ID: 1102981993

View in Genome Browser
Species Human (GRCh38)
Location 12:117249237-117249259
Sequence GCCCTTCCACAGATGAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102981993_1102981998 3 Left 1102981993 12:117249237-117249259 CCCAAGCTCATCTGTGGAAGGGC 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1102981998 12:117249263-117249285 TGAAACCTAAGGGCTCTCAAGGG 0: 1
1: 0
2: 1
3: 2
4: 119
1102981993_1102981997 2 Left 1102981993 12:117249237-117249259 CCCAAGCTCATCTGTGGAAGGGC 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1102981997 12:117249262-117249284 TTGAAACCTAAGGGCTCTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 116
1102981993_1102981995 -8 Left 1102981993 12:117249237-117249259 CCCAAGCTCATCTGTGGAAGGGC 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1102981995 12:117249252-117249274 GGAAGGGCACTTGAAACCTAAGG 0: 1
1: 0
2: 1
3: 11
4: 119
1102981993_1102982000 23 Left 1102981993 12:117249237-117249259 CCCAAGCTCATCTGTGGAAGGGC 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1102982000 12:117249283-117249305 GGGTTTCTCTTCGTTTCTTTTGG 0: 1
1: 0
2: 0
3: 28
4: 391
1102981993_1102981996 -7 Left 1102981993 12:117249237-117249259 CCCAAGCTCATCTGTGGAAGGGC 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1102981996 12:117249253-117249275 GAAGGGCACTTGAAACCTAAGGG 0: 1
1: 0
2: 1
3: 23
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102981993 Original CRISPR GCCCTTCCACAGATGAGCTT GGG (reversed) Intronic
900335296 1:2160123-2160145 GCGCTTCCACAGATAAGCAAAGG - Intronic
900563288 1:3319313-3319335 GCCCTTCCAATGTTGAGCCTTGG - Intronic
901210717 1:7524546-7524568 GCTCTTCCACAGATGAGGAATGG - Intronic
901260928 1:7870126-7870148 GACCTTCAACATATGAGTTTTGG - Intergenic
903941443 1:26934575-26934597 ACCTTGTCACAGATGAGCTTTGG - Intronic
904279524 1:29409175-29409197 GCCCTTCCAAAGACAAACTTGGG - Intergenic
906276798 1:44522968-44522990 GCCCATCCAGAGAGCAGCTTTGG + Intronic
917618694 1:176772546-176772568 CCCCTCCCACATATGAGCCTGGG - Intronic
918051589 1:180977566-180977588 GTCCTTCCACTGATGAGTTTTGG + Intronic
919247923 1:195013513-195013535 GCCGTGTCTCAGATGAGCTTTGG - Intergenic
919838111 1:201590616-201590638 GCCCTTCCTCAGCTGGGCCTGGG - Intergenic
921321149 1:213940295-213940317 CCCCCTTCACAGATGAGCTGAGG - Intergenic
922549020 1:226480428-226480450 GTGCTTCCAGAGATTAGCTTGGG + Intergenic
922579348 1:226685513-226685535 GAGCCTCCACAGATGAGCTCTGG + Intronic
922629242 1:227087934-227087956 GCCCTTCCACATTTGTGGTTGGG + Intronic
922815114 1:228443313-228443335 GGGCTTCCACAGATGAGTTTGGG - Intergenic
923030508 1:230245863-230245885 GGCCATCCACAGATGTGCTGTGG - Intronic
923102669 1:230828690-230828712 GCCCTTCCACTGGAGAGCTCTGG - Intergenic
924424738 1:243940881-243940903 TCCCTGCCAGAGATGAGCTGGGG - Intergenic
1063299773 10:4841069-4841091 TCCATTCCACAGCTGAGCTTTGG + Intronic
1064314811 10:14245524-14245546 GAACTTCAACAGATGAGTTTGGG - Intronic
1068030367 10:51698407-51698429 GCCCTTCCTCACATGAGATGAGG - Exonic
1069888116 10:71636690-71636712 GCCAAGCCACAGAGGAGCTTGGG + Intronic
1070916638 10:80159242-80159264 GGACTTCCACATATGAACTTTGG - Intronic
1071334073 10:84587429-84587451 ACCCTGCCAGAGATGATCTTTGG + Intergenic
1071445249 10:85740198-85740220 TTTCTTCCACAGATGAGCTTGGG + Intronic
1072536507 10:96368415-96368437 GCTCTTCCAAAGATGATCCTAGG + Intronic
1074782621 10:116812812-116812834 GCGCAGACACAGATGAGCTTTGG + Intergenic
1074863543 10:117531803-117531825 GGTCTTCCCCAGATGGGCTTGGG - Intergenic
1075600081 10:123761333-123761355 GTCCCTTCACAGCTGAGCTTGGG + Intronic
1076459630 10:130632762-130632784 GGCCTTCCCCAGAGGAGATTGGG + Intergenic
1080313386 11:30921236-30921258 GGACTTCCACTGATGAGTTTTGG - Intronic
1080863461 11:36171367-36171389 ACCCTTCCAGACATGGGCTTAGG - Intronic
1084638246 11:70407657-70407679 GTCCCTCCACAGATGACCATGGG - Intronic
1089002043 11:115060143-115060165 GCCCTTCCTCAGCAGGGCTTGGG + Intergenic
1089293030 11:117449921-117449943 GCCCTTCCACTGATGCTCTGAGG - Intronic
1091132001 11:133154110-133154132 GACCCTCTACAGATGAGCGTGGG - Intronic
1091586795 12:1821385-1821407 ACCCTCCCCCAGATGAGCATGGG + Intronic
1095244664 12:39904973-39904995 GCCATTCTACAGTTGAGATTGGG - Intronic
1102981993 12:117249237-117249259 GCCCTTCCACAGATGAGCTTGGG - Intronic
1104479252 12:129093142-129093164 GACATGCCACAGATGGGCTTCGG + Intronic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1108711083 13:53033010-53033032 GATGTTCCACAGGTGAGCTTTGG + Intronic
1108924015 13:55715594-55715616 GCCCTTACAGACATTAGCTTAGG - Intergenic
1110813386 13:79835422-79835444 GCCTTTCTACAGAGGAGCTGGGG + Intergenic
1113009528 13:105748032-105748054 TCCCTTCCCCAGGTAAGCTTGGG - Intergenic
1113666706 13:112146828-112146850 GGACTTCCACAGGTGAACTTTGG - Intergenic
1115969499 14:38929603-38929625 TCCCTTTCTCAGATGAGCTGTGG + Intergenic
1115972568 14:38962281-38962303 GACCTTCAACATATGAACTTGGG + Intergenic
1118337949 14:64870456-64870478 ACCCTTCCCCACCTGAGCTTGGG + Intronic
1119438122 14:74611387-74611409 GCCCCTCCACAAATGAGCCCTGG + Intronic
1119902124 14:78270107-78270129 GCTCTTGCACACATGAGCTCAGG - Intronic
1120988654 14:90355659-90355681 GCCCTTCTGCTGATGAGCTCTGG + Intergenic
1121291541 14:92779866-92779888 CCCCTTTCACAGTTGAACTTGGG + Intergenic
1122135648 14:99631416-99631438 GGGCTTCCACATATGAACTTGGG + Intergenic
1123991890 15:25689524-25689546 GCCCTTTGAGAGATGAGCTGTGG - Intronic
1124420906 15:29520987-29521009 GCACTTCTACAGATCAACTTGGG - Intronic
1128253673 15:66181651-66181673 AACTTTCCACAGATGAGATTAGG - Intronic
1128294187 15:66503916-66503938 GTCTTTCCACTGGTGAGCTTTGG - Intronic
1129737790 15:77975587-77975609 GCCTTTCCACAGATGACCTGAGG + Intergenic
1129848296 15:78778029-78778051 GCCTTTCCACAGATGACCCAAGG - Intronic
1130253629 15:82315907-82315929 GCCCTTCCACAGATGACCCGAGG + Intergenic
1131971410 15:97897200-97897222 GCATTTTCACAGATGAACTTTGG - Intergenic
1134182146 16:12056411-12056433 ACCCTTCCACAGAGCAGCCTGGG + Intronic
1134618121 16:15667548-15667570 GCCCTTCCAGAGATGAGCATGGG - Intronic
1141352874 16:83315171-83315193 GGGCTTCCACATATGAGCTTAGG - Intronic
1141432478 16:83977578-83977600 GCCCCTCCACAGAGGAGCTGTGG + Intronic
1143578265 17:7807818-7807840 GCCCTTCCAAAGATTGACTTGGG + Intronic
1144718180 17:17448969-17448991 GCCCCTTCACAGCTGAGCTCAGG - Intergenic
1147659720 17:42111089-42111111 TCCCTTCCCCAGCTGAGCCTCGG - Intronic
1150119526 17:62588545-62588567 CCCCCTCCTCAGATGAGCTCAGG - Intronic
1150588384 17:66539069-66539091 GCCTGTGAACAGATGAGCTTTGG - Intronic
1151154021 17:72111782-72111804 GCCCTTTCACAGATGAGCCCTGG - Intergenic
1152474394 17:80508653-80508675 GGCCTTGCACAGATGAGGTGGGG + Intergenic
1155713688 18:28913040-28913062 GCCCTTTCACAGTGGAACTTGGG + Intergenic
1156352232 18:36311336-36311358 TCCCTTTCACAGATGTTCTTGGG + Intronic
1157932719 18:51840923-51840945 TCCCTTCCAGAGATGGTCTTGGG - Intergenic
1160568396 18:79800490-79800512 CCCCTTCCTCAGATGAGGCTTGG + Intergenic
1164502536 19:28831813-28831835 GGACTTCCACAGATGAATTTGGG + Intergenic
1164512616 19:28909977-28909999 GCCCTTCTTCAGATTAGCCTGGG - Intergenic
1166263904 19:41664645-41664667 GCCCTTCTAGACATGGGCTTAGG + Intronic
1167180492 19:47899492-47899514 GGCCTTCAACTGATTAGCTTGGG - Intergenic
931136600 2:59409575-59409597 GCCCTTCCAGACATTGGCTTAGG - Intergenic
933289854 2:80426119-80426141 GCCCTTCTAAAGATTAGCTAAGG + Intronic
933555250 2:83823552-83823574 GCCCTTGCACATATGTGCCTCGG + Intergenic
933738895 2:85517409-85517431 GCCCTGCCACAGCTGCACTTTGG - Intergenic
935124086 2:100207595-100207617 TCCCTTCCCCACATGAGCCTGGG + Intergenic
936743949 2:115550888-115550910 GCCCATCCACAGATGTGCTTAGG + Intronic
937293035 2:120793476-120793498 GGCCTGCCTCAGATGAGCTTTGG + Intronic
948109923 2:235446157-235446179 GCCTTTACACAGCTGAACTTAGG + Intergenic
948266527 2:236638972-236638994 GCCCATCCACAGCCGGGCTTCGG + Intergenic
948695211 2:239729779-239729801 GCACTGCCACAGGTGAGCATAGG + Intergenic
948809621 2:240467917-240467939 CCCCTTCCAGAGATGAGCGTAGG - Exonic
948900633 2:240955298-240955320 GCCCTCCCCCAGATGGGCCTGGG + Intronic
949006992 2:241655353-241655375 GCGCTTCCACTGCTGAGCATGGG + Intronic
1170586911 20:17741608-17741630 CCCCTGCCACAGATGGGTTTTGG + Intergenic
1170695974 20:18659318-18659340 CCCCTTCCACAGGTCAGCCTGGG - Intronic
1170955631 20:20977184-20977206 GTCCTTCCACAGCTCAGCTCAGG + Intergenic
1174052746 20:47778651-47778673 GCTCTGCCACAGATGCCCTTGGG - Intronic
1176205163 20:63884235-63884257 TCCCTACCACTGCTGAGCTTTGG + Intronic
1177312695 21:19418072-19418094 GCATTTCAACATATGAGCTTTGG - Intergenic
1179145015 21:38760466-38760488 AAGCTTCAACAGATGAGCTTGGG - Intergenic
1181375287 22:22453294-22453316 GCCCTTCCTCAGAGGAGAATGGG - Intergenic
1181786361 22:25230090-25230112 GGGGGTCCACAGATGAGCTTTGG + Intronic
1181818532 22:25457913-25457935 GGGGGTCCACAGATGAGCTTTGG + Intergenic
950489813 3:13297052-13297074 GCCTGTCCACAGATGAGGATTGG - Intergenic
956237481 3:67090444-67090466 GGCCTTCCACAGATTAACTGAGG + Intergenic
964315089 3:155434951-155434973 GCCCTTCCACAGGCTGGCTTGGG + Intronic
967857023 3:194125759-194125781 GGACTTCCACAGACCAGCTTTGG - Intergenic
967880559 3:194298500-194298522 GTCCTTCTGCAGAGGAGCTTAGG - Intergenic
968509422 4:988827-988849 GCCCTGCTACAGATGGGCATCGG + Exonic
971940533 4:33209185-33209207 GCCCTTCTAGAGATTGGCTTAGG + Intergenic
974843488 4:67323922-67323944 GCCTTGTCACAGATGAGCTATGG + Intergenic
975495737 4:75034297-75034319 CCCCTTTCACAGATGAGAATAGG - Intronic
975504550 4:75123579-75123601 GCCTTTCTACAGATGGGCTGAGG - Intergenic
976827449 4:89276772-89276794 TCCCCTCCACAGATGAGAGTAGG - Intronic
977801670 4:101241330-101241352 GGCCTTCCACATATTATCTTAGG - Intronic
981076942 4:140601732-140601754 GCCCTTCCTCAGAGGAGAATGGG + Intergenic
982104159 4:151997369-151997391 GCAGTTCCACAGCAGAGCTTTGG + Intergenic
982607090 4:157528624-157528646 GCAATACCACAGATGAGCTGGGG - Intergenic
984716771 4:182933340-182933362 TCACCTCCACAGATAAGCTTTGG - Intergenic
985712979 5:1440536-1440558 GAACTTCAACAGATGAACTTGGG - Intronic
990799439 5:59583910-59583932 GCCTTTCTAGAGATGAGCTAGGG + Intronic
992757965 5:79926740-79926762 ACCCTTCAAGAGATGACCTTCGG + Intergenic
996877715 5:128258152-128258174 GCCATTTCACATATGAGGTTTGG + Exonic
1001065464 5:168531793-168531815 GCCTTTCTAAAGATGTGCTTGGG + Intergenic
1001500134 5:172225059-172225081 GTCCTTCCACAGAGGATGTTAGG - Intronic
1001927689 5:175650409-175650431 TTGCTTCCACAGATGAGCATAGG + Intergenic
1005938832 6:30545940-30545962 CCCCTTCCCCAGATGAACTGAGG - Exonic
1013107629 6:107039132-107039154 TCCCTCCCACAAATTAGCTTTGG - Intronic
1015186734 6:130425715-130425737 CCCCTTAGACAGATGAGCTAAGG - Intronic
1017805531 6:157942488-157942510 GCTTTTCCTCAGATGAGCTGGGG - Intronic
1018445383 6:163853518-163853540 GGGCTTCAACAGATGATCTTGGG - Intergenic
1018931872 6:168245310-168245332 ACAATTTCACAGATGAGCTTTGG + Intergenic
1021071030 7:16241089-16241111 GCTCTGCCACTGGTGAGCTTTGG + Intronic
1022891762 7:34708367-34708389 GCAATTACACTGATGAGCTTAGG + Intronic
1028018510 7:85743499-85743521 GCCCTTCCACTCATGACTTTTGG - Intergenic
1030360747 7:108593128-108593150 GCCTTTCCACAGTGGAACTTAGG - Intergenic
1034261602 7:149760217-149760239 GCCCTCCCACAGGCGAGGTTAGG - Intergenic
1034498112 7:151433885-151433907 GCCCTTCCCCAGGTGAGGGTAGG + Intronic
1036143520 8:6229854-6229876 GATTTTCCACAGATTAGCTTTGG - Intergenic
1036672023 8:10796448-10796470 CCCCTTCCAGAGAGCAGCTTGGG + Intronic
1037009933 8:13829033-13829055 GCCATTACACAGATGAATTTTGG + Intergenic
1037787943 8:21913392-21913414 GCCCTCCCAAAGTTGAGCTCTGG + Intronic
1037951567 8:23021780-23021802 GCCCTCCCTCAGATGTACTTTGG - Exonic
1038779327 8:30557028-30557050 GCCCTGCCTTAAATGAGCTTTGG + Intronic
1044331550 8:90926021-90926043 TCCTTTCCCCAGATGAACTTAGG - Intronic
1047372577 8:124268067-124268089 GCCCCTCCTCAGAAGTGCTTGGG + Intergenic
1048944591 8:139432606-139432628 GGCTTTCCACATATGAACTTTGG - Intergenic
1049345838 8:142138139-142138161 GCCCTCACACAAGTGAGCTTAGG - Intergenic
1050428953 9:5542249-5542271 GCCCTTCTAGACATTAGCTTAGG + Intronic
1052203631 9:25811699-25811721 GCCCTTCCACAGGTGATATTTGG - Intergenic
1053308369 9:36999942-36999964 GCCCTTTCAGAGATGCGCTTTGG - Intronic
1056846454 9:90041776-90041798 GCCCTTCCTCAGATGAGAGTGGG + Intergenic
1057742825 9:97726942-97726964 GTCCTGCCACAGACGAGCTGAGG + Intergenic
1061634252 9:131896281-131896303 GCCCTTCCAGAGGAGAGCTGTGG - Intronic
1186518986 X:10188832-10188854 GCCCCTCCTCCGATGAGCTAGGG - Intronic
1186627052 X:11305526-11305548 GACCTTCCAAAGATGTGCTAAGG + Intronic
1199134739 X:144236258-144236280 GCCCTTCCACTGGAGAGGTTGGG + Intergenic
1201513375 Y:14789821-14789843 GCCCTTTCTCAGATGAGTCTAGG + Intronic