ID: 1102990949

View in Genome Browser
Species Human (GRCh38)
Location 12:117315618-117315640
Sequence ATCCAGGTTGAACAGACTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102990949_1102990953 -6 Left 1102990949 12:117315618-117315640 CCACAAGTCTGTTCAACCTGGAT 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1102990953 12:117315635-117315657 CTGGATCCACCTGTTTGCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 159
1102990949_1102990952 -7 Left 1102990949 12:117315618-117315640 CCACAAGTCTGTTCAACCTGGAT 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1102990952 12:117315634-117315656 CCTGGATCCACCTGTTTGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 146
1102990949_1102990950 -8 Left 1102990949 12:117315618-117315640 CCACAAGTCTGTTCAACCTGGAT 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1102990950 12:117315633-117315655 ACCTGGATCCACCTGTTTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 129
1102990949_1102990957 19 Left 1102990949 12:117315618-117315640 CCACAAGTCTGTTCAACCTGGAT 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1102990957 12:117315660-117315682 GCAGGAGCAGTGTAGCATGCTGG 0: 1
1: 1
2: 4
3: 13
4: 175
1102990949_1102990955 1 Left 1102990949 12:117315618-117315640 CCACAAGTCTGTTCAACCTGGAT 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1102990955 12:117315642-117315664 CACCTGTTTGCTGGGGTTGCAGG 0: 1
1: 0
2: 1
3: 21
4: 213
1102990949_1102990958 25 Left 1102990949 12:117315618-117315640 CCACAAGTCTGTTCAACCTGGAT 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1102990958 12:117315666-117315688 GCAGTGTAGCATGCTGGTTAAGG 0: 1
1: 0
2: 5
3: 25
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102990949 Original CRISPR ATCCAGGTTGAACAGACTTG TGG (reversed) Intronic