ID: 1102989322

View in Genome Browser
Species Human (GRCh38)
Location 12:117303505-117303527
Sequence CACCTTTACCAGCTAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102989322 Original CRISPR CACCTTTACCAGCTAGAGGC TGG Intronic
905298158 1:36967740-36967762 CAACTTTACCACCTATAGACAGG + Intronic
908463180 1:64366283-64366305 CACCTTTCCCAGGGAGAAGCAGG + Intergenic
912688346 1:111784854-111784876 CATCTTTAGCAGCGAGAGGAAGG + Intronic
913120903 1:115739852-115739874 CAGCTTTATCAGCTAGGGGGAGG - Intronic
913546504 1:119874037-119874059 ACTCTTCACCAGCTAGAGGCTGG - Intergenic
913576924 1:120184506-120184528 CCCTTTTCCCAGCTAAAGGCTGG - Intergenic
913711615 1:121489901-121489923 CACCTGTACAAGTTAGAGACAGG + Intergenic
914558833 1:148795941-148795963 CCCTTTTCCCAGCTAAAGGCTGG - Intergenic
914614000 1:149334289-149334311 CCCTTTTCCCAGCTAAAGGCTGG + Intergenic
916062765 1:161112001-161112023 CACATTTACAAGTTAGAGGAAGG + Intronic
918668044 1:187177272-187177294 CACCTTTTCCACATGGAGGCAGG + Intergenic
921951644 1:220936386-220936408 CTCCTTTACCAAGCAGAGGCTGG + Intergenic
922088609 1:222374395-222374417 CAGTTTTACCATCTAGAGACTGG - Intergenic
922509384 1:226150816-226150838 CATATTTACCAGCTAGAATCTGG + Intronic
922793625 1:228325035-228325057 AGCCTGTACCAGCCAGAGGCTGG - Intronic
924580738 1:245321878-245321900 CACCTTTAACTCCTGGAGGCTGG + Intronic
924604099 1:245517227-245517249 CACGTGCCCCAGCTAGAGGCAGG + Intronic
1064033111 10:11895237-11895259 CCCCATGACCAGCGAGAGGCGGG + Intergenic
1066400267 10:35069248-35069270 CACCTTGCCCAGCTGGTGGCTGG - Intronic
1067432621 10:46253844-46253866 CACCTGTGCCAGCTGGAAGCCGG + Intergenic
1069469365 10:68673583-68673605 CACCTTTATCAGCTCGTGGGTGG + Intronic
1076227721 10:128793733-128793755 CACGGTCACCAGCTGGAGGCTGG + Intergenic
1076417795 10:130303980-130304002 CACCTTTACGAGCTTGGAGCAGG - Intergenic
1078533844 11:12157399-12157421 AATTTTTAGCAGCTAGAGGCAGG + Intronic
1079808558 11:24964247-24964269 CACATTTACCTGCTACATGCTGG + Intronic
1081568512 11:44275446-44275468 CACCTTCACCAGCTACCAGCTGG - Exonic
1081614765 11:44584172-44584194 CACCTCTAACAGCAAGATGCTGG - Intronic
1085843384 11:80039189-80039211 GACCTGAAACAGCTAGAGGCAGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1090660966 11:128881164-128881186 CAGCTTGATCAGCTGGAGGCAGG + Intergenic
1096025053 12:48352979-48353001 CACCATGCCCAGCTAGAGACAGG - Intergenic
1100644846 12:96518144-96518166 CAATTTTACCACCTAGTGGCTGG - Intronic
1102989322 12:117303505-117303527 CACCTTTACCAGCTAGAGGCTGG + Intronic
1104837253 12:131799722-131799744 CACCTTTTCTAGCTAGACCCTGG + Intronic
1107986937 13:45783906-45783928 CACCTTCACCACCAGGAGGCGGG - Exonic
1108719340 13:53114943-53114965 CATATTTACCAGCTAGTTGCTGG + Intergenic
1110009842 13:70318188-70318210 CAACTTTACCACCTAGAGTATGG + Intergenic
1113474058 13:110567479-110567501 CACCCTTACCTGCCAGACGCAGG + Intergenic
1115023025 14:28706148-28706170 CACTTTTAGGAGGTAGAGGCAGG + Intergenic
1120365343 14:83561547-83561569 CACTTTTACCTGCTGGAGCCAGG + Intergenic
1120950350 14:90035241-90035263 CAAAGTTACCAGCAAGAGGCAGG - Intronic
1121417659 14:93789966-93789988 CACCTCAACCAGCAAGATGCAGG + Intergenic
1123666128 15:22610582-22610604 CACCTTTAAAAGTCAGAGGCAGG + Intergenic
1124319951 15:28704988-28705010 CACCTTTAAAAGTCAGAGGCAGG + Intronic
1124482559 15:30090435-30090457 CACCTTTAAAAGTCAGAGGCAGG - Intronic
1124489015 15:30142531-30142553 CACCTTTAAAAGTCAGAGGCAGG - Intronic
1124521018 15:30406774-30406796 CACCTTTAAAAGTCAGAGGCAGG + Intronic
1124537644 15:30559446-30559468 CACCTTTAAAAGTCAGAGGCAGG - Intronic
1124544100 15:30611501-30611523 CACCTTTAAAAGTCAGAGGCAGG - Intronic
1124754515 15:32395792-32395814 CACCTTTAAAAGTCAGAGGCAGG + Intronic
1124761012 15:32448141-32448163 CACCTTTAAAAGTCAGAGGCAGG + Intronic
1124777622 15:32600922-32600944 CACCTTTAAAAGTCAGAGGCAGG - Intronic
1127859482 15:62981161-62981183 TTCCTTTATCAGCTAGAAGCTGG + Intergenic
1132195726 15:99913402-99913424 CACCTTTTCCAGCTAGCAGGAGG + Intergenic
1136624873 16:31456267-31456289 CAGCCTGACCAACTAGAGGCTGG + Intergenic
1137557604 16:49482621-49482643 CACCTCTACCAGCTAGAGGGTGG - Intergenic
1151684156 17:75637002-75637024 CACTTTTCCCCGCTGGAGGCCGG + Exonic
1162786900 19:13040657-13040679 CACATGTACCAGCTGGAGGACGG - Intronic
1167994798 19:53393753-53393775 CTCCATTACCAACTAGAGCCAGG + Intronic
933121820 2:78547381-78547403 CACCTTCCCCAGCTAGACTCAGG + Intergenic
937842325 2:126536150-126536172 TACATTTACTAGTTAGAGGCAGG + Intergenic
939529190 2:143336216-143336238 AACATTTACAAGCTGGAGGCTGG - Intronic
939609169 2:144289185-144289207 CACCATACCCAGCTAGAGACAGG + Intronic
944079358 2:195769593-195769615 CACCTTTACCCCCTAGACCCAGG - Intronic
946503450 2:220274581-220274603 CACCTTGAAAAGCAAGAGGCAGG + Intergenic
947388687 2:229618059-229618081 CCCCTTTTCCTGCAAGAGGCAGG + Intronic
947777847 2:232728650-232728672 CATCTCTCCCAGCTAGTGGCCGG + Intronic
1174444044 20:50578616-50578638 CCTCCTTACCAGCAAGAGGCAGG - Exonic
1177738070 21:25118439-25118461 CACCTTTCCCAGCTAGACTTAGG - Intergenic
1178752496 21:35318015-35318037 CACCTATGCCAGCTAGAGGCAGG + Intronic
1180162085 21:46002627-46002649 CTCCTTGACCAGCGAGAGGCCGG - Exonic
1182410226 22:30178993-30179015 CACCTCTTCCAGGAAGAGGCTGG + Intergenic
1183320656 22:37163351-37163373 CACCCTTTCCAGCTGGAGGATGG - Intronic
1184072103 22:42152771-42152793 CGCCTTTCCCAGCTGGAAGCGGG - Intergenic
1185421159 22:50735142-50735164 CACCTTGCCCAGCCTGAGGCTGG + Intergenic
950032187 3:9860539-9860561 CACCTTTCCAAGATAGATGCAGG + Intergenic
955197026 3:56813961-56813983 CATCTGTACCAGCTGGAAGCAGG + Intronic
972679050 4:41288111-41288133 CGCCTTAACCAGCCACAGGCTGG - Intergenic
978534812 4:109749872-109749894 ATCCTTTATCAGCTAGAGGCTGG - Intronic
980847521 4:138341945-138341967 CTCTTTTACCAGCTTGTGGCAGG - Intergenic
980852970 4:138405645-138405667 CAGCCTTACCTGCTAGAGGCTGG - Intergenic
988400341 5:30753277-30753299 TCCCTTTACCAGCCAAAGGCAGG - Intergenic
992427830 5:76676387-76676409 CTGCTTTCCCAGCCAGAGGCTGG - Intronic
996110151 5:119555840-119555862 CACCTTAGGGAGCTAGAGGCTGG + Intronic
998404976 5:141869188-141869210 CACCTGTACAAGCTAGAGGTGGG - Exonic
999096983 5:148988372-148988394 CTCCTATACCAGCTCTAGGCTGG + Intronic
1000042898 5:157498310-157498332 CACCTCTGCCATCCAGAGGCAGG + Intronic
1000936328 5:167306581-167306603 CAGCTTTAACAGATAGATGCGGG + Intronic
1002717644 5:181238178-181238200 CACCTTTACACGCTAGATGGTGG - Exonic
1005583633 6:27255269-27255291 CTCCTTTGCCAGCTTGAGCCAGG - Exonic
1006585346 6:35106956-35106978 CACCTTTACCCGGTAATGGCGGG + Intergenic
1008675483 6:53813487-53813509 CAACTTTACCAGCTGGAAGGTGG + Intronic
1011534944 6:88366570-88366592 CAACTGTACCATCTACAGGCTGG - Intergenic
1011623597 6:89265454-89265476 TGCCTTTACCATCTAGATGCTGG - Intronic
1019699783 7:2469031-2469053 CTCCTTTACCAGCATGGGGCAGG - Intergenic
1022137384 7:27461788-27461810 CTCCTATACCAGCTAGAGTGAGG + Intergenic
1024411045 7:49041590-49041612 CACCTTTACCAGGGAAAGACAGG + Intergenic
1029019290 7:97347379-97347401 CACTTTTACCAACTGGTGGCTGG - Intergenic
1033397794 7:140992575-140992597 CACCTTTGCCAACAAGGGGCTGG - Intergenic
1034041815 7:147885780-147885802 CTCGTTTACCTGCTAGAAGCTGG + Intronic
1034816457 7:154175974-154175996 CACCATGCCCAGCCAGAGGCTGG + Intronic
1038443617 8:27588100-27588122 CACCATGCCCAGCTAGAGACAGG - Intergenic
1039892066 8:41692565-41692587 CACCATTACCAGGTGCAGGCAGG - Intronic
1045566697 8:103323912-103323934 CAAGTATACCAGCAAGAGGCAGG - Intronic
1049615583 8:143574470-143574492 GACCTTTCCTTGCTAGAGGCAGG - Intergenic
1055288478 9:74756899-74756921 TACCTTAACAAACTAGAGGCTGG + Intronic
1055810818 9:80145670-80145692 CACCTAGACCTACTAGAGGCAGG - Intergenic
1058626311 9:106936758-106936780 CACTTTTACCAGCGAGAGCTGGG + Intronic
1059434991 9:114270716-114270738 CACCTTTTCCAGGGAGAGCCAGG + Exonic
1061022013 9:128022108-128022130 CACCCTTACCAGCTAGGAGCTGG + Intergenic
1186699258 X:12071797-12071819 CACCCTTACCAGCCAAAGGAAGG + Intergenic
1195352091 X:104005496-104005518 TACTTTTACCAGGCAGAGGCAGG - Intergenic
1197838386 X:130719411-130719433 CACGTTTCCCAGCTTGAGGCTGG + Intronic