ID: 1102977226

View in Genome Browser
Species Human (GRCh38)
Location 12:117215325-117215347
Sequence CTGTGGAAAGAGAAGTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 649}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102977218_1102977226 -3 Left 1102977218 12:117215305-117215327 CCAGTTAGGAGCTGAAAACCCTG 0: 1
1: 0
2: 1
3: 11
4: 123
Right 1102977226 12:117215325-117215347 CTGTGGAAAGAGAAGTTGGGGGG 0: 1
1: 0
2: 4
3: 49
4: 649
1102977216_1102977226 15 Left 1102977216 12:117215287-117215309 CCGGCTGGGCAAGAGGGTCCAGT 0: 1
1: 0
2: 2
3: 19
4: 175
Right 1102977226 12:117215325-117215347 CTGTGGAAAGAGAAGTTGGGGGG 0: 1
1: 0
2: 4
3: 49
4: 649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102977226 Original CRISPR CTGTGGAAAGAGAAGTTGGG GGG Intronic
901579744 1:10231628-10231650 CTTTGGGAAGTCAAGTTGGGCGG - Intronic
901620970 1:10586977-10586999 CTGTGGTATTAGAAGTTAGGTGG + Intronic
901949041 1:12726727-12726749 ATTTGAGAAGAGAAGTTGGGAGG + Exonic
901969814 1:12898605-12898627 CTTTGGGAGGACAAGTTGGGTGG + Intronic
902015359 1:13303175-13303197 CTTTGGGAAGACAAGTTGGGTGG - Intergenic
902696520 1:18144200-18144222 CTGGGGAAGGAGAAGATGGGAGG - Intronic
902980952 1:20122678-20122700 CTGTGGAAAGAGAAACTGCCAGG - Intergenic
903015975 1:20362042-20362064 CTGTGGAAAGAGGAGTGGCAGGG + Intergenic
903796076 1:25929851-25929873 CTGTGGAATGTGGGGTTGGGGGG - Intergenic
903982900 1:27202799-27202821 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
904051226 1:27640216-27640238 CTGTGGAAGGAAAAGCTGGATGG - Intergenic
904565393 1:31425440-31425462 CTGTGGGGAGGGAAGTGGGGCGG + Intronic
904689896 1:32286026-32286048 CTGAGGAAAGAAAAGTAGGTGGG - Exonic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905092728 1:35442364-35442386 CTGTGGAGGGAGAGGCTGGGAGG + Intronic
905142910 1:35862772-35862794 CTTTGGAAAGTCAAGGTGGGTGG + Intergenic
905174043 1:36125257-36125279 CTGTGGAAAGAGGAGGGCGGAGG - Intergenic
905966951 1:42106462-42106484 CTGTGGAATTACAAGCTGGGTGG - Intergenic
906011299 1:42529228-42529250 CTTTGGAAAGCCAAGGTGGGCGG + Intronic
906165660 1:43684259-43684281 CTTTGGAAAGCCAAGGTGGGCGG + Intronic
906207488 1:43994988-43995010 CTGAGGAAGGACAGGTTGGGTGG + Intronic
906286162 1:44589161-44589183 CTGGGGAAAGTGAAGTTTGGTGG - Intronic
907024671 1:51104580-51104602 CTGTGGAAATAGAAGTTGTATGG + Intronic
909200409 1:72684970-72684992 TTGTGGAAAGAGAAGTGAAGTGG + Intergenic
909407569 1:75309198-75309220 CTTTGGGAAGCTAAGTTGGGGGG + Intronic
910458772 1:87426027-87426049 CAGGGGAAAGATAATTTGGGGGG + Intergenic
910499338 1:87871507-87871529 CTATGGAAGGAGAAGATGTGTGG - Intergenic
911380342 1:97106408-97106430 CTGAGTAAAGAGAATGTGGGCGG + Intronic
911511849 1:98816724-98816746 CTGATGAAAGAGAACTTGGAAGG - Intergenic
911656211 1:100446940-100446962 CTTTGGAAAGACAAGGTGGGCGG - Intronic
912417872 1:109522458-109522480 CTGTGAAAAGACAAGATGTGGGG + Intergenic
913438235 1:118869848-118869870 ATTTTGAAAGAGAAGTTGGGAGG - Intergenic
914084541 1:144440962-144440984 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914190554 1:145406228-145406250 CTGAGTAAAGAGAAGTCGGCCGG - Intergenic
914588360 1:149083102-149083124 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
915062078 1:153194590-153194612 CTGAGGAAGGAAAAGTTTGGAGG - Intergenic
915505955 1:156356699-156356721 CTGTGGGAGGCCAAGTTGGGAGG - Intronic
915531828 1:156507044-156507066 CTTTGGAAAGCCAAGATGGGAGG + Intergenic
916200330 1:162265056-162265078 CTTTGGGAAGCGAAGGTGGGTGG - Intronic
916218429 1:162419356-162419378 CTGTGGAAAGAGAGTTTCTGGGG + Intergenic
917348634 1:174055201-174055223 CTTTGGGAAGACAAGGTGGGCGG - Intergenic
917429658 1:174952831-174952853 CTGTGGGAAGTCAAGGTGGGTGG - Intronic
918003983 1:180524739-180524761 ATGTGGAATCAGAAGTAGGGAGG + Intergenic
918063936 1:181086910-181086932 CTTTGGAAGGACAAGGTGGGCGG - Intergenic
918187374 1:182140343-182140365 CTGTACTAAAAGAAGTTGGGAGG - Intergenic
918361821 1:183766970-183766992 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
918466812 1:184829041-184829063 CTTTGGAAGGCCAAGTTGGGAGG - Intronic
918497033 1:185152092-185152114 CTTTAGAATGAAAAGTTGGGGGG + Intronic
918773630 1:188598774-188598796 CTAGGGAAAGAGAACATGGGAGG + Intergenic
919280345 1:195482100-195482122 CTGTGAAGAGAGAAGTGGGGAGG + Intergenic
919411445 1:197249001-197249023 CTGTGGCAAGAACACTTGGGTGG - Intergenic
920329206 1:205193235-205193257 CTCTGAAAAGAGAAGATGGGAGG + Intronic
920511547 1:206555951-206555973 CTGGGGAAACATAAGCTGGGTGG - Intronic
920599304 1:207306783-207306805 CTGTGGATAAAGTAGTGGGGTGG + Intergenic
920645161 1:207797774-207797796 TTGGGGAAAGCTAAGTTGGGAGG - Intergenic
920735949 1:208533188-208533210 CTGTGGAGAGAGATGCTTGGGGG - Intergenic
920930268 1:210381522-210381544 CTTTGGAAAGCTAAGGTGGGTGG - Intronic
921051225 1:211513246-211513268 CTGTGGAAAGAGCACTGGGTTGG - Intergenic
921910594 1:220545128-220545150 CTGTGGAAAGTTGAGTTGGTGGG + Intronic
922013877 1:221622912-221622934 CTGTTGAAAGAGAAGATGGGAGG + Intergenic
922310109 1:224380855-224380877 CTTTGGAAAGACAAGGTGGGAGG + Intergenic
922313085 1:224414734-224414756 CTTTGGAAGGACAAGGTGGGAGG + Intronic
922522137 1:226263826-226263848 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
922624750 1:227027871-227027893 CTTTGGGAAGCCAAGTTGGGAGG + Intronic
922889905 1:229053829-229053851 ATGTGGAAATGGAAGCTGGGAGG - Intergenic
923056360 1:230428437-230428459 CTGTGGTAAGAGAAGGAGTGAGG + Intergenic
923123501 1:231015460-231015482 CAGTGGCCAGAGAAGTTGGGAGG + Intergenic
923218601 1:231873040-231873062 CTGTGGAAGAAGATGGTGGGAGG + Intronic
923707697 1:236358112-236358134 CTTTGGGAGGTGAAGTTGGGTGG - Intronic
923777103 1:236989269-236989291 CTTTGGAAAGCAAAGGTGGGAGG + Intergenic
924551738 1:245084323-245084345 CTGTGGGAAGCCAAGATGGGTGG - Intronic
924608606 1:245555828-245555850 CTGTGAAATGAGGACTTGGGGGG + Intronic
1063467483 10:6256559-6256581 TTGTGGAAAGAGAGGTGTGGTGG - Intergenic
1063516689 10:6703281-6703303 CTTTGGGAAGTGAAGGTGGGAGG - Intergenic
1063764232 10:9119536-9119558 CGTAGGAAACAGAAGTTGGGAGG + Intergenic
1064744188 10:18462998-18463020 CTTTGGAAGGCCAAGTTGGGTGG - Intronic
1064815932 10:19262357-19262379 GTGTGGTAAGAGAACTTGGCCGG + Intronic
1064948014 10:20814350-20814372 CTTTGGAAAGCTAAGGTGGGAGG + Intronic
1065104060 10:22362495-22362517 CTGTGGGAGGACAAGATGGGAGG + Intronic
1065666739 10:28071272-28071294 AGGTGTAAAGAGAAGTAGGGTGG + Intronic
1065833487 10:29636350-29636372 CTCTGTAAAGAGAAGATAGGAGG + Intronic
1066746167 10:38605190-38605212 CTGTAGAAAGAGGAGGTGAGGGG - Intergenic
1067219441 10:44333338-44333360 CTCTGGACAGAGAAGATAGGGGG - Intergenic
1067355672 10:45523280-45523302 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
1068191401 10:53657215-53657237 CTTTGGAAAGTGAAGCAGGGAGG - Intergenic
1068710625 10:60129506-60129528 CTTTGGAAGGACAAGCTGGGCGG + Intronic
1069839292 10:71329082-71329104 ATGTGGAAAAAGAAGATGGCAGG - Intronic
1070085719 10:73235354-73235376 TTGGGGAAAGAAAAGGTGGGGGG + Intronic
1070334480 10:75442021-75442043 CTGTGCAAAGGGAAACTGGGAGG - Intronic
1070678335 10:78431072-78431094 CTGTGGAAAGAGAAGCAGAGAGG - Intergenic
1071355135 10:84786115-84786137 CTTTGGAAGGACAAGGTGGGTGG + Intergenic
1072408696 10:95180301-95180323 CTTTGGAAGGCCAAGTTGGGTGG + Intergenic
1072747036 10:97947807-97947829 CTTTGGGAAGCCAAGTTGGGAGG + Intronic
1072763269 10:98075798-98075820 CTTTGGAGAGGGAAGTGGGGAGG + Intergenic
1073787752 10:106908884-106908906 CTGAAGAAACAGAAATTGGGTGG - Intronic
1074394411 10:113085770-113085792 CTGCGGAAAGTGAAGTTATGAGG - Intronic
1074796994 10:116957030-116957052 CTTTGGAAGGACAAGGTGGGAGG - Intronic
1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
1077922434 11:6651603-6651625 GTGTAGAAAGAAAAGTTAGGAGG + Intronic
1078386954 11:10900743-10900765 TTGTGGAAAGAGCAGTGGGTTGG + Intergenic
1079181689 11:18199460-18199482 CAATGGAAAGAGCAGTTGGTTGG - Intronic
1079436625 11:20460164-20460186 CTGTGGAAATAAACGTTAGGAGG + Intronic
1079836639 11:25342810-25342832 CTGTGGGAAGCCAAGGTGGGTGG + Intergenic
1080384274 11:31801476-31801498 CAGTGGAGAGAGAGGGTGGGAGG + Intronic
1081999053 11:47383000-47383022 GAGTGGAAAGAGGAGTTGGGAGG - Intergenic
1082715156 11:56603241-56603263 CTGTGGAAAGGGAAGGGGAGAGG - Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1084017898 11:66397440-66397462 CTTTGGAAGGACAAGGTGGGAGG - Intergenic
1084176941 11:67427802-67427824 CTTTGGGAAGCCAAGTTGGGAGG - Intergenic
1084368608 11:68721269-68721291 CTGTGGCAAGAGAGGGAGGGTGG - Intronic
1084724091 11:70929007-70929029 TTGTGGAGAGAGAAGCTGGGAGG + Intronic
1084769302 11:71332255-71332277 ATGTGGGAAGAGGAGTAGGGTGG - Intergenic
1084777346 11:71386326-71386348 CTTTGGAGTGAGAAGGTGGGAGG + Intergenic
1084859518 11:72009186-72009208 CTGTGGGCAGAGAGGGTGGGTGG + Intronic
1085214092 11:74812547-74812569 CTTTGGAAAGCTAAGGTGGGAGG - Intronic
1085564463 11:77500866-77500888 CTGTGGTAAGAGAAGTCTGTTGG - Intergenic
1085765306 11:79276909-79276931 CTGAGGCAGCAGAAGTTGGGGGG - Intronic
1085835933 11:79956419-79956441 CTGATAAAAGAGGAGTTGGGTGG + Intergenic
1086101313 11:83102750-83102772 GTGTGGGAAGAGAAGTGGGAAGG - Intergenic
1086198714 11:84173888-84173910 CCGTGGACAGAGCAGTAGGGAGG - Intronic
1086656383 11:89361871-89361893 CTGTGGAGAGCGCAGTTGGCAGG + Intronic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089362007 11:117897086-117897108 CTGTGGATTGAGGAGTTGTGGGG + Intergenic
1090088431 11:123672101-123672123 ATGTGCAAACAGAAATTGGGGGG - Intergenic
1090185876 11:124738894-124738916 CTATGGAAAGAGCATCTGGGAGG - Intergenic
1090271029 11:125386451-125386473 CTGTGGAGAGAGCAGTAGAGAGG + Intronic
1090908081 11:131094750-131094772 CTGTGGAAAGAGAAGGAGTTGGG + Intergenic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091076090 11:132618621-132618643 ATGTGGATAAAGAAGTTGGTAGG - Intronic
1091224424 11:133949102-133949124 CTTTGGGAAGAGATGCTGGGAGG - Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1092269019 12:7007292-7007314 CTTTGGAAAGCCAAGGTGGGTGG - Intronic
1093338877 12:17946799-17946821 ATCTGGCAAGTGAAGTTGGGTGG - Intergenic
1093450801 12:19311180-19311202 CTTTGGAAGGATAAGGTGGGAGG + Intronic
1093885845 12:24459395-24459417 ATGTGGAAAGACAAGTTGACAGG - Intergenic
1094646418 12:32328870-32328892 CTGTGGAAACAGGAGATGGAGGG + Intronic
1095294623 12:40514061-40514083 CTGTGGAAAGAAATGTTGCATGG + Intronic
1095723663 12:45428367-45428389 CTTTGGAAGGCCAAGTTGGGAGG + Intronic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1097243564 12:57592403-57592425 CTGTGGAGATGGAAGTTGTGAGG + Intronic
1097770932 12:63584422-63584444 CTGTGGAAAGTGAGGATTGGAGG - Intronic
1098027331 12:66218115-66218137 CTTTGGAAAGATCAGCTGGGTGG - Intronic
1098876767 12:75873652-75873674 CTGTGGCAAGGGGAGTTGGGTGG + Intergenic
1098925976 12:76349677-76349699 CTTTGGAAGGCCAAGTTGGGAGG - Intergenic
1099192709 12:79576163-79576185 CTTTGGAAAGCCAAGGTGGGTGG - Intronic
1099537021 12:83857624-83857646 CTGGGAACAGGGAAGTTGGGTGG + Intergenic
1100022854 12:90090752-90090774 CTTTGGGAAGCCAAGTTGGGAGG - Intergenic
1100476118 12:94936898-94936920 CTTTGGAAGGCCAAGTTGGGTGG + Intronic
1101100234 12:101384295-101384317 CTTTGGGAAGCCAAGTTGGGAGG + Intronic
1101286316 12:103316943-103316965 CTGAGGAAAGAGAAGTGAAGTGG - Intronic
1101618613 12:106361883-106361905 CTGTGGAAAGGGAATGTGAGGGG + Intronic
1101879511 12:108616854-108616876 CTGTGGAAGGCCAAGGTGGGCGG - Intergenic
1101945475 12:109133005-109133027 GTGTGGAGAGAGAAGGTGAGTGG - Intronic
1102161435 12:110772169-110772191 CTGTGGGAAGCCAAGGTGGGTGG + Intergenic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1102977226 12:117215325-117215347 CTGTGGAAAGAGAAGTTGGGGGG + Intronic
1103436582 12:120931568-120931590 CTCTGGAAACACAAGGTGGGGGG - Intergenic
1103548114 12:121716048-121716070 CTTTGGGAGGACAAGTTGGGAGG + Intronic
1103576696 12:121882829-121882851 CTGAGGCAGGAGAAGCTGGGAGG - Intergenic
1105239487 13:18597442-18597464 CTGAGGAAGGTCAAGTTGGGAGG + Intergenic
1105358752 13:19686552-19686574 CCCTGGATAGAGAAGTTGGATGG + Intronic
1106871395 13:34025828-34025850 CTTTGGAAAGCCAAGCTGGGTGG - Intergenic
1106954261 13:34918296-34918318 CTTTGGAAAGCCAAGGTGGGTGG + Intergenic
1107786712 13:43964786-43964808 CTGTGAACAGAGAAGCTGTGGGG + Intergenic
1107817997 13:44261530-44261552 CTGTGGAAAGAGCCTTTGGAGGG + Intergenic
1107825559 13:44325987-44326009 ATGTGGAAAGAGAAGTGGCCAGG - Intergenic
1107930489 13:45303032-45303054 CTGTGTAAAGAGAAGTCAGGGGG + Intergenic
1107935858 13:45344877-45344899 CTTTGGGAAGTGAAGTTGGGCGG + Intergenic
1108040536 13:46335514-46335536 GTGTGGAAAGAGGAGATAGGAGG + Intergenic
1108385555 13:49896219-49896241 CTGTGGAAGGTCAAGGTGGGTGG + Intergenic
1109694955 13:65942507-65942529 CTGTGGGAGGCCAAGTTGGGAGG - Intergenic
1110229478 13:73153380-73153402 TTGTTGAAAGAGAAGGAGGGAGG - Intergenic
1110240692 13:73263031-73263053 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1110264347 13:73520995-73521017 GTGTGGAAATAGAAGATTGGAGG - Intergenic
1110869124 13:80430171-80430193 CTTTGGGAAGCGAAGGTGGGAGG - Intergenic
1112378750 13:98868518-98868540 CTTTGGGAAGCCAAGTTGGGAGG + Intronic
1112598274 13:100830121-100830143 CTGGAGAAAGAGAAGCTGTGTGG - Intergenic
1112655015 13:101442864-101442886 TTGTGGAAACAGAATTTAGGAGG + Intergenic
1113711203 13:112466664-112466686 CTGTGCATGGAGAAGCTGGGAGG - Intergenic
1114004640 14:18299208-18299230 CTTTGGGAGGACAAGTTGGGTGG - Intergenic
1114326153 14:21590785-21590807 CTGTGGAAAGTCAAGATGGGTGG + Intergenic
1114648419 14:24268421-24268443 CTGGGGAAAGAGTAGGTGGTTGG + Intronic
1115652214 14:35410795-35410817 CTTTTGAAAGTGAAGATGGGCGG - Intergenic
1116325637 14:43531095-43531117 CTTTAGAAAGTGAAGATGGGAGG + Intergenic
1116984653 14:51205828-51205850 CTGTGGCAAGAGGAGGTGAGGGG + Intergenic
1117044961 14:51804040-51804062 CTGTGGCCAGAGAAGATGGAAGG - Intergenic
1117819540 14:59633162-59633184 GTGTGGAGAGAGATGTTGGATGG + Intronic
1118281291 14:64431162-64431184 CTGAGGCAGGAGAACTTGGGAGG - Intronic
1118438532 14:65792447-65792469 GTGTGGAGACAGAAGTTGGGAGG + Intergenic
1118730564 14:68663055-68663077 CTGTGGGAAGCCAAGGTGGGTGG + Intronic
1120077244 14:80172857-80172879 GTGTGGGAAAAGAAGATGGGTGG - Intergenic
1121762665 14:96459092-96459114 CTTTGGGAAGCCAAGTTGGGCGG + Intronic
1121797087 14:96744184-96744206 CTGTGGGAAGAGAAGTAAGGAGG + Intergenic
1122148175 14:99706538-99706560 CTGTGCAGAGTGAAGGTGGGTGG - Intronic
1122378325 14:101283963-101283985 CTGTGGGAAGCCAAGGTGGGTGG - Intergenic
1122983909 14:105203572-105203594 CGGTGGAAAGAGGGGCTGGGAGG + Intergenic
1123106609 14:105844771-105844793 CTGAGGAATGAGCAGGTGGGTGG + Intergenic
1202889181 14_KI270722v1_random:139373-139395 CTGTGGGAGGCCAAGTTGGGTGG - Intergenic
1123465831 15:20514809-20514831 CTGTGGGAGGCCAAGTTGGGGGG - Intergenic
1123548259 15:21355735-21355757 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1123652282 15:22486230-22486252 CTGTGGGAGGCCAAGTTGGGGGG + Intergenic
1123742705 15:23295087-23295109 CTGTGGGAGGCCAAGTTGGGGGG + Intergenic
1123760620 15:23429399-23429421 CTGTGGGAGGCCAAGTTGGGGGG - Intergenic
1123789556 15:23706942-23706964 CTTTGGAAGGCCAAGTTGGGTGG - Intergenic
1124018344 15:25897710-25897732 CTGTAGAAAGGAAAGTAGGGTGG - Intergenic
1124276554 15:28330783-28330805 CTGTGGGAGGCCAAGTTGGGGGG - Intergenic
1124306147 15:28580824-28580846 CTGTGGGAGGCCAAGTTGGGGGG + Intergenic
1124577583 15:30923478-30923500 CTCTGGAAACAGAGGTTAGGAGG - Intronic
1125012922 15:34899612-34899634 CTTTGGGAGGTGAAGTTGGGAGG - Intronic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125473174 15:40024496-40024518 CTGAGGTAGGAGAACTTGGGAGG - Intronic
1125962376 15:43842308-43842330 ATGTTGAAAGTGAAGTTGTGGGG + Intronic
1127458330 15:59175461-59175483 CTGTGAGGAGAGAAGTTGAGTGG - Intronic
1127654459 15:61043330-61043352 CTGTGAGATGAGGAGTTGGGAGG - Intronic
1127836264 15:62793575-62793597 CTGGGGAAAAAGAAGTTTGGAGG - Intronic
1128214710 15:65926298-65926320 CTGTGGCATGAGAAGGTTGGTGG + Intronic
1128574118 15:68758589-68758611 GTGTGGAAAAAAAAGTGGGGGGG + Intergenic
1128624322 15:69183836-69183858 CTGTGGTATGAGGAGTTGGGAGG + Intronic
1129006537 15:72378370-72378392 CTGTGGAAGGCCAAGATGGGAGG + Intergenic
1129022666 15:72536337-72536359 CTGTGGGAGGACAAGCTGGGAGG - Intronic
1129054518 15:72809424-72809446 CTGTGGAAATAGACATTGGAGGG + Intergenic
1129357945 15:75004931-75004953 CTTTGGAAGGCGGAGTTGGGCGG + Intronic
1129413068 15:75360449-75360471 CTAGGGGAAGAGAAGTTTGGAGG - Intronic
1129786785 15:78314958-78314980 CTTTGGAAAGTCAAGGTGGGAGG - Intergenic
1130289329 15:82583043-82583065 TTGTGGAGAGAGTAGTGGGGAGG - Intronic
1131313252 15:91309792-91309814 TTGGGCAGAGAGAAGTTGGGTGG - Intergenic
1131870504 15:96758623-96758645 TTGGGGAAAGAAAAGGTGGGGGG + Intergenic
1132198802 15:99933395-99933417 CTGGGGCATGAGAAGTTTGGGGG + Intergenic
1202956591 15_KI270727v1_random:82965-82987 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1133135004 16:3704768-3704790 CTTTGGAAGGCCAAGTTGGGAGG + Intronic
1133161399 16:3914454-3914476 CTTTGGAAAGAAGAGGTGGGAGG - Intergenic
1133571321 16:7043124-7043146 CTGAGTAAATAGGAGTTGGGCGG - Intronic
1133815837 16:9196765-9196787 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1133887320 16:9842691-9842713 CTTTGGGAAGCCAAGTTGGGTGG + Intronic
1134280617 16:12813770-12813792 CTTTGGGAAGCCAAGTTGGGTGG - Intergenic
1134630735 16:15753960-15753982 CTGTGGAAGGCCAAGGTGGGTGG + Intronic
1135042320 16:19127340-19127362 CTGTGGGAAAGGAAGTTTGGTGG - Intronic
1135642750 16:24135211-24135233 CTTTGGGAAGAAAAGTTTGGAGG - Intronic
1135957136 16:26965263-26965285 CTTTGGAAAGTCAAGGTGGGAGG + Intergenic
1136461128 16:30410774-30410796 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
1136463998 16:30429679-30429701 CTGAGGCAAGGGAAATTGGGTGG - Intronic
1136736893 16:32474451-32474473 CTGTAGAAAGAGGAGGTGAGGGG + Intergenic
1137019996 16:35415120-35415142 ATGGGGAAGGAGAAGTTGTGCGG - Intergenic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1137499600 16:49000347-49000369 CTGTGGAAAGTGACCTTTGGGGG + Intergenic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1137793179 16:51192543-51192565 TTATTGAATGAGAAGTTGGGGGG + Intergenic
1137981294 16:53072240-53072262 CTATGGAAATAGGAGTTGGCTGG - Intronic
1138061133 16:53891415-53891437 CTTTGGGAAGCCAAGTTGGGAGG + Intronic
1138063942 16:53920946-53920968 TTGCTGAAAGAGGAGTTGGGTGG + Intronic
1138231723 16:55342448-55342470 CTGTGGAAAGCCAAGGTGGGAGG + Intergenic
1138255561 16:55556056-55556078 CTTTGGGAAGCCAAGTTGGGTGG - Intronic
1138515070 16:57531403-57531425 CTGTGGACAAAGAAGGTGGATGG - Intronic
1139550870 16:67672347-67672369 CTGTGGAACCACAGGTTGGGAGG + Intergenic
1139555544 16:67707113-67707135 CTGTGGGAAGCCAAGATGGGTGG + Intronic
1140105650 16:71957552-71957574 CTTTGGGAGGAGAAGGTGGGAGG + Intronic
1141172285 16:81699006-81699028 CTGTGGGAAGCCGAGTTGGGTGG + Intronic
1141179169 16:81740633-81740655 CTGAGGCAGGAGAACTTGGGAGG + Intronic
1141244061 16:82290213-82290235 ATGGGGACAGAGGAGTTGGGTGG - Intergenic
1141585376 16:85030006-85030028 CTGTGGAATGGGAAGTGGGGCGG + Intronic
1141907899 16:87039771-87039793 CTGTGTAAAGAGCAGTGGGGGGG + Intergenic
1142320885 16:89382159-89382181 CAGGGGAAAGAGGAGATGGGTGG - Intronic
1203016176 16_KI270728v1_random:355126-355148 CTGTAGAAAGAGGAGGTGAGGGG - Intergenic
1203034511 16_KI270728v1_random:628284-628306 CTGTAGAAAGAGGAGGTGAGGGG - Intergenic
1142481954 17:224422-224444 CTGTGCCAAGAGAAGACGGGTGG - Intronic
1142886476 17:2915476-2915498 CTTTGGAAAGCCAAGGTGGGCGG - Intronic
1142934546 17:3317508-3317530 CATTGGAGTGAGAAGTTGGGAGG + Intergenic
1143470813 17:7174068-7174090 CTGAGGAGAGAGAAGGCGGGTGG + Intronic
1143724893 17:8838007-8838029 CTCTGGATAGAGGAGTGGGGAGG + Intronic
1144053875 17:11521538-11521560 CTTTGGGAAGCCAAGTTGGGAGG + Intronic
1144140181 17:12340630-12340652 CTGTGGGAGGCGAAGATGGGAGG - Intergenic
1144566913 17:16367329-16367351 CTCTGGAAAGCCAAGTTGGGAGG - Intergenic
1146456332 17:33012557-33012579 AGGTGGAATGAGAGGTTGGGAGG - Intergenic
1146682357 17:34817249-34817271 CTTTGGAAAGCCAAGGTGGGAGG + Intergenic
1146737804 17:35253939-35253961 CTTTGGGAAGACAAGGTGGGCGG - Intronic
1147057456 17:37845304-37845326 CTTTGGGAAGCCAAGTTGGGAGG + Intergenic
1147327636 17:39677323-39677345 TTGCGGAAAGGGAAGTTGAGGGG - Intronic
1147458374 17:40552843-40552865 CAATGGTATGAGAAGTTGGGGGG + Intergenic
1147812820 17:43185328-43185350 CTTTGGAAAGCCAAGGTGGGCGG + Intronic
1147980185 17:44269324-44269346 CTGTGGAGAGAGAAAAGGGGAGG + Intergenic
1148076545 17:44939900-44939922 CTGAGGCAAGAGAACCTGGGAGG - Intronic
1148203778 17:45766889-45766911 CTGTGGAGAGAGGAATTAGGTGG + Intergenic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149346282 17:55739531-55739553 CTTTGGAAAGCCAAGATGGGAGG + Intergenic
1149408416 17:56378645-56378667 TTGGGGAAAGAGAGGTGGGGAGG + Intronic
1149545379 17:57499657-57499679 CTGTGGAGCGGGAATTTGGGCGG + Intronic
1150133682 17:62682496-62682518 CAGGTGAAAGAGAAGTTGGTGGG - Intronic
1150431614 17:65122954-65122976 CTCTGGGAAGCCAAGTTGGGAGG - Intergenic
1151412040 17:73937366-73937388 ATGTGGCAGGAGTAGTTGGGTGG + Intergenic
1151565437 17:74894724-74894746 CCTAGGAAAGAGAAGTTGGGTGG + Intergenic
1151741186 17:75983370-75983392 CTGGGGAAAAAGAGGTGGGGAGG - Intronic
1151810516 17:76438011-76438033 GTGTGGACAGAGGAGTGGGGAGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151833504 17:76569302-76569324 CTGTAGAAGGAGGACTTGGGGGG + Intronic
1152168856 17:78729889-78729911 CTGTGGAAAGAGAGTGGGGGAGG + Intronic
1152472241 17:80496258-80496280 CTTTGGAAAGACAAGATGGGTGG - Intergenic
1152998776 18:433727-433749 CTTTGGAAAGCCAAGCTGGGTGG + Intronic
1153287870 18:3473038-3473060 CTTTGGGAAGACAAGGTGGGTGG - Intergenic
1153797419 18:8637018-8637040 CTTTGGAAAGTCAAGGTGGGAGG + Intronic
1153872198 18:9331717-9331739 CTTTGGGAAGCCAAGTTGGGAGG - Intergenic
1153938179 18:9950706-9950728 CTGTTAAAAGAGGAGTAGGGTGG - Intronic
1153973698 18:10248258-10248280 CTGAAGAAAAAGAAGTTGGCTGG + Intergenic
1154344176 18:13528554-13528576 CTTTGGAAGGTGAAGGTGGGTGG - Intronic
1154449308 18:14461179-14461201 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1154939023 18:21092336-21092358 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
1155046225 18:22105707-22105729 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1155258448 18:24018681-24018703 CAGTTGAATGAGGAGTTGGGAGG + Intronic
1155275835 18:24186660-24186682 CTTTGGGAAGACAAGGTGGGTGG + Intronic
1156304644 18:35866004-35866026 CTTTGGGAAGGCAAGTTGGGAGG - Intergenic
1157126749 18:44963401-44963423 CTGGGGAAAGAGAACTTGAATGG + Intronic
1157559081 18:48633456-48633478 CTGTGGGAAGCCAAGGTGGGTGG + Intronic
1158962659 18:62599310-62599332 CTGTAAAAAGAGAGGTGGGGGGG - Intergenic
1160566824 18:79791085-79791107 CTGTGGAGATCGAAGTTGGTAGG + Intergenic
1161101355 19:2423622-2423644 CTGTGGAAAGAACACGTGGGTGG - Intronic
1161167393 19:2795657-2795679 CTCTGGAAAGTGGAGGTGGGAGG - Intronic
1161627358 19:5335114-5335136 CTGTGGGGAGAGAGGCTGGGAGG - Intronic
1162251665 19:9449723-9449745 CTTTGGAAAGTCAAGGTGGGTGG + Intergenic
1162905452 19:13820477-13820499 CTTTGGAAAGCCAAGGTGGGCGG - Intronic
1163138024 19:15327293-15327315 CTTTGGAAAGCTAAGGTGGGTGG + Intronic
1163538961 19:17895324-17895346 CTGAGGAAGGAGAATCTGGGAGG - Intergenic
1163700391 19:18783986-18784008 CTTTGGAAAGCCAAGATGGGAGG - Intronic
1165454580 19:35903328-35903350 CTGTGGAAAGAGAAAGAAGGTGG - Intronic
1165622185 19:37257299-37257321 CTGTGGACAGAGGAGCTGTGGGG + Intergenic
1165631930 19:37308612-37308634 CTTTGGAAGGCCAAGTTGGGTGG - Intergenic
1165787579 19:38471283-38471305 CTGTGGGAAGCCAAGGTGGGAGG + Intronic
1165919206 19:39282918-39282940 CTTTGGAAGGACAAGGTGGGAGG - Intergenic
1166038056 19:40183711-40183733 CTTTGGAAAGCCAAGGTGGGCGG + Intergenic
1166293738 19:41878967-41878989 CTGTGGAGAGACAGGGTGGGTGG - Intronic
1166295377 19:41886870-41886892 CTGTGGAAAGAGGGGTGGGGTGG - Intronic
1166328841 19:42067233-42067255 CTGTGGAATGAGAACTTCGAGGG + Intronic
1166533461 19:43556356-43556378 CTGTGGAAAGAGTCCCTGGGAGG + Intronic
1166703811 19:44897211-44897233 CTGTGGGTAGAGAAACTGGGGGG + Intronic
1167209523 19:48124769-48124791 CTTTGGAAAGCGGAGGTGGGTGG + Intronic
1167413785 19:49360209-49360231 CTGAGGGAAGAGGAGCTGGGGGG + Intronic
1167417606 19:49384780-49384802 CTTTGGAAGGCCAAGTTGGGTGG - Intergenic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG + Intergenic
1167827296 19:51985761-51985783 CTTTGGAAAGCCAAGGTGGGCGG + Intronic
1167998467 19:53425854-53425876 CTTTGGAAAGCCAAGGTGGGTGG + Intronic
1168219828 19:54952648-54952670 CTGAGGAATGAGGAGATGGGAGG - Intronic
1168427826 19:56253073-56253095 CTGTGGACTTAGAAGCTGGGAGG + Intronic
1168532862 19:57143631-57143653 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
1168567538 19:57437480-57437502 CTTTGGGAAGCGAAGGTGGGCGG + Intronic
1168663321 19:58183898-58183920 CTGAGGAAACCGAAGTTGGGAGG - Intronic
1202664576 1_KI270708v1_random:106147-106169 CTGTGGGAGGCCAAGTTGGGTGG - Intergenic
926046896 2:9716590-9716612 CTTTGGAAAGCTAAGGTGGGAGG + Intergenic
926090582 2:10046415-10046437 CTCTGGTAAGAGGAGGTGGGAGG + Exonic
926202342 2:10811186-10811208 CTGTGGAGAGAGTAGATGAGGGG - Intronic
926665162 2:15513743-15513765 CTTTGGGAAGACAAGGTGGGAGG + Intronic
926773951 2:16403862-16403884 GGGTGGAAAGAGAAGGTGGATGG - Intergenic
926818208 2:16822488-16822510 CAGTGGAAAGATGAGTTAGGAGG - Intergenic
926911651 2:17857336-17857358 CTGGGGAAAGAGACATTTGGAGG - Intergenic
927054997 2:19359094-19359116 CTCTGGAAAGAGATTCTGGGAGG - Intergenic
928411968 2:31061227-31061249 CTGTTGAAATTGGAGTTGGGTGG - Intronic
928615655 2:33036699-33036721 CTTTGGGAAGACAAGGTGGGTGG - Intronic
930001869 2:46866999-46867021 CTGAGGAGAGAGAGGTGGGGAGG + Intergenic
931471275 2:62539944-62539966 CTGTAGAATGAGAAGAGGGGAGG + Intergenic
931628980 2:64282667-64282689 CTGTGGAAGGAGAGGTAGAGGGG + Intergenic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
931908087 2:66864579-66864601 CAGTAGAGAGAGAACTTGGGAGG + Intergenic
932301392 2:70669735-70669757 CTGTGAAAATAGAAGTTGCTAGG - Intronic
933765782 2:85707815-85707837 ATGTGGAAAGAGAAATTGTATGG + Intergenic
934159521 2:89235037-89235059 GTGTGGAAAGAGCCATTGGGTGG + Intergenic
934207757 2:89947394-89947416 GTGTGGAAAGAGCCATTGGGTGG - Intergenic
934308568 2:91844382-91844404 CTGTAGAAAGAGAAGGTGAGGGG - Intergenic
934909155 2:98234792-98234814 CTGTGGAAAGGGAGGCTGGTTGG - Intronic
937157098 2:119728765-119728787 CTTTGGAAGGACAAGCTGGGAGG + Intergenic
937344394 2:121115567-121115589 CTTTGGGAAGAGCAGATGGGAGG + Intergenic
938261104 2:129895645-129895667 CTGTGGAAGGAGAGATTGGTGGG + Intergenic
938428355 2:131210318-131210340 CTGTGGAAGGGGTGGTTGGGGGG + Intronic
938555623 2:132421184-132421206 CTTCAGAAAGAGAAGATGGGAGG - Intronic
938604960 2:132882947-132882969 CTTTGGAAGGACAAGGTGGGAGG + Intronic
939618010 2:144381906-144381928 CTGTGGGTAGAGAGGTTGGATGG + Intergenic
939732379 2:145800403-145800425 CAGTGCAAAGGGAAGATGGGGGG + Intergenic
940195328 2:151088128-151088150 CTCAGAAAAGAGAAGATGGGGGG - Intergenic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
940510101 2:154602700-154602722 ATGTGGATAGAGTGGTTGGGGGG + Intergenic
941892107 2:170593344-170593366 CTTTGGAAAGCCAAGGTGGGAGG - Intronic
942036528 2:172015714-172015736 CTTTGGAAAGCCAAGATGGGAGG + Intronic
942299027 2:174544561-174544583 AAGTGGGTAGAGAAGTTGGGAGG - Intergenic
942747949 2:179257035-179257057 CTGTGGCATGAGATGCTGGGTGG - Intronic
942817078 2:180064665-180064687 GTGTGGAAAGAGTATTAGGGAGG + Intergenic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945799007 2:214401988-214402010 CTGTGGATATATAAGTTGGTTGG - Intronic
947985856 2:234446867-234446889 CGGTGGAAGGAGGAGGTGGGAGG - Intergenic
948077164 2:235173940-235173962 GTGTGGATTGAGAATTTGGGAGG + Intergenic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948543378 2:238705597-238705619 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG + Intronic
1168831930 20:850379-850401 CTGTGGGAAGCCAAGGTGGGTGG - Intronic
1170013768 20:11757406-11757428 ATGTGGACAGAACAGTTGGGAGG - Intergenic
1170404281 20:16020007-16020029 CAGTGGGAAGAACAGTTGGGAGG - Intronic
1170409629 20:16074742-16074764 CTGTGGAAAGTAAAGATGAGAGG - Intergenic
1170759490 20:19237212-19237234 CCATGGAAAGAGAAGTTGGGAGG + Intronic
1171108031 20:22454633-22454655 CTCAGGAAATAGAGGTTGGGGGG + Intergenic
1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG + Intronic
1174143991 20:48438006-48438028 CTTTGGAAAGCCAAGATGGGAGG - Intergenic
1174465338 20:50712905-50712927 CTGTGGAAACCAAAGGTGGGGGG + Intergenic
1175281155 20:57804943-57804965 CTGTGGAGAGGGACTTTGGGTGG - Intergenic
1175325119 20:58120221-58120243 CTTTGGAAAGCCAAGGTGGGAGG + Intergenic
1175584571 20:60127760-60127782 CTCAGGAATGAGATGTTGGGTGG - Intergenic
1175642920 20:60646403-60646425 CTGTGGACAGAGAGGGTGGCTGG + Intergenic
1175678107 20:60964650-60964672 TTGTGCAATGAGAGGTTGGGGGG + Intergenic
1175707708 20:61193176-61193198 CTGAGGAAAGAAAAGCTGCGGGG - Intergenic
1175974777 20:62705222-62705244 CTGAGGGAAGAGAAGGTTGGAGG + Intergenic
1176446864 21:6829200-6829222 CTGAGGAAGGTCAAGTTGGGAGG + Intergenic
1176764580 21:13003551-13003573 CTTTGGGAGGACAAGTTGGGTGG - Intergenic
1176825035 21:13694226-13694248 CTGAGGAAGGTCAAGTTGGGAGG + Intergenic
1178661885 21:34513745-34513767 CTGTTGAAACATAATTTGGGTGG - Intronic
1179437673 21:41373531-41373553 CTGTGGACAGAGCAGCTGGAGGG - Intronic
1179554332 21:42162823-42162845 CTGTGCAGGGATAAGTTGGGGGG + Intergenic
1180331305 22:11483062-11483084 CTGTGGGAGGCCAAGTTGGGTGG - Intergenic
1180535654 22:16391461-16391483 CTGTAGAAAGAGGAGGTGAGGGG - Intergenic
1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG + Intergenic
1181097753 22:20517534-20517556 CTGTGAAAAGAGCAGCGGGGTGG - Intronic
1181110372 22:20599203-20599225 CAGTGGAGAGAGAAGTTGCCTGG + Intergenic
1181180557 22:21065193-21065215 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1182029012 22:27142982-27143004 CTTTGGAAGGACAAGGTGGGTGG - Intergenic
1182499409 22:30734945-30734967 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
1182554532 22:31122173-31122195 CTGGGGGAAGGGAACTTGGGTGG - Intergenic
1183194419 22:36343671-36343693 TTGTGAAAAGAGCAGTTGGAGGG - Intronic
1183340155 22:37275652-37275674 CTGTGGGAAAAGGGGTTGGGAGG - Intergenic
1183590557 22:38777111-38777133 CTGAAGACAGAGAAGTTAGGAGG + Intronic
1183884877 22:40871117-40871139 CTTTGGAAAGACAAGATGAGAGG + Intronic
1184354004 22:43966081-43966103 CTTTGGAAGGCCAAGTTGGGAGG - Intronic
1184501961 22:44879850-44879872 GTTTGGAAAGAGCAGGTGGGTGG + Intergenic
1184676998 22:46048948-46048970 CTGTGGAAAGCTGAGGTGGGTGG - Intergenic
1184861832 22:47176749-47176771 CTGTGGAAAGAGAGGTGAAGAGG - Intergenic
1185029593 22:48434702-48434724 CTGTGGCAAGAGAAACTTGGAGG - Intergenic
1185407258 22:50660041-50660063 CTGTGGGAAGCCAAGGTGGGCGG + Intergenic
949642514 3:6054205-6054227 ATGGGCAAAGAGAAGTAGGGTGG - Intergenic
949732379 3:7128749-7128771 CTTTGGGAAGCGAAGGTGGGTGG - Intronic
950352339 3:12368423-12368445 CTTTGGGAAGACAAGGTGGGAGG - Intronic
950774064 3:15334705-15334727 CTTTGGAAAGCCAAGGTGGGTGG + Intronic
951001078 3:17560372-17560394 CTTTGAAAGGACAAGTTGGGAGG + Intronic
951132730 3:19067792-19067814 CTTTGGAAAGCTAAGGTGGGAGG + Intergenic
951923895 3:27886422-27886444 CAGTGGAGAGAGAGGTGGGGAGG + Intergenic
952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
953612177 3:44456170-44456192 CTTTGGAAAGCGGAGGTGGGAGG + Intronic
953974499 3:47371811-47371833 CTGTGGCAGGAGAAGTGGGGAGG - Intergenic
955679552 3:61486295-61486317 CTTTGGAAAGCCAAGGTGGGGGG - Intergenic
956304829 3:67812214-67812236 CTGTAGATAGAGTAGTTGAGAGG + Intergenic
956555053 3:70511987-70512009 CTGTTTAAAGAGGAGTTAGGAGG + Intergenic
957333209 3:78792854-78792876 CTTTGGAAGGCGAAGGTGGGAGG + Intronic
958020981 3:87995350-87995372 CTTTGGGAAGACAAGGTGGGAGG - Intergenic
958568718 3:95851583-95851605 TTGAGGCAAGAGAAGTGGGGTGG + Intergenic
959833804 3:110894906-110894928 CTGTAGAAAGAGAACTTGCTGGG - Intergenic
959915049 3:111807472-111807494 CTCTGGGAAGCCAAGTTGGGAGG + Intronic
960621635 3:119642562-119642584 CTGTGGAAAGAAAAAGAGGGAGG + Intronic
960636476 3:119789684-119789706 CCGAGGAAACAGAAGTTGTGAGG - Intronic
960737983 3:120801391-120801413 CCCTGGACAGGGAAGTTGGGTGG + Intergenic
960842173 3:121970961-121970983 CTTTGGAAAGATGAGGTGGGAGG - Intergenic
960907853 3:122619635-122619657 CTATAGAAAGAGCAGTTGGTCGG + Intronic
961043454 3:123693398-123693420 CTGTGGGAAGATCTGTTGGGAGG + Intronic
961210604 3:125122463-125122485 ATAAGCAAAGAGAAGTTGGGAGG + Intronic
962041422 3:131711404-131711426 GTGGGGAGAGAGAAGTTTGGGGG + Intronic
962207216 3:133444866-133444888 CTGTGGGAAGAGAGGATTGGAGG - Intronic
962420586 3:135225552-135225574 CTCTGAAAAGAGGAGTTTGGGGG + Intronic
963170637 3:142247448-142247470 CTTTGGGAAGACAAGGTGGGTGG + Intergenic
963315203 3:143751615-143751637 CTGTGGAAAGAAGCGGTGGGAGG - Intronic
963365789 3:144332564-144332586 CTGTGGGAAGAAAAGTTCTGGGG + Intergenic
964119387 3:153166449-153166471 CTGTCAAAACAGAAATTGGGTGG + Exonic
964213376 3:154252702-154252724 GTGTGGGAAGGGAAGTGGGGAGG + Intronic
964310526 3:155386953-155386975 CTGGGAAAAGGGAAGTGGGGAGG + Intronic
964394237 3:156228800-156228822 CTGTGGAAGGAGAAATAGGGTGG - Intronic
964572582 3:158125060-158125082 CTTTGGAAGGATAAGGTGGGAGG - Intronic
964790000 3:160445169-160445191 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
965572078 3:170182712-170182734 CTTTGGGAAGTGAAGTTGGGAGG + Intergenic
965863646 3:173177971-173177993 ATGGGGAGAGAGAAGATGGGAGG + Intergenic
966250886 3:177863968-177863990 GTGGGGAAAGAGAACCTGGGTGG - Intergenic
966281207 3:178231523-178231545 CTTTGGAAAGCCAAGGTGGGCGG - Intergenic
966554434 3:181243237-181243259 CTGTGGTAAAAGATGTTGAGTGG + Intergenic
966761442 3:183422668-183422690 CTGAGGAGAGAGGAGCTGGGAGG + Intronic
966863083 3:184241467-184241489 CTGAGGAGAGAGGAGGTGGGGGG - Intronic
967635818 3:191801679-191801701 CTGTGGCAGTAGAAGTTGGGTGG - Intergenic
969562664 4:7959502-7959524 CTCTGGAAGGTGGAGTTGGGAGG + Intergenic
970311149 4:14783844-14783866 CTGTGGAAAGAGCAGTGGTATGG - Intergenic
970445082 4:16116659-16116681 CTAGGGAAGGAGATGTTGGGGGG + Intergenic
970590903 4:17559988-17560010 CTGTGGAAAAAAAAATTGAGAGG + Intergenic
970713064 4:18887266-18887288 CTGGGGAAAGAATAATTGGGTGG - Intergenic
971554274 4:27993468-27993490 CTCTGGAAACAGAAGTTGTTAGG - Intergenic
973720600 4:53719950-53719972 CTGTGGGAAGACAAGATGGGAGG - Intronic
974229113 4:59086588-59086610 CTGCGGAAAGAGAAGGATGGAGG + Intergenic
975182805 4:71366466-71366488 CTGTAGAAAAAGATGTTGTGAGG - Intronic
975197418 4:71541746-71541768 GAGTGGAAAGGGAAGGTGGGTGG + Intronic
975579405 4:75893051-75893073 ATGGGAAAAGAGAAGCTGGGAGG + Intronic
976319571 4:83698263-83698285 CTTTGGAAGGTGAAGTTGAGAGG - Intergenic
976532819 4:86174640-86174662 CTGTGGAAAGAGAAGTGTTGAGG - Intronic
976913260 4:90335859-90335881 CTTTGGAAAGACAAGGCGGGAGG - Intronic
977244923 4:94619864-94619886 CTTTGGGAAGACAAGGTGGGAGG - Intronic
977603511 4:98959060-98959082 CTGAGGAAGGAGAACTCGGGAGG - Intergenic
978160017 4:105534837-105534859 TTGTGGAAACAGATGTTTGGTGG - Intergenic
978344499 4:107752925-107752947 CTGTTAAAACAGAATTTGGGGGG + Intergenic
978484686 4:109238653-109238675 CTGTGGAACTAGAAGGTGTGTGG + Intronic
978495783 4:109357933-109357955 CTTTGGGAGGAGGAGTTGGGCGG + Intergenic
979655169 4:123184037-123184059 CTTTGGGAAGCCAAGTTGGGAGG - Intronic
979996304 4:127435548-127435570 CTGGGGAAGCAGAGGTTGGGAGG + Intergenic
980094298 4:128473578-128473600 CTTTGGAAAGCCAAGGTGGGAGG + Intergenic
980566132 4:134545263-134545285 CTGTGGGAATAGAAATTGGAAGG - Intergenic
980631572 4:135442910-135442932 CTTTGGAAGGACAAGGTGGGCGG + Intergenic
981225999 4:142294932-142294954 CTGAGGAAAGAGGAGTGGTGTGG + Intronic
981995645 4:150971463-150971485 TTGAGGAAAGAGAAGGTGGCTGG - Intronic
982205853 4:152996604-152996626 CTGTGGGAACAGAAATTGGGGGG + Intergenic
982278663 4:153662535-153662557 GTGAGGGAAGTGAAGTTGGGTGG + Intergenic
982516648 4:156359601-156359623 CTTTGGAAGGCGAAGGTGGGTGG - Intergenic
983634808 4:169886732-169886754 CTTTGGAAGGCCAAGTTGGGCGG - Intergenic
983892590 4:173046038-173046060 CTGTGGGAAGCCAAGGTGGGAGG + Intergenic
984441709 4:179779297-179779319 CTGTGGAAAGGGGAGTGTGGGGG - Intergenic
984776411 4:183484782-183484804 CTCTGGGAAGAGAAGCTGCGGGG + Intergenic
986859583 5:11911190-11911212 CTTTGGGAGGAAAAGTTGGGTGG + Intergenic
986878413 5:12139498-12139520 CAGTGTAAAGAGCAGTTGGGAGG + Intergenic
986883050 5:12198997-12199019 TTGTGGAAAGAAAAACTGGGTGG - Intergenic
986943198 5:12982151-12982173 CTATGAAGAGAGAAGTTTGGGGG - Intergenic
986984627 5:13486293-13486315 CTGAGCAAAGAGATGATGGGTGG + Intergenic
987173719 5:15285467-15285489 CTGTGGAAAGAGTCCTAGGGAGG - Intergenic
987382526 5:17298926-17298948 AAGTGGAAAGAGAAATTGGAAGG + Intergenic
987924847 5:24327360-24327382 CTGTTGAATGATAAGTTGGGAGG - Intergenic
988353973 5:30149186-30149208 TTTTGGAAAGACAAGTGGGGAGG + Intergenic
989099896 5:37813804-37813826 CTTTGGAAAGCCAAGGTGGGAGG - Intronic
989126621 5:38059814-38059836 ATGTGAAACAAGAAGTTGGGGGG - Intergenic
989234372 5:39128098-39128120 TTGTGGAAAAAGAAGTGAGGAGG + Intronic
989624920 5:43420134-43420156 CTGAGGAAGGAGGAGTGGGGCGG - Intergenic
990269387 5:54119118-54119140 CTGTGCAAAGAGCCGTTGGAAGG - Intronic
990436651 5:55799304-55799326 CTTTGGAAGGACAAGGTGGGAGG - Intronic
991282155 5:64927492-64927514 GTGGGGAAACAGAAGTTTGGTGG - Intronic
991349387 5:65705197-65705219 CTTTGGGAAGTGAAGGTGGGAGG + Intronic
991646809 5:68808396-68808418 TTGGGGAGGGAGAAGTTGGGAGG + Intergenic
992262294 5:74983533-74983555 ATCTGTAAAGAAAAGTTGGGGGG - Intergenic
992484458 5:77181190-77181212 CTGTGGGAAGGGATGTTTGGAGG + Intergenic
992821600 5:80503323-80503345 CTTTGGGAAGCCAAGTTGGGTGG + Intronic
993118963 5:83751846-83751868 CTGAGGACAGAGAAGTTTGAAGG - Intergenic
993484220 5:88462569-88462591 CTGTGGAAAGAGAAAGCAGGGGG + Intergenic
994269673 5:97762069-97762091 CTGGGGAAAGAATATTTGGGTGG + Intergenic
994629929 5:102272710-102272732 CTTTGGAAGGACAAGGTGGGTGG + Intronic
995111069 5:108429004-108429026 CTGTGGAAAAAGCAGTTTGCTGG + Intergenic
995924343 5:117352523-117352545 CTGTGGAAAGAGCAGATGCTCGG + Intergenic
996310022 5:122094078-122094100 CTCTGGAATGAGTAGCTGGGTGG + Intergenic
997264115 5:132485153-132485175 CTTTGGAAGGCGAAGGTGGGTGG - Intronic
997317957 5:132953754-132953776 CAGTGGAAAAAGAAGTGAGGAGG - Intronic
998143709 5:139713605-139713627 CTTTGGAAAGATAGGTTGAGGGG + Intergenic
998723357 5:144979231-144979253 ATGTGGAAATAAAAGTTGGTTGG - Intergenic
999764209 5:154726081-154726103 CTGTGGAAGGCCAAGGTGGGCGG - Intronic
1000690866 5:164319354-164319376 CTGTAAAAAGAGAATATGGGAGG - Intergenic
1000731242 5:164836339-164836361 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1000797428 5:165682415-165682437 TTGTGGAAAGGGAATGTGGGAGG + Intergenic
1001390189 5:171372375-171372397 CTTTGGGAAGCCAAGTTGGGAGG - Intergenic
1001828063 5:174762302-174762324 CTTTGGAAGGCTAAGTTGGGAGG - Intergenic
1001845774 5:174919647-174919669 CTTTGGCAAGCGAAGGTGGGAGG + Intergenic
1002025738 5:176395188-176395210 GGGTGGGAAGAGAAGGTGGGAGG - Intronic
1002036561 5:176475373-176475395 CTGTGGGAAGCCAAGGTGGGTGG - Intronic
1002178587 5:177417340-177417362 CTGTTCAAGGAGACGTTGGGGGG + Intronic
1002288461 5:178181488-178181510 CTTTGGGAAGTGAAGGTGGGAGG + Intergenic
1002469044 5:179423815-179423837 CTTTGGAAAGCCAAGGTGGGTGG + Intergenic
1002581513 5:180211903-180211925 TTCTGGAGTGAGAAGTTGGGTGG - Intergenic
1003859432 6:10308620-10308642 CTTTGGGAAGTGAAGGTGGGTGG - Intergenic
1003954710 6:11151013-11151035 CTGTGAAAAGAGGAGGTGGTGGG - Intergenic
1004317173 6:14599725-14599747 CTGAGGAAGGAGAGGTGGGGAGG + Intergenic
1004368973 6:15035928-15035950 CTTTGGGAAGCCAAGTTGGGTGG + Intergenic
1004790089 6:19015976-19015998 ATGTGGAAAGAAAGATTGGGAGG + Intergenic
1005098274 6:22142242-22142264 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
1005421934 6:25660260-25660282 CGGTGGAAAGAGAATTGTGGTGG - Intronic
1005429151 6:25736096-25736118 CTGTTGAAAGAGAAGGTGGTGGG + Intergenic
1006206829 6:32352281-32352303 ATTTGGAAAGAGTAGTTTGGAGG + Intronic
1006401058 6:33817658-33817680 CAGTGTAAAGAAAAGTTGGCTGG + Intergenic
1006783006 6:36644823-36644845 CTGTGGGAGGCCAAGTTGGGAGG + Intergenic
1007852643 6:44819977-44819999 CTTTGGGAAGACAAGGTGGGCGG + Intronic
1007910326 6:45506897-45506919 CTTTGGAAGGCCAAGTTGGGTGG - Intronic
1008911263 6:56736131-56736153 CTTTGGAAAGCCAAGGTGGGTGG - Intronic
1009444135 6:63720020-63720042 ATGTAGAAAGAGAAGGTGAGAGG - Exonic
1009848556 6:69165405-69165427 GGGTGTAAAGTGAAGTTGGGGGG - Intronic
1009885078 6:69616059-69616081 CTTGGGAAACAGAAGCTGGGAGG - Intergenic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010221808 6:73454469-73454491 CTTTGGAAGGCGAAGGTGGGTGG + Intergenic
1010756763 6:79674053-79674075 CTTTGGAAACAGAAGTAGGAAGG + Intronic
1010935327 6:81853508-81853530 CGGTGGTAACACAAGTTGGGAGG + Intergenic
1010944688 6:81960060-81960082 CTGTCTAAAGAAGAGTTGGGGGG - Intergenic
1011380909 6:86741245-86741267 TTGTGGAAAGAGAAGTGGCTTGG - Intergenic
1012248121 6:96949453-96949475 CTGTGGAAAGAAAGGCTGGTCGG - Intronic
1012291528 6:97461212-97461234 CTGTGGAGTGAGAGGTTTGGAGG + Intergenic
1013037858 6:106404166-106404188 ATCTGGAAAGTGAAGTTGGGAGG + Intergenic
1013136716 6:107289454-107289476 CTGTGGGAGGACAAGGTGGGTGG + Intronic
1013757272 6:113476379-113476401 CTTTGGGAAGACAAGGTGGGGGG - Intergenic
1013775989 6:113678826-113678848 CTTTGGGAAGACAAGGTGGGCGG + Intergenic
1014472297 6:121831632-121831654 ATGTGGAAAGAGGAATGGGGAGG + Intergenic
1014817282 6:125949988-125950010 CTGTGGGCAGAGCAGTTTGGAGG - Intergenic
1015574850 6:134660344-134660366 CTTTGGAAGGCTAAGTTGGGAGG - Intergenic
1016585518 6:145680131-145680153 CTGTGGAAAGACAAAATTGGGGG + Intronic
1016615500 6:146043052-146043074 CTTTGGAAAGCTAAGGTGGGAGG + Intronic
1016696031 6:146997552-146997574 CTTTGGAAAGCCAAGGTGGGTGG + Intergenic
1017006080 6:150028875-150028897 CTGGAGAAAGAGCAGGTGGGTGG + Intergenic
1017428875 6:154350961-154350983 CTTTGGGAAGCGGAGTTGGGAGG - Intronic
1017946538 6:159100675-159100697 CTATGGAAAAAGGACTTGGGTGG + Intergenic
1018074595 6:160200671-160200693 CTGTGGGAAGAGAGGTGGGGAGG - Intronic
1018313286 6:162532150-162532172 ATCTGGAGAGAGGAGTTGGGGGG - Intronic
1019495903 7:1340536-1340558 CTTTAGACAGAGAAGCTGGGTGG + Intergenic
1020034359 7:4955807-4955829 CTTTGGAAAGCCAAGGTGGGTGG + Intronic
1020113096 7:5458901-5458923 CTTTGGGAAGCCAAGTTGGGAGG + Intronic
1022210284 7:28202166-28202188 CTTTGGGAAGACAAGGTGGGTGG + Intergenic
1022374389 7:29800085-29800107 TTGGGGAAAGAAAAGTGGGGAGG - Intergenic
1023910390 7:44551421-44551443 CTTTGGGAGGAGAAGTTGGGAGG + Intergenic
1026185786 7:68081864-68081886 CTGTGAAGAGAGAAGGTGGTGGG + Intergenic
1026244646 7:68608299-68608321 TGGTAGAAAGAGAAGTTGTGTGG + Intergenic
1027709096 7:81575090-81575112 CTTTGGAAGGCCAAGTTGGGTGG + Intergenic
1028014371 7:85687985-85688007 GTGGGGAAAGAGTAGTGGGGAGG - Intergenic
1028441505 7:90867880-90867902 CTTTGGAAAGTGGAGGTGGGCGG + Intronic
1028606637 7:92662820-92662842 GATTGCAAAGAGAAGTTGGGAGG + Intronic
1028816495 7:95152191-95152213 CTGTGGAAAGCCAAGGCGGGTGG - Intronic
1029146168 7:98447635-98447657 CTTTGGAAAGCCAAGGTGGGAGG + Intergenic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029803213 7:102971780-102971802 CTTTGGAAAGCCAAGGTGGGCGG + Intronic
1029826309 7:103199203-103199225 CTGTGGAAAGTGAGGATCGGAGG - Intergenic
1030494186 7:110276446-110276468 TTCTGCAAAGAGAATTTGGGTGG - Intergenic
1031042051 7:116848989-116849011 CTGCTGAAATAGAAGTAGGGTGG + Intronic
1032384644 7:131513207-131513229 AAGAGGAAAGAGAAGTTAGGAGG + Intronic
1033147989 7:138887576-138887598 CTTGGGAAAGGGAAGGTGGGAGG - Intronic
1033519034 7:142141389-142141411 CTTGGGAAAGAGAAATTTGGAGG - Intronic
1033842991 7:145397707-145397729 CTTTGGAAAGTAAAGGTGGGAGG - Intergenic
1033963231 7:146940293-146940315 CTGAGGCAAGAGAACTCGGGAGG - Intronic
1034034513 7:147804795-147804817 CTGTGGGAAGATAAGCTGGGTGG - Intronic
1034240888 7:149609877-149609899 CTGTGGACAGAGATGCTGGTGGG - Intergenic
1035046845 7:155973471-155973493 CTGTGGAAGGTGGAGCTGGGAGG + Intergenic
1035274757 7:157741112-157741134 CTGTGGAAGGAGGCGTGGGGTGG - Intronic
1035521245 8:276309-276331 CTGTGGAGAGAGGAGTGGAGTGG + Intergenic
1035602072 8:902764-902786 CGGTGGAAAGTGCAGGTGGGCGG + Intergenic
1036718181 8:11146518-11146540 ATGTGGAAAGCTGAGTTGGGGGG + Intronic
1037116534 8:15236100-15236122 CTGGGCAAAGGGAAGTAGGGAGG - Intronic
1037168844 8:15865247-15865269 CTTTGGAAAGCCAAGGTGGGCGG - Intergenic
1037512188 8:19594793-19594815 CTGTGGAAGGCCAAGGTGGGTGG - Intronic
1037727666 8:21496391-21496413 CTGTGGAAAGGGAAGTGTGCAGG + Intergenic
1037885871 8:22596036-22596058 CTTTGGAAAGCCAAGGTGGGAGG - Intronic
1038682799 8:29685021-29685043 GAGTGGGGAGAGAAGTTGGGAGG + Intergenic
1038702486 8:29861730-29861752 ATGCGGAAGGGGAAGTTGGGAGG + Intergenic
1039361433 8:36881465-36881487 CTTTGGGAAGTGAAGGTGGGAGG - Intronic
1039397655 8:37240904-37240926 CTGTGTTGACAGAAGTTGGGGGG - Intergenic
1040351954 8:46578055-46578077 CTTTGGGAAGACAAGGTGGGTGG + Intergenic
1041607674 8:59802327-59802349 CTGTGAAAATGGAAGTTAGGAGG - Intergenic
1042175480 8:66033870-66033892 AGGTGGAAAGAGAATTTGGATGG + Intronic
1042601652 8:70504699-70504721 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1042920974 8:73919251-73919273 CTGTGGGAGGACAAGGTGGGAGG + Intergenic
1043056166 8:75442463-75442485 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
1043332174 8:79130952-79130974 CTGAGGAAAGGGAAGTTCTGAGG - Intergenic
1044235821 8:89828913-89828935 CTGTGGTCAGAGAAGTGGGAAGG + Intergenic
1044466457 8:92512511-92512533 CTGTCTACAGAGAAGCTGGGGGG - Intergenic
1044507188 8:93035726-93035748 CTGTGCAAAGTGAGGTTGGAGGG - Intergenic
1045243095 8:100419353-100419375 CTGTGCACAGAGAAATTTGGGGG + Intergenic
1045392262 8:101727182-101727204 CTTTAGAGAGAGCAGTTGGGTGG - Intronic
1045458765 8:102408703-102408725 CCCTGGAAAGAGCAGTTGAGGGG + Intronic
1045656797 8:104395240-104395262 CTTTGGAAAGCCAAGGTGGGTGG - Intronic
1046350205 8:112999424-112999446 GTGTGACAAGAGAAGTGGGGAGG + Intronic
1047242272 8:123101654-123101676 CTGTGGGAAGCCAAGGTGGGTGG - Intronic
1047324538 8:123824044-123824066 CTGGGGAAAGAGTGGTGGGGAGG - Intergenic
1048533297 8:135270425-135270447 CTGGGAAAAGAGAAGGTTGGAGG + Intergenic
1049664358 8:143836430-143836452 GTGGGGAAAGGGAGGTTGGGCGG + Intronic
1049865105 8:144930157-144930179 CTGTATAAAGAAAAGTAGGGTGG + Intergenic
1051015304 9:12467598-12467620 CTGTGAATGTAGAAGTTGGGGGG + Intergenic
1051152637 9:14100373-14100395 CCATGGAAAGAGAAGATGAGTGG - Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051718254 9:20008270-20008292 CTTTGGGAAGAGGAGCTGGGAGG + Intergenic
1052794480 9:32910726-32910748 CTTTGGGAAGCCAAGTTGGGCGG + Intergenic
1053004726 9:34596908-34596930 GTGTGGAAAGAGAAGCAGGTGGG + Intergenic
1053505600 9:38640913-38640935 CTGAGGAAAGGGAAGCTGAGAGG + Intergenic
1054822848 9:69540846-69540868 CTTTGGGAAGCCAAGTTGGGAGG - Intronic
1056328719 9:85503972-85503994 CCTTAGAAAGAGAAGTTAGGAGG - Intergenic
1056505850 9:87257620-87257642 CTCTGGAAGCAGAACTTGGGTGG + Intergenic
1057041805 9:91853468-91853490 CTGTGACAAGTCAAGTTGGGAGG + Intronic
1057432490 9:95006653-95006675 CTGTGGAAAAAGAAAAGGGGTGG - Intronic
1057641780 9:96830583-96830605 CTGTGGCAGGGGAGGTTGGGGGG - Intronic
1057829292 9:98394695-98394717 TTCTGTAAAGAGGAGTTGGGGGG - Intronic
1059185668 9:112268449-112268471 CTTTGGGAAGACAAGGTGGGAGG + Intronic
1059363867 9:113770218-113770240 CTTTGGAAAGCCAAGGTGGGTGG - Intergenic
1060231091 9:121826007-121826029 GTGTGGAAAGAGATGATGGAGGG + Intronic
1060307940 9:122433306-122433328 CTTGGGAAAGAGAAGGTTGGTGG - Intergenic
1060690889 9:125659004-125659026 CTTTGGAAAGGCAAGGTGGGAGG + Intronic
1061151521 9:128831096-128831118 CTTTGGGAAGCCAAGTTGGGAGG - Intergenic
1061867165 9:133498839-133498861 CTGATGAAAGACAAGGTGGGAGG + Intergenic
1203522328 Un_GL000213v1:55331-55353 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1185516550 X:703316-703338 CTTTGGAAGGCCAAGTTGGGAGG - Intergenic
1186084525 X:5972738-5972760 CTTTGGGAAGACAAGGTGGGGGG + Intronic
1187064880 X:15823736-15823758 CTTTGGGAAGACAAGGTGGGAGG - Intergenic
1187128348 X:16475686-16475708 CTGTGGAGGGGGAAGTTAGGAGG + Intergenic
1188677793 X:32964462-32964484 CTTTGGAAAGCAAAGGTGGGTGG + Intronic
1189441225 X:41037936-41037958 CTTTGGAAGGACAAGGTGGGTGG + Intergenic
1189732815 X:44039564-44039586 GTGTGGAGAGAGGAGTTGAGGGG - Intergenic
1190818965 X:53955320-53955342 CTTTGGAAAGGTAAGATGGGAGG - Intronic
1191233923 X:58119055-58119077 CTTTGGGAAGACAAGGTGGGTGG + Intergenic
1192442523 X:71185230-71185252 CTGTTGAAAGAGTAGATGGAAGG - Intergenic
1192451877 X:71249918-71249940 CTGTGGAAAGGGGAGTGGGGAGG - Intronic
1193206187 X:78750628-78750650 CAGTGGAGAGAGAAATTGTGTGG + Intronic
1193287027 X:79725164-79725186 AAATGGAAATAGAAGTTGGGAGG - Intergenic
1195124155 X:101788405-101788427 CTGGGGGAAGGGTAGTTGGGAGG - Intergenic
1195465717 X:105176680-105176702 CTGTGGGGAGAGAAGGGGGGTGG + Intronic
1195539632 X:106047924-106047946 CTGTGGGAATGGAAGTTAGGAGG - Intergenic
1195853025 X:109303734-109303756 TTGTGGAAAGGGAAGTAGGCAGG + Intergenic
1196761485 X:119204687-119204709 CTCTGGTAAGGGAACTTGGGTGG - Intergenic
1197295617 X:124715778-124715800 CTGTGGAAAATGAAGTTGAACGG - Intronic
1197981989 X:132226955-132226977 CTGGGGAATGAGAAGTTTGGAGG + Intergenic
1198175904 X:134154051-134154073 CTCTGGAAAGCTAAGGTGGGAGG + Intergenic
1199969661 X:152850242-152850264 CTGTGGAAAGAGAGGAACGGTGG - Intronic
1201745346 Y:17366262-17366284 CTTTGGGAAGCCAAGTTGGGAGG - Intergenic