAAGAGG + Intronic
1182977279 22:34635273-34635295 CAGCTGTCCTGGAGGAATTAAGG + Intergenic
1183087256 22:35493989-35494011 CAGCTGGGGAGGAGGAGAAGTGG - Intergenic
1184778375 22:46634465-46634487 CAGCTGTGCAGGAGCAAGGGTGG + Intronic
1185042778 22:48513921-48513943 CAGCAGGGCAGGAGGAAAGGGGG + Intronic
949729616 3:7093338-7093360 TGTGTGTGCTGGAGGAAAAGAGG + Intronic
949867143 3:8555407-8555429 CATCTGAGCTGGAGGACAGGAGG + Intronic
950125135 3:10505950-10505972 GGGCTGTGCTGGAGGGAAGGGGG + Intronic
950195553 3:11006846-11006868 GAGCTCTGATGCAGGAAAAGAGG - Intronic
950656805 3:14441633-14441655 GGGCTGTGCTCGAGGAACAGAGG - Intronic
950678945 3:14571654-14571676 CAGGGGAGCTGGAGGAACAGAGG + Intergenic
950763232 3:15253467-15253489 CAGATGTGGTGGAGATAAAGAGG + Intergenic
953921270 3:46953670-46953692 CAGCTTTGCTGGTGCAGAAGAGG + Intronic
954373877 3:50184243-50184265 CAGCTGTGCAGGAGGGAGACGGG + Intronic
954420962 3:50418812-50418834 CAGCTGTGAGGGAGAAACAGGGG - Intronic
954624864 3:52016821-52016843 CATCTGAGCTGGAGGAGGAGGGG + Intergenic
956267832 3:67417708-67417730 TTTCTCTGCTGGAGGAAAAGGGG - Intronic
956275832 3:67500098-67500120 CAGCAATGCTGGAGGAGAATAGG - Intronic
958448794 3:94247550-94247572 CAGACATGCTGGAGGAATAGAGG - Intergenic
961465877 3:127081335-127081357 CAGGTGTGATGGAAGGAAAGTGG - Intergenic
961538604 3:127585553-127585575 CAGCAGTGCAGGTGGAACAGAGG + Intronic
962243115 3:133768009-133768031 CATCTGTGCAGAAGGACAAGAGG - Exonic
962309256 3:134313709-134313731 CAGTCGCGCTGGAGGAAAGGAGG + Intergenic
962450088 3:135505995-135506017 GAGCTGTGATGGAGGACAGGGGG - Intergenic
962929327 3:140022606-140022628 CAGCCCTGCTGGAGGCAATGGGG + Intronic
964527620 3:157631844-157631866 CAGCTGGAAGGGAGGAAAAGAGG - Intronic
966101554 3:176275283-176275305 CAAGTGTGCAGGAAGAAAAGAGG - Intergenic
967957022 3:194885158-194885180 CCGCTGTGATGGAGGAAGAGTGG + Intergenic
968130986 3:196192682-196192704 AAGCTGTGGTTCAGGAAAAGTGG + Intergenic
968371073 3:198222979-198223001 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
968744373 4:2352175-2352197 CAGCTGTGCTGGGCGTAAGGTGG + Intronic
969200610 4:5601839-5601861 CAGCTGTGCATGAGGCACAGAGG + Intronic
969386051 4:6849135-6849157 GAGCTGTGCTGGAGGGACAGAGG + Intronic
970441787 4:16086270-16086292 GAGCTCTGCTGGGGTAAAAGAGG - Intergenic
972557653 4:40196776-40196798 GGGCTTTGCTGGAGGAAAATGGG + Intronic
975321663 4:73015416-73015438 CTGGTGTTCTGGAGGAAGAGTGG - Intergenic
978118438 4:105049945-105049967 CAGCTGTGCTGCAGTACAGGGGG - Intergenic
978650304 4:110996194-110996216 AAGCTGTGCTGCAAGAAGAGGGG - Intergenic
979239350 4:118434750-118434772 CAGCTGTTCTGCAGGGAAGGAGG + Intergenic
979259757 4:118635463-118635485 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
979524066 4:121698613-121698635 CAGCTGGGCTGGTGGAGAGGAGG - Intergenic
979817069 4:125121825-125121847 CAGCTGTTCTGGAAAAAAAAAGG + Intergenic
981986610 4:150864581-150864603 CAGCTATGCAGTAGGAAAGGAGG + Intronic
982899302 4:160978528-160978550 TAGATCTGATGGAGGAAAAGTGG + Intergenic
984102559 4:175502714-175502736 CAGATGTTGAGGAGGAAAAGAGG - Intergenic
984167891 4:176324584-176324606 CAGATATTCTGGAGGAAAGGAGG + Intronic
984369036 4:178837750-178837772 AAGCTGAGCAGGGGGAAAAGAGG + Intergenic
984752304 4:183289580-183289602 CAGGCGTGCTGGAGGATGAGAGG + Exonic
986048050 5:4059991-4060013 GAGCTGTGCTGATGGACAAGAGG + Intergenic
986884565 5:12217180-12217202 AAGCTGTGAGGGAGGAAAAAAGG + Intergenic
987071587 5:14342093-14342115 CAGCTCTGCAAGGGGAAAAGAGG + Intronic
987647061 5:20687324-20687346 CATCTGTGCAGGAAGAAAAGTGG - Intergenic
990970557 5:61501231-61501253 CTGCTGTGGGGGTGGAAAAGAGG + Intronic
991499776 5:67265684-67265706 CAGCTGAGCTGGAGTATCAGAGG - Intergenic
993118506 5:83746514-83746536 CAGCCACCCTGGAGGAAAAGAGG - Intergenic
993944191 5:94097968-94097990 CTGCTGTGCTGGAGGAGTTGAGG - Intronic
995023070 5:107388139-107388161 CTCCTCTGCTGCAGGAAAAGGGG + Intronic
995743436 5:115378545-115378567 CACATGTAATGGAGGAAAAGGGG - Intergenic
996756936 5:126945426-126945448 GAGGTGTCCTGGAGGAAATGAGG + Intronic
996760443 5:126981288-126981310 CAGCCTTGCTTGAGTAAAAGGGG - Intronic
999087897 5:148909852-148909874 TAGCTGTGCTCCAGGAAGAGAGG + Intergenic
999369372 5:151044614-151044636 CAAATGTGCGGGAGGACAAGGGG + Intronic
999931919 5:156442918-156442940 TAGCTGTGATGGAGCAAAAGAGG + Intronic
1000680986 5:164184387-164184409 TACCTGTGCTGAAAGAAAAGAGG + Intergenic
1001148450 5:169205014-169205036 CAACTATGATGGAGGAAGAGAGG + Intronic
1001988869 5:176099437-176099459 CAGCTGTGGTGGAGGATAAATGG - Intronic
1001989173 5:176101974-176101996 CAGCTGTGGTGGAGGATGAATGG - Intronic
1001989842 5:176107298-176107320 CAGCTGTGGTGGAGGATGAATGG - Intronic
1002227029 5:177730840-177730862 CAGCTGTGGTGGAGGATGAATGG + Intronic
1002227697 5:177736164-177736186 CAGCTGTGGTGGAGGATGAATGG + Intronic
1002227996 5:177738699-177738721 CAGCTGTGGTGGAGGATAAATGG + Intronic
1002266449 5:178037589-178037611 CAGCTGTGGTGGAGGATGAATGG - Intronic
1002267119 5:178042934-178042956 CAGCTGTGGTGGAGGATGAATGG - Intronic
1002730310 5:181328535-181328557 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1002754220 6:145569-145591 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1003427518 6:6007487-6007509 CTGCTGGGTTGGAGAAAAAGAGG - Intronic
1005220246 6:23578511-23578533 CAGATGTTATGGAGGTAAAGCGG + Intergenic
1005264882 6:24101233-24101255 CAACAGGGCTGGAGGAAAATGGG + Intergenic
1005717852 6:28568764-28568786 CAGCAGAGCTGAAGGAGAAGTGG + Intergenic
1007356877 6:41326504-41326526 CAGCTGTGCTGAAAGCATAGAGG + Intergenic
1008488625 6:52062499-52062521 CAGGTATGTTGTAGGAAAAGTGG - Exonic
1009248125 6:61264816-61264838 CTGCTGTGTTGGAGGAACTGAGG + Intergenic
1010665902 6:78629591-78629613 CAGCTGCCCTGTGGGAAAAGCGG - Intergenic
1010771768 6:79840112-79840134 CTGCTGTGCTGCAGGAAATCAGG + Intergenic
1011667112 6:89644973-89644995 CACCTTTTCTGGAGGTAAAGTGG - Intronic
1012586794 6:100933072-100933094 CTGCTGTGCTGGAGGGACTGAGG + Intergenic
1013073510 6:106750669-106750691 CAGGTGTGTGAGAGGAAAAGAGG - Intergenic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1013666188 6:112351353-112351375 TAGCTGTGGTGGAGGAAGAGGGG - Intergenic
1014291907 6:119568433-119568455 GAGATGTGCTGGAAGAAAAAGGG - Intergenic
1014570154 6:122997589-122997611 CAGCTTTGCTGGGGGAAAGCAGG + Exonic
1014715006 6:124853834-124853856 CAGCTGTGCTAGAGGAAAGGCGG - Intergenic
1015825552 6:137307216-137307238 CAGCTGTGCTGGATGAGGAAAGG + Intergenic
1017655789 6:156627806-156627828 TAGCTGTGCTAAAGGAAAAGTGG - Intergenic
1018974769 6:168556155-168556177 CGGCTGTGCGGGAGGGAAGGAGG + Intronic
1019502738 7:1373012-1373034 GAGCTGTGGTGGATGAAATGTGG - Intergenic
1019595768 7:1857651-1857673 CAGCTGGACAGGAGGAAGAGGGG + Intronic
1022799463 7:33761839-33761861 CCGCTGTGCTGGAGGCAAATGGG + Intergenic
1023962479 7:44938420-44938442 CAGCTGTGCTCTGGGGAAAGGGG + Intergenic
1024334208 7:48188787-48188809 CAGCTGTGCTGATGGAAACATGG + Intronic
1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG + Intergenic
1024709201 7:51996171-51996193 GAGAGGTGCTGGTGGAAAAGGGG + Intergenic
1025051991 7:55740078-55740100 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1025128948 7:56365746-56365768 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1025177332 7:56808634-56808656 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1025694460 7:63767754-63767776 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1025940868 7:66075653-66075675 CCGCTGAGCTGGAGGCTAAGCGG - Intergenic
1026944472 7:74307010-74307032 CAGCTGTGCTGGTGGGACAGAGG - Intronic
1028357414 7:89926098-89926120 CATCTGTGATGGAGTAAAGGTGG + Intergenic
1028802361 7:94981046-94981068 CAGCTGTGCTAGAGAATAATGGG + Intronic
1028932036 7:96423988-96424010 AAGCAGGGCTGGAGGAAAGGAGG - Intergenic
1029105041 7:98167992-98168014 CAGCTGTGCTTGGGGAGAAGTGG + Intronic
1029174380 7:98653787-98653809 GGGCTGAGCTGAAGGAAAAGAGG + Intergenic
1029571660 7:101373843-101373865 CAGATGAGCTGGGGGAAGAGGGG - Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029587827 7:101486787-101486809 CCGCTGGGCAGGAGGAAACGTGG - Intronic
1030055351 7:105579416-105579438 CAGCTGTACTGTGGCAAAAGAGG + Intronic
1030245953 7:107384517-107384539 CAGTTTTACTGGGGGAAAAGGGG - Intronic
1032051981 7:128655454-128655476 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1032812286 7:135432581-135432603 CAGCTGTGCCCAAGGTAAAGAGG - Intronic
1033032430 7:137840292-137840314 CAGATGAGCTGGAAGGAAAGAGG + Intronic
1035006099 7:155662330-155662352 CTGCTGTGCTGGAGAGAAATGGG - Intronic
1035341478 7:158165313-158165335 GAGAGGTGCTGGAGGGAAAGTGG + Intronic
1035578726 8:726022-726044 TTGCTGTGCTGCAGGAGAAGTGG - Intronic
1037379601 8:18270570-18270592 CAGATGTGTTGGAGGCAAATAGG - Intergenic
1037915936 8:22773561-22773583 CAGCTGTTCTGTAGGGAGAGGGG - Intronic
1038239473 8:25795427-25795449 CATTTGTGTTTGAGGAAAAGAGG + Intergenic
1040007515 8:42632773-42632795 CAGCTGGGCTGGAGGGAGTGAGG - Intergenic
1041542904 8:59007191-59007213 CAGCTCTGCTGGAAAATAAGGGG + Intronic
1041683619 8:60620822-60620844 CAGCTGAGCAGGAGGAGAGGGGG - Exonic
1041723680 8:60998817-60998839 CAGCTGAGTTGCAGGTAAAGTGG + Intergenic
1042163754 8:65924562-65924584 CAGCTGTGATGGAGGCACAAGGG - Intergenic
1042515499 8:69654690-69654712 CTGCTTTGCAGGAGGATAAGAGG - Intronic
1042860712 8:73310448-73310470 GAGCTGTGCTGTTGGAACAGGGG + Intronic
1043011773 8:74889811-74889833 CAGCTGAGGTGCAGGGAAAGAGG - Intergenic
1043685108 8:83074700-83074722 AAGCAGTAATGGAGGAAAAGGGG + Intergenic
1044785356 8:95787310-95787332 CAGCTGTCCTGATGGAAAAGGGG - Intergenic
1045015655 8:97999542-97999564 GAGCTTTGATGGAGGAAAATAGG - Intronic
1045115602 8:98976868-98976890 CAGCTGGTCTGGGGGAAATGAGG - Intergenic
1045485404 8:102627529-102627551 CAGCTGTCCTGGAGGAAAGCGGG + Intergenic
1048475121 8:134736022-134736044 CACCTGTCCTGGAGGGAAACTGG + Intergenic
1048636157 8:136297643-136297665 CAGCTGTGCCTCAGTAAAAGGGG - Intergenic
1049193184 8:141300216-141300238 CAGCTTTGTTGGAGGAAAGCAGG - Intronic
1049372337 8:142273803-142273825 CAGGGGTGCAAGAGGAAAAGGGG - Intronic
1050270626 9:3940735-3940757 GAGCAGCGATGGAGGAAAAGGGG + Intronic
1050387841 9:5110030-5110052 CTCATGTGTTGGAGGAAAAGAGG - Intronic
1050616888 9:7410662-7410684 CTGCTTTGCTGGAGGTGAAGAGG - Intergenic
1052201073 9:25781020-25781042 CTTCTGTACTGAAGGAAAAGGGG - Intergenic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1053674038 9:40403920-40403942 CAGCTACTCTGGGGGAAAAGAGG - Intergenic
1053923841 9:43030287-43030309 CAGCTACTCTGGGGGAAAAGAGG - Intergenic
1054385142 9:64543989-64544011 CAGCTACTCTGGGGGAAAAGAGG - Intergenic
1054510587 9:65972370-65972392 CAGCTACTCTGGGGGAAAAGAGG + Intergenic
1055593399 9:77841554-77841576 CAGCTAAGTTGGAGGCAAAGGGG - Intronic
1055986971 9:82062388-82062410 CGGCTGGGCTGGAGGCAGAGAGG - Intergenic
1056286246 9:85090661-85090683 CAGCTGTGAGGGAGGAAGAATGG + Intergenic
1057020788 9:91696102-91696124 GAGCTGGGCTGGAGGAATCGTGG - Intronic
1057845312 9:98518153-98518175 CAACTGCTCTGGAGGACAAGGGG - Intronic
1057938653 9:99261444-99261466 CAGCTGTGCCAGAGGCACAGAGG + Intergenic
1058544764 9:106049224-106049246 CAGCTGTGTGGGAGAAAAATTGG - Intergenic
1059450913 9:114370994-114371016 CAGCTGAGATGGAGGAACAGGGG + Intronic
1059663554 9:116425025-116425047 AAGCTGTGCTAGAGGAAGAATGG - Intergenic
1060235466 9:121859701-121859723 CAGATGGGCTGGAGCAAAAAGGG - Intronic
1060944490 9:127561916-127561938 CTTCTGTGCTGGAGGAAGAAGGG - Intronic
1062707541 9:137953724-137953746 CAGCTGGGGTGGAGGCACAGTGG + Intronic
1062754722 9:138281049-138281071 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1203578629 Un_KI270745v1:25209-25231 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1186479749 X:9887552-9887574 CATCTTTGCTGCATGAAAAGTGG + Intronic
1186516311 X:10168307-10168329 CCCTGGTGCTGGAGGAAAAGGGG - Intronic
1187581939 X:20616505-20616527 CAACTGTCCTGGAGGGAAACTGG + Intergenic
1187722802 X:22169631-22169653 CAGCTATGCTGGAGGAACAGAGG + Intronic
1187857934 X:23655056-23655078 CAGTTGTGCTGGAGGACAAGGGG - Intergenic
1188340722 X:28997999-28998021 CAGCTGCACTGAGGGAAAAGGGG - Intronic
1189438803 X:41016310-41016332 CATCTGTGTTGTAGGCAAAGAGG - Intergenic
1190033876 X:47001556-47001578 CAGCTGTGGTTGAGGAAATTAGG - Intronic
1190915201 X:54806916-54806938 CAGTTGTGATGAAGGAAAAATGG + Intergenic
1191877867 X:65814056-65814078 CAGTTGTGGTGGAGGACAAAGGG - Intergenic
1192722471 X:73713774-73713796 CATCTGAGGTAGAGGAAAAGTGG + Intergenic
1192947645 X:75983405-75983427 TTGCTGTGCTGAAGTAAAAGAGG + Intergenic
1192983022 X:76367195-76367217 CATGTGTGCTGGTGGAGAAGTGG + Intergenic
1193165692 X:78277550-78277572 CTGCTGTGCTGGAGGAACCAAGG - Intronic
1198233080 X:134711962-134711984 AATGTATGCTGGAGGAAAAGAGG - Intronic
1198658922 X:138945343-138945365 CAACTGTGCTTGAGGAGTAGAGG - Intronic
1199640853 X:149859320-149859342 CTGCCATGCTGGAGGAGAAGAGG - Intergenic
1201764112 Y:17563653-17563675 AGGCTGCCCTGGAGGAAAAGCGG - Intergenic
1201837441 Y:18342337-18342359 AGGCTGCCCTGGAGGAAAAGCGG + Intergenic