ID: 1103000653

View in Genome Browser
Species Human (GRCh38)
Location 12:117383187-117383209
Sequence CCTGAGCCTGCCCTTTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103000653 Original CRISPR CCTGAGCCTGCCCTTTTGTG GGG Intronic
900360639 1:2287210-2287232 CTGGAGACTGCCATTTTGTGTGG + Intronic
900383482 1:2397638-2397660 CCTGAGCTCTCCCTTGTGTGAGG + Intronic
901137701 1:7008501-7008523 CCTGAGCCTCCCCTCCTCTGGGG - Intronic
901534896 1:9875733-9875755 CCTGAGTGTGCCCTCTTGTTAGG - Intronic
901850697 1:12013028-12013050 CCTCAGTCTGTCCTGTTGTGTGG + Exonic
902665051 1:17931551-17931573 CCTGTGCCTGCCATTCTATGTGG + Intergenic
902744098 1:18461682-18461704 CCAGAGCCTGCCTTTGTTTGTGG + Intergenic
903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG + Intergenic
904486420 1:30827528-30827550 CATGTACCTGCCCTGTTGTGTGG + Intergenic
904768586 1:32869022-32869044 CCTGAGCATCCCCTATTGTGAGG + Intronic
905919655 1:41711029-41711051 CCTGAGTCAGCCCTTTTCTCTGG + Intronic
908252697 1:62277625-62277647 CCTGAGACTGCCATGTTGTGAGG + Intronic
910214769 1:84832176-84832198 ACTGTGACTGCCCTTTCGTGGGG - Intronic
913219056 1:116644784-116644806 CCTGAGCCTGTCCTTTTCACAGG - Intronic
916055747 1:161068128-161068150 CCTGGTACTGCCCTTTTTTGTGG - Intronic
916317596 1:163467602-163467624 CTTCAGCATCCCCTTTTGTGAGG + Intergenic
920106375 1:203556281-203556303 CCTCAGCCTGCCCTTGTGACTGG - Intergenic
920392248 1:205615134-205615156 TCTGAGCCTGCGCCTTTGGGAGG + Exonic
920431981 1:205924432-205924454 CCTCAGCCTGCCCTATGGTGTGG - Exonic
921246624 1:213250068-213250090 CCTGGGCCTGCTGTATTGTGGGG - Intronic
922425077 1:225484922-225484944 CAGCAGCCAGCCCTTTTGTGGGG + Intergenic
922722163 1:227904697-227904719 CCACAGCCAGCCCTTCTGTGGGG + Intergenic
923935136 1:238751365-238751387 CTTGAGCCTCCCATTTTGTGAGG + Intergenic
924306824 1:242698182-242698204 CCTGAGCATCCCATTTTCTGAGG - Intergenic
1063700475 10:8379757-8379779 CCTATGCTTGCCATTTTGTGGGG - Intergenic
1064034324 10:11902884-11902906 CCCGAGCCTGCCCTCTTCAGTGG + Intergenic
1065777702 10:29136979-29137001 CCTGAGATTGCCATATTGTGAGG - Intergenic
1065985442 10:30947258-30947280 GCTGAACCTGCCCTTTTCTCTGG + Intronic
1066662636 10:37751950-37751972 CCTGATCCTGCCCCTTTGCAAGG - Intergenic
1067247612 10:44559538-44559560 CCTGAGCCAGCCTTAGTGTGAGG + Intergenic
1068596699 10:58909760-58909782 CCTGAGACTGCCATTCTATGAGG + Intergenic
1068913141 10:62400128-62400150 CCTAGGCCTGACATTTTGTGTGG - Intronic
1070670763 10:78375743-78375765 CCTGTCACTGCCCTTCTGTGTGG + Intergenic
1070759974 10:79018074-79018096 CCTGAAGCTGCCATGTTGTGAGG - Intergenic
1072033221 10:91540876-91540898 CCTGAGGCTGCCATGTTATGAGG + Intergenic
1074403577 10:113162269-113162291 CCTGAACCGGCCTTATTGTGAGG - Intronic
1075023005 10:118965138-118965160 CCTGAGCCTGTCCCCTTGTGGGG - Intergenic
1075200965 10:120403542-120403564 CCTGACCCTCCCCCTTTGTATGG - Intergenic
1075485980 10:122822357-122822379 GCTGAGCCTGCCCTGGGGTGGGG + Intergenic
1076402304 10:130192299-130192321 CCAGAGCCTGCCCCTGTGTCAGG + Intergenic
1076575256 10:131461582-131461604 TCTGAGCCAGCCCTGTTGTGGGG + Intergenic
1076616682 10:131759690-131759712 CTAGAGCCTCCCCGTTTGTGAGG - Intergenic
1076617927 10:131769037-131769059 CCTCAGCCTTACCTTGTGTGGGG - Intergenic
1076772911 10:132676834-132676856 CTTGACCCTGCCCTTTTCTCTGG + Intronic
1076818592 10:132926903-132926925 CCTGAGTTTGCCCTTTTCAGGGG + Intronic
1079159424 11:17978348-17978370 CCTGGGCCTGCCCATCTGTGGGG + Intronic
1079207105 11:18425533-18425555 ACTGTGCTTGGCCTTTTGTGTGG + Intronic
1080856349 11:36115081-36115103 CCTGAGACTGCCATATTGTGAGG + Intronic
1083628917 11:64085914-64085936 CCTGAGCCTCCCCTTCTGTGGGG - Intronic
1083704617 11:64505473-64505495 CCTGAGACTGCACCTTTGTGTGG - Intergenic
1083944593 11:65916998-65917020 CCTGAGCATGCCATTTTGAGGGG - Exonic
1085341669 11:75735421-75735443 GCTGACTCTGCCCTTCTGTGAGG - Intergenic
1085786400 11:79455114-79455136 CCTGAGGCTTCCCATTTCTGAGG + Intergenic
1086412913 11:86559848-86559870 CCTGAGTATGCACTTATGTGTGG - Intronic
1088756501 11:112889679-112889701 CCTGAGCCTGGGCTTTCCTGAGG + Intergenic
1089441992 11:118525166-118525188 CCTCAATCTGCACTTTTGTGCGG - Exonic
1089731419 11:120521612-120521634 CCTGTGCCTTCCAGTTTGTGCGG + Intronic
1090367265 11:126217129-126217151 GCTGAGGCTACCCGTTTGTGTGG - Intronic
1091636121 12:2198163-2198185 CCTGAGGATGCCCTTTGCTGTGG - Intronic
1093568064 12:20632572-20632594 CCTGTGCCAGGCCATTTGTGGGG + Intronic
1096101382 12:48972278-48972300 CCTGCGCCTGCCCCTTTGGAGGG + Intergenic
1096518633 12:52171832-52171854 CCTGGGGTTGCCCTGTTGTGTGG + Intronic
1099091546 12:78316403-78316425 CCTGAGCTTGTCCCTTTGGGAGG + Intergenic
1100930882 12:99608373-99608395 CCTGAGGCTTCTCTTATGTGAGG + Intronic
1102186712 12:110954034-110954056 CCTGAGACTGCCATGTTGTGAGG - Intergenic
1102496894 12:113325896-113325918 CCTGAGCCTGGCCTGTAGTAGGG + Intronic
1102638123 12:114342358-114342380 ACTGAGGCTGCCCTTTTCAGAGG - Intergenic
1102653868 12:114463490-114463512 CCTGAGGCTGCCATATTGTGAGG + Intergenic
1102659513 12:114513719-114513741 CCTGAGACTGCCCTATGGTCAGG + Intergenic
1103000653 12:117383187-117383209 CCTGAGCCTGCCCTTTTGTGGGG + Intronic
1103014332 12:117482126-117482148 CCTGAGACTGCCATGGTGTGAGG + Intronic
1103023110 12:117552521-117552543 CCTGAGGCAGCCATATTGTGAGG + Intronic
1103471593 12:121186090-121186112 CCTGAGACTGCCCTGCTGTGAGG + Exonic
1104356217 12:128089390-128089412 CCTGTGCCTGGCCAATTGTGTGG - Intergenic
1104442728 12:128807549-128807571 GCTGAGCCTGCGCTTTGGGGAGG + Intronic
1106901980 13:34363317-34363339 CAGGAGCCTGGCGTTTTGTGTGG - Intergenic
1110674886 13:78230289-78230311 CATGGTTCTGCCCTTTTGTGGGG + Intergenic
1112008838 13:95277289-95277311 ACTGTGCCTGGCCTTCTGTGTGG - Intronic
1113207116 13:107929852-107929874 CCTGAGCCTGCCATGCTGCGAGG - Intergenic
1114469813 14:22952540-22952562 CCTGAGCCTGCTCCTTTGCTAGG + Exonic
1114776272 14:25485640-25485662 TCTGAGCCTGCACTTTTAAGAGG - Intergenic
1115755178 14:36521679-36521701 CCTGCGCCCGCGTTTTTGTGCGG + Intergenic
1116322567 14:43489379-43489401 CCTGGGCCTGTCCTGGTGTGGGG + Intergenic
1118996377 14:70840320-70840342 CCTGGCACTGCCCTTGTGTGTGG - Intergenic
1120360478 14:83494524-83494546 CCTGTGACTGCATTTTTGTGAGG + Intergenic
1121402144 14:93689318-93689340 TTTGAGCCCACCCTTTTGTGTGG + Intronic
1122941087 14:104981721-104981743 CCGCAGCCTGCCTGTTTGTGGGG - Intergenic
1125727045 15:41873460-41873482 CCTGAGCCTCCCCTGCAGTGTGG - Intronic
1126574231 15:50182168-50182190 GCTGAGCCCGCCCCCTTGTGGGG - Intronic
1127304684 15:57693499-57693521 CCTCAGCATGCCCTTCTGTGAGG - Intronic
1128311502 15:66633972-66633994 CCTGAGCCTGCCTGTCTGTGAGG - Intronic
1128532204 15:68462065-68462087 CCAGAGCCTGCACCTTGGTGTGG + Intergenic
1128769913 15:70274305-70274327 CCTCAGTTTACCCTTTTGTGAGG + Intergenic
1129057870 15:72834940-72834962 GCTGAGCCCACCTTTTTGTGAGG + Intergenic
1129775351 15:78233095-78233117 CCTGAATCTGCCCTTGGGTGAGG + Intronic
1133106237 16:3511580-3511602 CCTCAGGCTGTCCCTTTGTGTGG + Intronic
1134828844 16:17307048-17307070 TATGAGCCTGCAGTTTTGTGGGG + Intronic
1135078298 16:19412666-19412688 CCCGAGCCCACCCTTTTGTGGGG + Intronic
1136188511 16:28601725-28601747 CCTGGGCCCTGCCTTTTGTGTGG + Intergenic
1136190979 16:28614719-28614741 CCTGGGCCCTGCCTTTTGTGTGG + Intronic
1137693290 16:50444763-50444785 CCTGAGGCTGCCATACTGTGAGG + Intergenic
1137710221 16:50561621-50561643 CCTGAGACTGCCATACTGTGAGG - Intronic
1138496352 16:57411635-57411657 CTTCTGCCTGCCCTCTTGTGGGG - Intronic
1138593884 16:58018986-58019008 CCTCAGCCTGGCCTGGTGTGTGG + Exonic
1140479173 16:75253311-75253333 CCTGGGCCTCCACTTCTGTGGGG + Intronic
1141745804 16:85925574-85925596 CCTGACGCTGCCATATTGTGAGG - Intergenic
1142232864 16:88907878-88907900 CCTGAGTCTGCCCTGATGTTGGG + Intronic
1143187489 17:5019433-5019455 ACTGAGCCTGCCAGTTTCTGGGG - Intronic
1143435063 17:6918260-6918282 ACTGACCCTGCTCTTTTGTCTGG + Intronic
1147310214 17:39591595-39591617 CCAGGGCCTGCCCTTTGCTGGGG + Intergenic
1147646735 17:42038777-42038799 CCTGAGGCTGCCTATTGGTGAGG + Intronic
1148325708 17:46782386-46782408 CCTGGCCCTGGCCTGTTGTGGGG - Intronic
1151320463 17:73349493-73349515 CCTGACCCTCCCCTGATGTGTGG - Intronic
1151365906 17:73616357-73616379 CCTGAGCCTGCATGTGTGTGTGG - Intronic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1158108326 18:53910643-53910665 CCTGCTACAGCCCTTTTGTGTGG - Intergenic
1158423036 18:57312994-57313016 CCTGAGTCTGTCCCTCTGTGTGG - Intergenic
1159966810 18:74602955-74602977 CCTGAGCATGCCCAGGTGTGTGG + Intronic
1160992985 19:1868239-1868261 CCTGTCCCTGCCCTGTTCTGCGG - Intergenic
1161281604 19:3448712-3448734 CCTGAGCCTTCCCATTTCTCTGG + Intronic
1161333578 19:3699626-3699648 GCTGGGCCTTCCCTTCTGTGGGG - Intronic
1161402776 19:4075753-4075775 CTTGAGCCTGCCCTTTTTAAAGG - Intergenic
1162503379 19:11067513-11067535 CTGGAGCCTGCCATTTTGTGAGG + Intergenic
1163144562 19:15371866-15371888 GCTGCTCCTGCCCCTTTGTGAGG + Intronic
1163645594 19:18487267-18487289 ACTGGGCCTGCCCATTTGAGGGG - Intronic
1163691940 19:18743042-18743064 CCTGGCCCTGCCCCATTGTGGGG + Intronic
1163710238 19:18842346-18842368 CATGAGCCAGCTGTTTTGTGGGG + Intronic
1164578506 19:29419755-29419777 GCTGAACCTGCCCTGCTGTGTGG + Intergenic
1165090849 19:33387755-33387777 GCTTAGCCTGCCCCTTCGTGTGG - Intronic
1166259007 19:41625242-41625264 CCTGAGGCTGGGCTTTTGTGAGG + Intronic
1168428602 19:56258905-56258927 CCAGAGGCTGCCATGTTGTGAGG + Intronic
926393962 2:12422952-12422974 CCAATGCCTGCCCTTCTGTGAGG - Intergenic
927419927 2:22919893-22919915 CCTGAGGCTGCCATGTTGTGAGG - Intergenic
929933663 2:46277627-46277649 CCCGAGCCTGCCATTTTCTGTGG - Intergenic
930764419 2:55070267-55070289 ACTGTGCCTGGCCTTTTGTTTGG - Intronic
932126321 2:69148305-69148327 CTTGTGCTTGCCTTTTTGTGCGG + Intronic
932482423 2:72053622-72053644 CCTGAGGCCGCCGTGTTGTGAGG + Intergenic
932639998 2:73435705-73435727 CCTCAGCCTCCTCTGTTGTGAGG + Intronic
934527114 2:95058804-95058826 CCTGAGCCAGCCCAAGTGTGTGG + Intergenic
936456594 2:112679643-112679665 CCTGAGACTGCTGTGTTGTGAGG + Intergenic
936613897 2:114028976-114028998 CCTGAGGCTGCCATGTTGTGAGG - Intergenic
937652864 2:124339864-124339886 CCTGAGTCTGCCTCTGTGTGGGG + Intronic
939461243 2:142498367-142498389 CCTGAGCCATCCCTTTTCTCAGG + Intergenic
941759703 2:169228484-169228506 TCTGATCCTGCCCTTTTGAATGG + Intronic
946789206 2:223283533-223283555 CCTGGGGCTGCCATTTTGTAAGG + Intergenic
947965812 2:234280676-234280698 CCTGAGGCTGCCATACTGTGAGG + Intergenic
948588001 2:239033015-239033037 TCTGAGCCTGGGCTTTTTTGTGG + Intergenic
948676781 2:239601504-239601526 CCTGCAGGTGCCCTTTTGTGAGG + Intergenic
1168840530 20:907252-907274 CCTGAGCCTCACCTTTCATGGGG + Intronic
1169905052 20:10594282-10594304 CCTGAGCCTGCCTTGTAGTTTGG + Intronic
1170419616 20:16179877-16179899 CCTAAGGCTGCCATGTTGTGAGG - Intergenic
1170709888 20:18781140-18781162 CCTGAGACTGCCATGCTGTGAGG - Intergenic
1172502759 20:35438621-35438643 CCTGAGTCTGCCCTGTGGAGGGG - Intronic
1172750127 20:37244960-37244982 CCTGGGCCTGGCCTTCTCTGAGG + Intergenic
1173749209 20:45463343-45463365 CCTGAGACTGCCTTGTTGTAAGG - Intergenic
1173932422 20:46831962-46831984 CCTGAGGCTTCCATGTTGTGAGG - Intergenic
1174406624 20:50307025-50307047 CCTGAGCCTGCCCTCAGCTGCGG - Intergenic
1176377046 21:6091957-6091979 CCTGGGCCTGCCTTTGGGTGTGG - Intergenic
1178327026 21:31654457-31654479 CCTGAGCCTCCCCCTCTCTGTGG + Intergenic
1179746429 21:43446287-43446309 CCTGGGCCTGCCTTTGGGTGTGG + Intergenic
1179802875 21:43819737-43819759 CCTGAGCCGGCCTTCCTGTGTGG + Intergenic
1180820346 22:18822840-18822862 CCTGAGCCTGTCCTTTTCACAGG - Intergenic
1181206571 22:21257312-21257334 CCTGAGCCTGTCCTTTTCACAGG - Intergenic
1181494630 22:23281044-23281066 CCTGAGCGTGCCCTCGTGCGTGG - Intronic
1181603220 22:23964672-23964694 CTTGACCCTGACCTTCTGTGTGG + Intergenic
1181605294 22:23976635-23976657 CTTGACCCTGACCTTCTGTGTGG - Intronic
1182151103 22:28027792-28027814 CCTGTCCCTGCCCTGCTGTGGGG - Intronic
1183250070 22:36724200-36724222 ACTGTGCCTGGCCTTTTTTGTGG - Intergenic
1183459817 22:37943003-37943025 CCTGAGCCGGCCCTTGATTGGGG + Intergenic
1183530896 22:38352728-38352750 CCTGGGCCTGGACTTTTCTGTGG + Intronic
1183947557 22:41335279-41335301 CCGGTACCTGCCATTTTGTGGGG + Intronic
1184007260 22:41719485-41719507 CCTGAACTTGTCCTTTTATGAGG + Intronic
1184519384 22:44983557-44983579 CCCTCGCCTGCCCTTTGGTGTGG - Intronic
1184893467 22:47393436-47393458 CCTGAGACTGCCGTGCTGTGAGG - Intergenic
1185130501 22:49036008-49036030 CCTGAGCCTGGCCCTGTGTGAGG - Intergenic
1203220349 22_KI270731v1_random:38111-38133 CCTGAGCCTGTCCTTTTCACAGG + Intergenic
1203270476 22_KI270734v1_random:48715-48737 CCTGAGCCTGTCCTTTTCACAGG - Intergenic
950269739 3:11604443-11604465 CCTGTCCCTGACCTTATGTGCGG - Intronic
951557874 3:23938857-23938879 CCTGAGGCTGCCATGTTGTGAGG + Intronic
953946523 3:47153456-47153478 CCTGTGCCTGGCCTTAAGTGGGG - Intronic
957792470 3:84958960-84958982 TCTGAGCTTGCCCTTGTGTCTGG + Intronic
957996468 3:87696327-87696349 CCTCAGCTTGACCTTTGGTGTGG - Intergenic
958896764 3:99838250-99838272 CCCGTGCCTGCCCATTTGTGTGG + Intronic
962898945 3:139740344-139740366 CAGGAGCCTGGACTTTTGTGTGG - Intergenic
962964721 3:140342852-140342874 CCTGAGGCTGCCATGTTCTGTGG - Intronic
963672547 3:148270128-148270150 CCTGAGACTGCCATACTGTGAGG - Intergenic
963841094 3:150107217-150107239 CCTGGGCCTGCCATTTGGTGGGG - Intergenic
967288696 3:187898492-187898514 CCTGAGGCTGCCATGCTGTGAGG + Intergenic
969319868 4:6405247-6405269 CCTGAGCCAGCTCTGCTGTGCGG - Intronic
970074341 4:12200576-12200598 CCTGATCTTTCCCTTTTGTTAGG + Intergenic
970313182 4:14804256-14804278 CCTCAGCCTGCCTCTTGGTGTGG - Intergenic
971161649 4:24139694-24139716 CCTGTGCGTGCCCTTGTATGAGG + Intergenic
973308621 4:48682007-48682029 CCTTTGCCTGCCCTCTTGTGGGG + Intronic
978866879 4:113523654-113523676 CCTTAGCCTCCCCTGTAGTGGGG - Intronic
979854338 4:125612412-125612434 CCTTAGTCACCCCTTTTGTGAGG - Intergenic
982916327 4:161214214-161214236 TCTGAGCCTGCACATTTGAGAGG + Intergenic
983430561 4:167644856-167644878 CCTGGGCCTGTCCTCTGGTGGGG + Intergenic
983642709 4:169958006-169958028 CCTGAGGCTGCCATGCTGTGAGG - Intergenic
984706607 4:182851737-182851759 CCTCAGCTCCCCCTTTTGTGAGG + Intergenic
984835548 4:184016592-184016614 CTTGAGCATGCCCTTTTTTGGGG - Intronic
985622577 5:963188-963210 CCTGTGTCTGCCCTTGTCTGGGG - Intergenic
989435413 5:41407111-41407133 CCTAAGCATGGCCCTTTGTGTGG + Intronic
990901035 5:60749145-60749167 CCTGAGACTGCCATGCTGTGAGG + Intergenic
993252646 5:85548848-85548870 ACTTAGCATGCCCTTTTGTGTGG + Intergenic
994506375 5:100647515-100647537 CTTGGACCAGCCCTTTTGTGTGG - Intergenic
995062014 5:107821464-107821486 CCTTAGCCTGCCCTTTCACGTGG + Intergenic
995558725 5:113357810-113357832 CCTGAGTCTTCCCTTTGGTTGGG - Intronic
998396654 5:141823022-141823044 GCTGAGCCTGCCCTTGTGTCTGG + Intergenic
998989165 5:147796008-147796030 CCTGTGCCTCCACTTTTATGTGG + Intergenic
1002016554 5:176328462-176328484 CCTGAGTATGCCTTTTTGTGTGG + Intronic
1003411392 6:5865912-5865934 CCTAAGTCTGCCATGTTGTGAGG + Intergenic
1004027258 6:11831420-11831442 CCACAGCCTGCCCGTCTGTGTGG - Intergenic
1004678234 6:17865373-17865395 CCTGGGCCTACTCATTTGTGAGG + Intronic
1004991336 6:21141719-21141741 CCTGAGCTAACCCTTTTATGTGG - Intronic
1007391923 6:41554371-41554393 ACTGAGCCTGCATTTCTGTGTGG + Intronic
1007605858 6:43117533-43117555 CCTGAGCCTGCCATTTACTGGGG + Intronic
1011245292 6:85315605-85315627 CCTGAGTCTGCCATGCTGTGAGG - Intergenic
1012305666 6:97654059-97654081 CATGAGCCACCGCTTTTGTGTGG - Intergenic
1012322854 6:97873189-97873211 CCTAAGCCTGATCTTCTGTGAGG - Intergenic
1013602106 6:111714735-111714757 GCTGACGCTGCCCTTTTGTTTGG - Intronic
1015334345 6:132020253-132020275 TCTGAGCCTGGCCTGGTGTGTGG + Intergenic
1015340937 6:132099601-132099623 CCTGAGCTTCCCCTTCTGTGTGG - Intergenic
1016907961 6:149169900-149169922 CCTGGCCCTGCCCTTTTAGGAGG - Intergenic
1017185686 6:151598219-151598241 CTTGAGACTGACCTTTAGTGGGG + Intronic
1017804391 6:157931071-157931093 CCTCAGGCCGCTCTTTTGTGGGG + Intronic
1019176291 6:170160924-170160946 CCTGGGCCTGCTCCTGTGTGGGG + Intergenic
1019289362 7:242845-242867 TCTGAGCCTGCCCCTTGGTGTGG - Intronic
1019816264 7:3203125-3203147 CCAGAGCTTGCCCTATTGTTTGG + Intergenic
1020587385 7:10086004-10086026 CCTGAGCCTGCCCCTCAATGTGG + Intergenic
1021312160 7:19108554-19108576 CCTCAGCCTGCGGTTCTGTGCGG + Intronic
1021864979 7:24946684-24946706 CCTGAGCCTGCCCTTCTTAATGG - Intronic
1022038059 7:26552672-26552694 CCTCAGCCTGCCTTCCTGTGAGG + Intergenic
1025244398 7:57305421-57305443 TCTGAGCCGGCCGGTTTGTGGGG + Intergenic
1026176196 7:67999533-67999555 TCTGAGACTGCCATGTTGTGAGG - Intergenic
1029151404 7:98483139-98483161 CATGAGCCTGCCCTCTTGGATGG + Intergenic
1029219593 7:98977675-98977697 CCTGTGTCTGCCCTTCAGTGTGG + Intronic
1031276633 7:119732538-119732560 ACTGCGCCTGGCCCTTTGTGAGG - Intergenic
1033575669 7:142681896-142681918 TTTGAGACTGCCATTTTGTGAGG - Intergenic
1033579357 7:142717664-142717686 CCTGAGCCTGCCCTTGCCAGAGG + Intergenic
1034701372 7:153099204-153099226 CCTGAGCCTCCCCTTCTGAGGGG - Intergenic
1034920328 7:155074412-155074434 CCTGAAACTGCGCTTTTGGGAGG + Intronic
1035478069 7:159157847-159157869 CCTGAGCCTGCCATGCTGAGGGG + Intergenic
1036766440 8:11552268-11552290 CCTGGTCCTGCCCCTTTGTGGGG - Intronic
1036768450 8:11563528-11563550 CCGGAGCCTGCCCACCTGTGGGG - Intronic
1039395496 8:37222166-37222188 CCTCAGCCTACCCTTTAGTTAGG + Intergenic
1040952917 8:52954083-52954105 CCCGAGCCTCCCCTCTTCTGTGG + Intergenic
1041097954 8:54368123-54368145 CCTGAGCTGGTCCTGTTGTGGGG - Intergenic
1041378019 8:57222020-57222042 CCTGATCCTTCCCTTGAGTGGGG + Intergenic
1043992830 8:86777300-86777322 CTTGAGCCTGGGCTTTTTTGTGG - Intergenic
1044891740 8:96843193-96843215 ACTGAGCCTGGCCTTTTGTGGGG + Intronic
1047572423 8:126114033-126114055 CCTGTGACTGCCCATTTGTGTGG - Intergenic
1048432508 8:134383361-134383383 CCAGAGCCTGCCCTTCTGGCTGG - Intergenic
1052889285 9:33682750-33682772 TTTGAGACTGCCATTTTGTGAGG - Intergenic
1056292775 9:85160547-85160569 CCTGAGGCTGGCCTTTGGTGAGG + Intergenic
1057275813 9:93675515-93675537 GCTGACCCTGCCCTATTGTGAGG + Intronic
1058575411 9:106395810-106395832 CCTAACCCAGCCCTTGTGTGAGG + Intergenic
1058648686 9:107154748-107154770 CCTGTTCCTGCCCCTTTGTGAGG - Intergenic
1058732035 9:107859607-107859629 CCTGAGGCTGCCATGCTGTGGGG + Intergenic
1059373542 9:113863215-113863237 CCTGAGGCTGCCATGTTGTGAGG - Intergenic
1059410315 9:114127687-114127709 TCTGAAGCTGCCATTTTGTGAGG + Intergenic
1059673790 9:116516964-116516986 GCTCAGCCTGTCCTTGTGTGGGG - Intronic
1060279481 9:122206314-122206336 CCTGAGCCTGCCTAGCTGTGAGG - Intronic
1060620708 9:125063107-125063129 CCTAATCTTGCCCTTTTCTGGGG - Intronic
1061543492 9:131290588-131290610 CCGGAGCCTGCCTGTTTCTGGGG - Intronic
1061729813 9:132604979-132605001 CCTGAGGATGCCTTTATGTGGGG + Intronic
1061991227 9:134159764-134159786 CCTGTGGCTGCCCTGCTGTGGGG + Exonic
1062107089 9:134761640-134761662 CCTGAGGCTGCCCACATGTGTGG + Intronic
1185468793 X:370571-370593 CCTGAGCTTGGTCTTCTGTGTGG + Intronic
1186959361 X:14718730-14718752 CCTGAGGCTGCCATGCTGTGAGG - Intronic
1187113861 X:16329550-16329572 CCTGTGCCTGCCCTTCCCTGAGG + Intergenic
1189815141 X:44817214-44817236 CCTGAGGCTGCCATGCTGTGAGG - Intergenic
1190909740 X:54759716-54759738 CCACAGCCTGCCCATTTGGGTGG + Intronic
1191604381 X:63044946-63044968 CATGGGACTGGCCTTTTGTGGGG - Intergenic
1192504414 X:71672240-71672262 CCTGTGCCTTCCCTTTTGCTCGG - Intergenic
1197091187 X:122539310-122539332 CCAGAGCCTGCCATTTGGTCTGG - Intergenic
1197152508 X:123235232-123235254 CCTGCCCCTCCCCTTTTCTGAGG - Intronic
1197251155 X:124217687-124217709 CCTGTCCCTGCCCTTTGGTTTGG - Intronic
1197916833 X:131544559-131544581 CCTGAGGCTTCACTTCTGTGGGG + Exonic
1197979920 X:132206312-132206334 CTTGGGTCTGCCCTTTTTTGGGG + Intronic
1198513083 X:137373956-137373978 CCTGTGCCTGCCCATTTCTCAGG - Intergenic
1201524958 Y:14922603-14922625 TCTGAGGCTGCCATTTTGTGAGG + Intergenic