ID: 1102994989

View in Genome Browser
Species Human (GRCh38)
Location 12:117342287-117342309
Sequence CTCAAGCTTACAACCTAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102994989 Original CRISPR CTCAAGCTTACAACCTAGGG TGG Intronic
900544521 1:3221023-3221045 GTCATGTTTACAACCCAGGGTGG + Intronic
903853760 1:26323479-26323501 CTGAAGCTTACATCCTAGTGGGG - Intronic
904981499 1:34506650-34506672 CTCAGACTTACAATCTAGTGGGG + Intergenic
907676656 1:56523952-56523974 CTCAAGGTTACAGTCTAGGGAGG - Intronic
911402034 1:97387443-97387465 CTGAAGCTTACATTTTAGGGAGG + Intronic
911449651 1:98046584-98046606 CTCAATCATACCACCTAGAGTGG - Intergenic
916203308 1:162292251-162292273 CTAAAGCTAACAAACTATGGGGG - Intronic
917366731 1:174239640-174239662 CACAAGCTTATAATCTAGTGAGG - Intronic
918316362 1:183325947-183325969 CACGAGTTTACAACCTGGGGAGG + Intronic
922637238 1:227186270-227186292 CTCATGCTTCCAACAGAGGGAGG + Intronic
1064656710 10:17563372-17563394 ATCAAGCGAACAACCTAGAGAGG - Intergenic
1064995489 10:21293342-21293364 CTTAAGCTTCCTACCTAGAGAGG + Intergenic
1073311928 10:102549114-102549136 CACAAGGGTACAACCTTGGGTGG - Intronic
1073352553 10:102830392-102830414 CTGAAGCTTACATTCTAGTGAGG - Intergenic
1073799513 10:107026039-107026061 CTCAATCCTGCAACCTATGGTGG - Intronic
1074263035 10:111873051-111873073 CTCAAGCTCAGAAGCTAGTGTGG + Intergenic
1086236502 11:84637449-84637471 CTCTAGGTTAGAACCTATGGGGG - Intronic
1087287284 11:96278556-96278578 CTCAAGCTGGCAAATTAGGGAGG + Intronic
1090316247 11:125791427-125791449 CTGAGGCATATAACCTAGGGTGG + Exonic
1096167827 12:49438932-49438954 CTCAAGTTTACATCCTATTGAGG + Intronic
1097217996 12:57429464-57429486 CTCAAGCCTACCACTTTGGGAGG + Intronic
1097344999 12:58481394-58481416 CTAAAGCTTGTAACCTTGGGAGG + Intergenic
1101605192 12:106243104-106243126 CTCAAGGTTACACCCTAGGGTGG + Intronic
1102994989 12:117342287-117342309 CTCAAGCTTACAACCTAGGGTGG + Intronic
1107010699 13:35667800-35667822 TTAAAGCTTAGAACCTCGGGAGG + Intronic
1120768506 14:88353912-88353934 CTCAAGCTTACAAACTATTTGGG + Intergenic
1127630329 15:60821601-60821623 ATAGAGCTTACAACCTAGGCAGG - Intronic
1128061744 15:64739695-64739717 CCCCAGCTTACAAACCAGGGAGG + Intergenic
1129442322 15:75590597-75590619 CTGAAGCTTACAATCTAGTAAGG - Intergenic
1141639206 16:85331881-85331903 CTCAAGCTTCCAAACATGGGAGG - Intergenic
1161612330 19:5250399-5250421 CTCAAGCTTGCAGCCGGGGGTGG - Intronic
929042982 2:37763588-37763610 ATGGAGCTTACAACCTAGGGTGG + Intergenic
945532748 2:210976497-210976519 ATGAAGCTTACATCCTAGTGAGG + Intergenic
1169772033 20:9211531-9211553 CCCAAGTTTAGAACCTAGTGGGG - Intronic
1169866197 20:10202652-10202674 ATCAAGCTTACAACATAGGGTGG - Intergenic
1172794794 20:37529172-37529194 CTCAAGGCTAAAACCTAGCGAGG - Intergenic
1177521570 21:22234398-22234420 CTGGAGTTTATAACCTAGGGTGG + Intergenic
1182701820 22:32246376-32246398 CTCAAGTTTACAGTCTAGGCAGG - Intronic
1184627591 22:45749166-45749188 TTCACGCTTAAAGCCTAGGGAGG - Intronic
953192879 3:40705031-40705053 CTCAAGCTTGCAGCCTATTGTGG + Intergenic
953700684 3:45193344-45193366 CTGAAGCTTCCAACCTTAGGTGG - Intergenic
955590685 3:60531646-60531668 CACAAGATTACAACCTACTGAGG + Intronic
961836851 3:129668842-129668864 CTCAAGCTTCTGACCTTGGGTGG + Intronic
962966845 3:140363737-140363759 CTCAAGCTTAAAATCTTGGATGG - Intronic
963220344 3:142803060-142803082 ATGAAGCTTACATTCTAGGGAGG + Intronic
963458049 3:145572515-145572537 CTCAAGCTTACATTCTAATGGGG + Intergenic
969858415 4:10018080-10018102 CTAAACCTTACAGCCTAGGTAGG + Intronic
970121514 4:12758306-12758328 ATCATGCTTACAATGTAGGGAGG + Intergenic
971093579 4:23372874-23372896 CTCAAGATTACAAACTGGGCCGG + Intergenic
974216980 4:58860812-58860834 CTTAACCTTACAACCTGAGGAGG + Intergenic
983275722 4:165615061-165615083 CACAATCTCACAACCTAGGGAGG + Intergenic
986306408 5:6520065-6520087 CTCAAGCTTCCCAGCCAGGGAGG + Intergenic
988090025 5:26526262-26526284 CTCAATCTTATTATCTAGGGAGG + Intergenic
988919003 5:35923360-35923382 CACATGCTTACTACCTAGTGGGG - Intronic
990197200 5:53331621-53331643 ATGAAGCTTACAACCCAGAGAGG - Intergenic
1000369371 5:160520095-160520117 CTCAAGCCTACTAGCTGGGGTGG - Intergenic
1006080237 6:31560873-31560895 TTCAAGCTTACAATCTAGTGGGG + Intergenic
1008835902 6:55829203-55829225 ATCAAGCTTACAATCTACCGGGG - Intronic
1009313433 6:62187440-62187462 TTCAATCTTACAGTCTAGGGAGG + Intronic
1010276054 6:73969718-73969740 CTCAGATTTACAACCTAGTGAGG - Intergenic
1011326774 6:86157044-86157066 ATGAAGCTTACATTCTAGGGGGG - Intergenic
1012671878 6:102061570-102061592 CTCATGCTTACTATCTAGGAAGG - Intronic
1013679903 6:112513585-112513607 GTCAAGCTTATATCCTAGTGGGG + Intergenic
1015888750 6:137947453-137947475 ATAAAACTTACAACCTAGTGGGG - Intergenic
1017713074 6:157187185-157187207 CTCCAGCTTACAGGCTGGGGAGG - Intronic
1023395038 7:39744611-39744633 CTAAAGCTTTCAACCCAGTGTGG + Intergenic
1027054605 7:75041344-75041366 GTGAAGCTTACATTCTAGGGAGG - Intronic
1036667718 8:10758501-10758523 ATCAAGCTTTCAAGCTAGGTGGG + Intronic
1039879812 8:41618077-41618099 CTCACGCTGACAGCCTTGGGAGG - Intronic
1042551904 8:70001605-70001627 CTCAAACTTCCAACCTCAGGTGG - Intergenic
1053369442 9:37548412-37548434 CTGAAGCATACAATCCAGGGAGG - Intronic
1058561875 9:106238960-106238982 CTCAATCTTACTACCTTGAGGGG - Intergenic
1059896789 9:118875518-118875540 CTCAATCTGACAACCAAGAGTGG - Intergenic
1060641708 9:125244401-125244423 CTCAAGATGACAACCTATAGAGG - Intergenic
1060732312 9:126046547-126046569 CTCCTGCTTAGAACCTAGGTTGG - Intergenic
1185943756 X:4351576-4351598 CTTGACCTTACAACCTAGGTGGG - Intergenic
1188247555 X:27853958-27853980 CTCAACCTCACAACAGAGGGTGG + Intergenic
1190885636 X:54529371-54529393 CTCAAGCCTAAACCCTGGGGTGG - Intergenic
1200002286 X:153068292-153068314 CTCTAGCTTGCCACCTGGGGAGG + Intergenic
1200005445 X:153081733-153081755 CTCTAGCTTGCCACCTGGGGAGG - Intergenic
1200155124 X:153971130-153971152 CTCCCGCTTACAAGCTCGGGCGG + Exonic
1201311149 Y:12598958-12598980 CCCAAGCTCACATGCTAGGGTGG + Intergenic