ID: 1102998434

View in Genome Browser
Species Human (GRCh38)
Location 12:117366953-117366975
Sequence GGAAACTCCTTGGCATCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102998429_1102998434 12 Left 1102998429 12:117366918-117366940 CCTGGCACTTCCACTAATGTGCA 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1102998434 12:117366953-117366975 GGAAACTCCTTGGCATCTCTGGG 0: 1
1: 0
2: 1
3: 18
4: 203
1102998430_1102998434 2 Left 1102998430 12:117366928-117366950 CCACTAATGTGCAATGTGAGCTC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1102998434 12:117366953-117366975 GGAAACTCCTTGGCATCTCTGGG 0: 1
1: 0
2: 1
3: 18
4: 203
1102998427_1102998434 25 Left 1102998427 12:117366905-117366927 CCTGCTTTCCAGACCTGGCACTT 0: 1
1: 0
2: 1
3: 19
4: 193
Right 1102998434 12:117366953-117366975 GGAAACTCCTTGGCATCTCTGGG 0: 1
1: 0
2: 1
3: 18
4: 203
1102998428_1102998434 17 Left 1102998428 12:117366913-117366935 CCAGACCTGGCACTTCCACTAAT 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1102998434 12:117366953-117366975 GGAAACTCCTTGGCATCTCTGGG 0: 1
1: 0
2: 1
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102998434 Original CRISPR GGAAACTCCTTGGCATCTCT GGG Intronic
902377898 1:16038684-16038706 GCAGCCTCCTGGGCATCTCTGGG - Intergenic
902830093 1:19006963-19006985 GGAAATTGCTTTGCCTCTCTGGG - Intergenic
903418409 1:23200826-23200848 GGAAGCTCCTTGGTATGTCTGGG - Intergenic
909765259 1:79347788-79347810 GAAAACTCTTTAGCAGCTCTCGG + Intergenic
910227831 1:84954562-84954584 GGAAGTTTCTTGGCCTCTCTGGG - Intronic
911121331 1:94300067-94300089 GGAAAGGCTTAGGCATCTCTTGG + Intergenic
911164872 1:94715503-94715525 GGAAACTTCCTGGCATGTCTGGG + Intergenic
911787016 1:101963637-101963659 TGAAACTTGTTTGCATCTCTTGG - Intronic
913314954 1:117541721-117541743 GAATACTCCTTGGCCTCTCCAGG + Intergenic
913446285 1:118954187-118954209 GGAAACTCCTTAGCTTTCCTTGG - Intronic
915583705 1:156831677-156831699 GGAGCCTCCTTGGGTTCTCTAGG - Intronic
916488669 1:165281895-165281917 GAAAACTCATTGCCATCTCTGGG - Intronic
917505625 1:175624545-175624567 AGACACTCCTTAGCATTTCTTGG - Intronic
921527908 1:216240993-216241015 GGACTCTCTTTGGCATTTCTAGG - Intronic
921825201 1:219664639-219664661 GTAAACCCCTGGGCACCTCTTGG - Intergenic
921953268 1:220955754-220955776 GGACCCTCCCTGGAATCTCTGGG + Intergenic
923453845 1:234145134-234145156 GGAAATTCCTTGGAACCTCAGGG + Intronic
1062912301 10:1219332-1219354 GGAAATTACTTGGGATCTTTAGG - Intronic
1063754796 10:8995356-8995378 TGAAACTCCTTGGCTCCTCCTGG + Intergenic
1063846287 10:10130876-10130898 GGAGATTTATTGGCATCTCTTGG + Intergenic
1064299284 10:14108447-14108469 TTAAACTCTTTGGCATATCTGGG + Intronic
1065634359 10:27715502-27715524 GGAGAGTCCTTGGCTTCTCCAGG - Intronic
1068989362 10:63134574-63134596 GCAAACTACTTGGCTTCACTCGG + Intronic
1070535525 10:77374569-77374591 GGCAAGGCCTTGGCATCTTTGGG + Intronic
1073358704 10:102878909-102878931 GTAAATAACTTGGCATCTCTTGG - Exonic
1074232761 10:111554250-111554272 AGAAGCTCCTTGGCATGTATAGG - Intergenic
1074360483 10:112821265-112821287 GGAAAAGCCCTGGCAGCTCTCGG - Intergenic
1074460590 10:113633272-113633294 GGAAACTCCTTCTCAACTATGGG - Intronic
1075616183 10:123892025-123892047 TGAAACTCATTAGCGTCTCTGGG - Intronic
1075940251 10:126385422-126385444 CTAAAATCCTTGGAATCTCTGGG - Intronic
1076544627 10:131237023-131237045 GGAAAGTCCTAGGAATCCCTAGG + Intronic
1083626617 11:64075095-64075117 GGAAGCACCTTGGTCTCTCTGGG + Intronic
1084473934 11:69378195-69378217 GCAAACCCCCTGGCATCTCCAGG - Intergenic
1084620017 11:70263382-70263404 GTAAGCTGCTTGGCCTCTCTGGG - Intergenic
1085787706 11:79469630-79469652 GGCAAATCTTTGGCTTCTCTGGG - Intergenic
1086120166 11:83297509-83297531 GGATACGCTTTGTCATCTCTGGG - Intergenic
1086531156 11:87786764-87786786 AGATTCTTCTTGGCATCTCTGGG + Intergenic
1086566762 11:88236044-88236066 GGCAAATCATTGGCATCTATAGG + Intergenic
1088445076 11:109917448-109917470 GGAATCTGCTTGCCATCACTTGG - Intergenic
1090564992 11:127980349-127980371 CCAAACTCCTTGTCATATCTGGG + Intergenic
1091691950 12:2603312-2603334 GGAATGGCCTTTGCATCTCTTGG + Intronic
1091701228 12:2664766-2664788 GGGCCCTCCTTGGCATCTGTAGG + Intronic
1094612421 12:32007084-32007106 GGCAGCCCCTTGGCAGCTCTGGG - Intergenic
1095123708 12:38449137-38449159 AGAAACTGCTTGGTCTCTCTGGG - Intergenic
1095885472 12:47184406-47184428 GGAAGCTACTTGGCATCACCTGG - Intronic
1097647333 12:62252238-62252260 GGAATGTATTTGGCATCTCTTGG - Intronic
1098198936 12:68034542-68034564 GTAATCTCCTTGGCATATCTGGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101778796 12:107817365-107817387 GCACACTCTTTGCCATCTCTAGG + Intergenic
1102707747 12:114896609-114896631 GGAACCTCATTGACATCACTGGG - Intergenic
1102998434 12:117366953-117366975 GGAAACTCCTTGGCATCTCTGGG + Intronic
1103577353 12:121888317-121888339 GGTCACTACTTGGCTTCTCTGGG - Intergenic
1112709059 13:102105505-102105527 GGAAATTCGGAGGCATCTCTGGG + Intronic
1113508134 13:110831138-110831160 GGAAACTGTCTGGCATCTCAGGG - Intergenic
1117024302 14:51604654-51604676 GGATGCTCCTTGGCATCTGGTGG - Intronic
1117250706 14:53934649-53934671 TGAGAATCCCTGGCATCTCTGGG - Intergenic
1117789784 14:59328126-59328148 GGAAATGCTTAGGCATCTCTGGG - Intronic
1119331203 14:73795357-73795379 GCAAACTGCATGGCATTTCTGGG + Intergenic
1120663496 14:87278637-87278659 TGAAGCTCCCTGGCCTCTCTGGG + Intergenic
1121787533 14:96673650-96673672 GGAAATCTCTTGGCCTCTCTGGG + Intergenic
1123181088 14:106470756-106470778 GGAAACACCTGGGAATCTCAGGG + Intergenic
1123189739 14:106557433-106557455 GGAAACTCCTGGGAATCTCACGG + Intergenic
1123201257 14:106666570-106666592 GGAAACACCTGGGCATCCCAGGG + Intergenic
1202945820 14_KI270726v1_random:26025-26047 GGAAACACCTGGGAATCTCAGGG - Intergenic
1123401169 15:19988153-19988175 GGAAACACCTGGGAATCTCATGG + Intergenic
1128978382 15:72169278-72169300 GGAAGCTCCTCAGCATCTCTGGG - Intronic
1129388572 15:75209057-75209079 GGAAACTCCTCGGCCTCCCCTGG + Intronic
1130834733 15:87638794-87638816 GGGAACTCCGAGGCATTTCTAGG - Intergenic
1134016702 16:10893407-10893429 GGAAGCTGCTTGTCTTCTCTGGG + Intronic
1135853463 16:25985421-25985443 GCAAGCTGCTTTGCATCTCTGGG - Intronic
1137047763 16:35684739-35684761 GGAGACTCCTTGGCAACCCCAGG - Intergenic
1138495519 16:57406666-57406688 GGAATCGCCTTGTCATCCCTGGG - Intronic
1144828126 17:18117951-18117973 GGAAAGTCCTTGTCCTCTCTGGG - Intronic
1147635587 17:41961968-41961990 GAAAACTCCTGGGCATCTTTTGG - Intronic
1147646148 17:42035291-42035313 GTGATCACCTTGGCATCTCTTGG + Intronic
1148813260 17:50308413-50308435 GGAAAGGACTTGGAATCTCTAGG - Intergenic
1148827516 17:50404860-50404882 GGAAAATACTGGGCATCTGTCGG - Intergenic
1150924388 17:69517310-69517332 GGGAGCTCCTAGACATCTCTTGG + Intronic
1151160391 17:72160098-72160120 GGAAACTTCTTAACTTCTCTGGG + Intergenic
1151358899 17:73576694-73576716 GGCAACCCCCTGGCCTCTCTGGG - Intronic
1152477722 17:80528995-80529017 GGAAAGTCCTTGCCTTCCCTCGG - Intergenic
1155404882 18:25476732-25476754 GGACTGTCCTAGGCATCTCTAGG + Intergenic
1155502289 18:26498966-26498988 GGAAGCTCCCTGGTATCACTTGG - Intronic
1158154567 18:54410845-54410867 GGAAAATCCTTAGCCTCTTTGGG + Intergenic
1159021126 18:63144092-63144114 GGAAACCCCTTGGCCAATCTTGG + Intronic
1159964422 18:74581450-74581472 GGAATCTCCTTGGCCTGCCTGGG - Intronic
1160498782 18:79392088-79392110 TTAAACTCCTGGGCAACTCTGGG - Intergenic
1161182015 19:2889941-2889963 GGTCACACCTTTGCATCTCTAGG + Intergenic
1164852858 19:31499342-31499364 GAAAACTCCTTCACCTCTCTGGG + Intergenic
1166789905 19:45392452-45392474 GGAAGTTCCTTGCCCTCTCTGGG + Intronic
1167277234 19:48545759-48545781 AGCAATTCCTTGGCCTCTCTTGG - Intergenic
925258853 2:2512266-2512288 GCAAAGTCCTTCACATCTCTAGG - Intergenic
926219047 2:10923008-10923030 CCAAACTCCTTGGCATCCCTTGG + Intergenic
926633066 2:15155138-15155160 AGCAAGTCCTTAGCATCTCTGGG + Intergenic
926989021 2:18657017-18657039 TGGAAATCCTTGGCATTTCTTGG + Intergenic
927260613 2:21085005-21085027 GTAAACTTCTTGGTATCTATAGG - Intergenic
927486204 2:23489913-23489935 GGAGACTCCTTGTCCACTCTAGG + Intronic
929869126 2:45743472-45743494 GAAAGCTCCTGGGCCTCTCTCGG - Intronic
930661073 2:54053613-54053635 GGCAACTCTTAGCCATCTCTGGG + Intronic
931676453 2:64701414-64701436 GGAATCTCATTGGCCTGTCTTGG - Intronic
933326219 2:80841284-80841306 GGACCCACCTTTGCATCTCTAGG + Intergenic
937913343 2:127086971-127086993 GGAAGCTGCCTGGCCTCTCTTGG + Intronic
939371754 2:141310329-141310351 ACAAAGTCCTTGACATCTCTGGG + Intronic
941748610 2:169112449-169112471 AGATTCTTCTTGGCATCTCTGGG - Intergenic
941820696 2:169841247-169841269 GGATACTGCATGGCTTCTCTTGG - Intronic
941919208 2:170832319-170832341 GGATATTCCTTGGCATTTGTTGG + Intronic
942342396 2:174961944-174961966 GTAATTTCCTTGGCATATCTAGG + Intronic
943650882 2:190456514-190456536 GGGAACTCCCTGGCTGCTCTAGG + Intronic
943707476 2:191050748-191050770 GGTACCTCTTTGGCATCTCTGGG + Intronic
944278886 2:197871656-197871678 GGGAAATCCTTGGCATTCCTTGG + Intronic
944942365 2:204642811-204642833 GGAAAGTGTTTGGCACCTCTCGG + Intronic
945485427 2:210389944-210389966 GTAAATTGCTTGACATCTCTGGG + Intergenic
945689537 2:213016264-213016286 GGAAATTACTTAACATCTCTGGG - Intronic
946080903 2:217117368-217117390 GGGAAATCCTTGGCATTCCTTGG + Intergenic
946743970 2:222827662-222827684 GAAAACTCCCAGGCATTTCTAGG - Intergenic
948120368 2:235524760-235524782 GGGAACTCATTGGCTTGTCTTGG + Intronic
948454764 2:238099853-238099875 GGAGGCTCCTAGGAATCTCTGGG - Intergenic
1171252793 20:23662328-23662350 GGAAAAACCTTAGCATCTCGGGG + Intergenic
1171263962 20:23755289-23755311 GTCATCTCCTTGACATCTCTGGG + Intergenic
1171273156 20:23832135-23832157 GTCATCTCCTTGACATCTCTGGG + Intergenic
1171284572 20:23926410-23926432 GCAATCCCCTTGGCATCTCTGGG + Intergenic
1172184544 20:33023207-33023229 GGAGAGTCCTTTGCCTCTCTGGG - Intronic
1173355037 20:42279384-42279406 GGCAAATCTTTGGCATTTCTTGG - Intronic
1174894993 20:54439045-54439067 AAACACTCCTTTGCATCTCTGGG - Intergenic
1175048690 20:56132524-56132546 GGAAAGCCATTGACATCTCTGGG - Intergenic
1179134650 21:38668753-38668775 GGGCCTTCCTTGGCATCTCTTGG - Intergenic
1180713460 22:17855822-17855844 GGAAACTCACTGGCTTCTCCAGG + Intronic
1180862047 22:19089123-19089145 GGAGCCTCCTGGGCATCTCACGG + Intronic
1181508236 22:23376122-23376144 GGAAGTTGCTTGGCCTCTCTGGG + Intergenic
1182507627 22:30796011-30796033 AGAAACCACTTGGCATATCTAGG - Intronic
1182903060 22:33914857-33914879 GAATATTTCTTGGCATCTCTGGG - Intronic
1183732298 22:39625460-39625482 AGAAGTCCCTTGGCATCTCTGGG + Intronic
1184234401 22:43175241-43175263 GGAATCTGCTCTGCATCTCTGGG + Intronic
949157403 3:846235-846257 GGGAAGTCCATGGCATCACTTGG + Intergenic
949911135 3:8908997-8909019 GGAAACCCATTGTGATCTCTAGG - Intronic
952225841 3:31374970-31374992 GTAAACTTCTAGGCATCTCATGG - Intergenic
952601208 3:35085487-35085509 GGAAGATCCTTGGCATTTCATGG - Intergenic
952902433 3:38119111-38119133 TAAAAGTCCTTGGCAGCTCTGGG + Intronic
953285853 3:41608242-41608264 TGAAAATCCTTTGCAGCTCTGGG + Intronic
954288867 3:49638435-49638457 GGAAACTGCTGGGGATCTGTCGG + Intronic
955671361 3:61406486-61406508 TGAAAATTCTTGGCATCCCTTGG + Intergenic
956467786 3:69536201-69536223 GGATCCTCCTTGGCCTCACTTGG + Intronic
957417987 3:79930175-79930197 GGAAACTCTTTGGCACCTGGAGG - Intergenic
960183525 3:114611072-114611094 AGAATATCCTTGGGATCTCTGGG + Intronic
962751933 3:138439992-138440014 GGAAGCCCCTTGTCCTCTCTGGG + Intronic
962835166 3:139183424-139183446 GCAACCTCCTTAACATCTCTTGG - Intronic
963517502 3:146326654-146326676 GGAATCACACTGGCATCTCTTGG + Intergenic
964179312 3:153864947-153864969 TGAAACTCCTAGGCAACTCCTGG + Intergenic
964296428 3:155239378-155239400 GGGAACACCTTGGCCTCTCCAGG - Intergenic
967824631 3:193868652-193868674 GGCAACTCCTGTGCATCTGTAGG - Intergenic
969498330 4:7539045-7539067 GGAAACAACTTGGCCTCTCTGGG - Intronic
969577070 4:8042420-8042442 AGATGCTCCTTGGCCTCTCTGGG - Intronic
969978799 4:11132838-11132860 TGGCACTCCTTGGCATTTCTTGG + Intergenic
970878145 4:20896566-20896588 GGGAAATCCTTGGCATTTCTTGG - Intronic
971895196 4:32583883-32583905 GGAAATTCATTGGACTCTCTTGG - Intergenic
975539541 4:75492456-75492478 GGAAGTTCCTTAGCTTCTCTAGG - Intronic
975934577 4:79562690-79562712 TGTAAATCCTTGGCATTTCTAGG - Intergenic
977051533 4:92134069-92134091 TGAAACTTCTTTGCATCTGTTGG - Intergenic
977082945 4:92556211-92556233 GGAAAATCCTTAGCTTCTATAGG - Intronic
982314730 4:154020683-154020705 AGAAAATCCTTGGCATTCCTTGG + Intergenic
983193666 4:164781705-164781727 GGAAAAACCTTGGCCTCTCCAGG - Intergenic
984689864 4:182714589-182714611 GGAAAATTCTTTGCATCTTTTGG - Intronic
984941374 4:184935163-184935185 GGATTCTTCTTGGCCTCTCTGGG - Intergenic
986612087 5:9579047-9579069 AGAAACATCTTGACATCTCTGGG - Intergenic
991210544 5:64099527-64099549 GAAAATTCCTAGACATCTCTGGG + Intergenic
991964031 5:72073425-72073447 GGAAAATGCATGGCATTTCTGGG + Intergenic
993725487 5:91362067-91362089 TGGCAATCCTTGGCATCTCTTGG - Intergenic
993981822 5:94551667-94551689 GGAAACTCATTGACATATATTGG + Intronic
993995133 5:94713421-94713443 AGAAACTCCTTTGTAACTCTAGG - Intronic
994613241 5:102072553-102072575 GCAAACTCCTACACATCTCTAGG + Intergenic
994953016 5:106489789-106489811 GGAAAGTCCATGGCTTATCTAGG + Intergenic
994967101 5:106687791-106687813 AGAAATTCCTTGGCTGCTCTTGG + Intergenic
997090394 5:130849835-130849857 GGAAGCACCTTGGCATCTTTAGG + Intergenic
998049202 5:139017291-139017313 GGAACCTCCTTGGCAGATTTTGG - Intronic
998183635 5:139962466-139962488 GGAAATGGTTTGGCATCTCTAGG + Intronic
999563974 5:152837263-152837285 GAAAACTCCTTGAGAGCTCTGGG - Intergenic
999914284 5:156240108-156240130 AGAAACTCTCTGGCAACTCTGGG - Intronic
1001772924 5:174309322-174309344 GGAAGCTACTAGGCTTCTCTGGG - Intergenic
1001970850 5:175953893-175953915 GGAATCTGCTGGGCAGCTCTTGG - Intronic
1002246588 5:177889871-177889893 GGAATCTGCTGGGCAGCTCTTGG + Intergenic
1004617685 6:17305954-17305976 GGAAACTATTTGGCTTCACTTGG + Intergenic
1005171737 6:22993737-22993759 TACAACTCCTTGGTATCTCTTGG + Intergenic
1008786814 6:55177821-55177843 GGAAACTGCTTTCCATCTTTGGG - Intronic
1009023480 6:57970367-57970389 GGAGAGTACATGGCATCTCTTGG + Intergenic
1009234085 6:61101846-61101868 GGTAACTTCTTGGGATCTCTTGG - Intergenic
1009539190 6:64929248-64929270 GGACAATCTTTGGCATCCCTTGG - Intronic
1011263595 6:85492820-85492842 AGCAGCTTCTTGGCATCTCTGGG + Intronic
1013815014 6:114087243-114087265 GGAAAGTACCTGGCATGTCTGGG - Intronic
1015798996 6:137042199-137042221 GGAAACACTTTGGCTTGTCTGGG + Intronic
1017076181 6:150620990-150621012 GGAAAACCTTTGGCCTCTCTTGG + Intronic
1018619163 6:165714157-165714179 GGAAACTCCTGGGTACCACTGGG + Intronic
1021369293 7:19821378-19821400 GGAAACATCTTTGCATCTCTGGG + Intergenic
1021612557 7:22472370-22472392 GGACACTCCTTGTCATTCCTAGG + Intronic
1022811569 7:33873673-33873695 GGAAACTCTTTGGCATGCCTTGG + Intergenic
1030843901 7:114385664-114385686 GGAAAATACTGGGCATCTGTTGG - Intronic
1034902400 7:154915600-154915622 GGAACCCCCTTGGGTTCTCTGGG - Intergenic
1035283756 7:157793646-157793668 GAAAACACGTTGGCTTCTCTGGG + Intronic
1035737721 8:1900950-1900972 GGAAACTGCTCGGCACATCTAGG - Intronic
1036903387 8:12688429-12688451 GGAAACTGCATGGCACCTCCCGG - Intergenic
1037802392 8:22042827-22042849 GGAGAGACCTTGGCTTCTCTGGG + Exonic
1040110642 8:43565826-43565848 AGAAACTCCACGGCATCCCTGGG + Intergenic
1043939558 8:86181563-86181585 GGAGACTCCTTGGCTTCTCTTGG - Intergenic
1047511647 8:125520434-125520456 GGAAAGTCCTTCCCCTCTCTGGG - Intergenic
1048441158 8:134459963-134459985 GGCCACTCCTTGGCCTCTCTGGG + Intergenic
1049152726 8:141045845-141045867 GTAATCTCATTGGCATCTCCTGG - Intergenic
1049336790 8:142090918-142090940 GGAAAGTCGCTGGCCTCTCTGGG - Intergenic
1049619822 8:143593056-143593078 GGGAGCTCCTTGGCAGCTCCAGG - Intronic
1050014777 9:1222073-1222095 TGAAACTCCTGGGCATTTCCTGG + Intergenic
1053291008 9:36879635-36879657 GGAAATTCCCTGGCTTCTCCGGG + Intronic
1054962801 9:70988099-70988121 TGAAATTCTTTGGAATCTCTTGG + Intronic
1055625542 9:78173635-78173657 GGAAAATTCTGGGCATCTCAGGG + Intergenic
1060745455 9:126127966-126127988 AGAAAGTGCTTGGCAGCTCTGGG + Intergenic
1187526964 X:20063160-20063182 GCAAACTGGTTGGCTTCTCTGGG - Intronic
1189254436 X:39626987-39627009 GTAAACTCCCTGGCACTTCTAGG - Intergenic
1189613828 X:42764796-42764818 GGAAACTCCCTCACCTCTCTGGG + Intergenic
1190562224 X:51696887-51696909 GGAACATCCTCGGCACCTCTCGG - Intergenic
1191882561 X:65857405-65857427 GGAAACACCATGGCGTCTCCTGG - Intergenic
1191980335 X:66917971-66917993 GGTAACTGCTTGGCATGCCTAGG + Intergenic
1192035521 X:67558692-67558714 TCAACCTCCTTGGGATCTCTAGG - Intronic
1192054782 X:67761886-67761908 GCAAATTCCTTAACATCTCTGGG + Intergenic
1192336133 X:70221412-70221434 GGAATCTACTTGGCATGTTTAGG + Intergenic
1196654245 X:118200354-118200376 GCAAAGTACTTGACATCTCTAGG + Intergenic
1198049036 X:132930708-132930730 GGAAAGTCCTTGGCTTCCTTAGG + Intronic