ID: 1103004882

View in Genome Browser
Species Human (GRCh38)
Location 12:117413230-117413252
Sequence TTGTGGGGCCCTTATTCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103004882 Original CRISPR TTGTGGGGCCCTTATTCTGT TGG Intronic
900411650 1:2515212-2515234 TTGTGGGACCCTGACTCTGGGGG - Intronic
901758393 1:11455261-11455283 TTGGGGGGCCGTTATTCTGCTGG + Intergenic
907680993 1:56563302-56563324 TTGTAGGGCCCCTATTCAGTTGG - Intronic
907806302 1:57823741-57823763 TTTTGGGGCCCCCATTCTCTGGG + Intronic
908416781 1:63920916-63920938 TTGTTGGGCATTTACTCTGTGGG + Intronic
913555087 1:119958002-119958024 TTCTGGGTTTCTTATTCTGTAGG + Intronic
914916801 1:151824075-151824097 TTGTCGGGCCCTTGGTCTCTGGG + Intronic
918042754 1:180923169-180923191 TTGTGGAGGCCTCATTATGTAGG + Intronic
920201135 1:204260393-204260415 TTGTGGGGCCTGTATTCTCATGG - Intronic
920656445 1:207879078-207879100 TTGTGGATCCCTTGTTCTGGGGG - Intergenic
1064449328 10:15426869-15426891 TTCTAAGGCCCTTATTCTTTAGG + Intergenic
1070984983 10:80680960-80680982 TTCTGGGTCTCTTAGTCTGTGGG + Intergenic
1078301944 11:10140399-10140421 TTGTGGAGGCCTCATTGTGTAGG - Intronic
1079487901 11:20954597-20954619 TTATGGGGCCTCTACTCTGTGGG - Intronic
1085736407 11:79042927-79042949 GTGTTGGAACCTTATTCTGTAGG - Intronic
1089178270 11:116563730-116563752 TTGTGCAGCCCTGATTCTGTGGG + Intergenic
1090505626 11:127310534-127310556 TTGTGAGGCCACTTTTCTGTAGG - Intergenic
1091453619 12:589038-589060 CTGTGGGAGACTTATTCTGTGGG - Intronic
1095449341 12:42313486-42313508 TTGTGGGGCCCTTAAAATCTAGG + Intronic
1097975046 12:65676420-65676442 ATGTTCGGCCCTTATACTGTTGG - Intergenic
1097998683 12:65917728-65917750 TTGTGGAGCCCTAGATCTGTGGG + Intronic
1098690405 12:73480832-73480854 TTGGGGGGGCTTTATTATGTAGG + Intergenic
1101793445 12:107951582-107951604 TTGTGGGTCCCTTATTTTGGAGG - Intergenic
1103004882 12:117413230-117413252 TTGTGGGGCCCTTATTCTGTTGG + Intronic
1105642363 13:22279105-22279127 CTCTGGGACCCTTATTCTCTGGG - Intergenic
1108137054 13:47376207-47376229 TTGTGGGGTCCTTAATGTCTTGG + Intergenic
1110149429 13:72231751-72231773 TTGTGTGGACAGTATTCTGTAGG - Intergenic
1111312455 13:86507463-86507485 TTATTAGGCCCTCATTCTGTGGG + Intergenic
1112746780 13:102535770-102535792 TTTTGGGGGCATTATTCTGTCGG + Intergenic
1114373908 14:22122558-22122580 TTCTGGGGCCCTTACACTGATGG + Intergenic
1115176531 14:30568083-30568105 TTTTGGGGCTCTTATTAGGTGGG + Intronic
1117291765 14:54341469-54341491 TTGTGGGGTCATTATTCAGATGG - Intergenic
1118612064 14:67549212-67549234 TTCTAGGGCTTTTATTCTGTGGG + Intronic
1121094977 14:91211521-91211543 TTGTGTGGCCCTATTTGTGTGGG - Intronic
1126080293 15:44954412-44954434 TTGTGGTTCCCTTTTTCTTTAGG - Intergenic
1127300768 15:57651418-57651440 TGCTGGGGCCCTAATTCTTTAGG - Intronic
1129478885 15:75807419-75807441 GGGTGGGGCCCTGATTCAGTAGG + Intergenic
1129836996 15:78714930-78714952 GGGTGGGGCCCTGATTCAGTAGG + Intronic
1130510207 15:84582955-84582977 GGGTGGGGCCCTGATTCAGTAGG - Intergenic
1130584872 15:85173044-85173066 GTGTGGGGCCCTGATTCAGTAGG + Intergenic
1134768508 16:16783492-16783514 TGGTGGGGCCCTAATCCAGTAGG + Intergenic
1144763647 17:17721549-17721571 TGGTGGGGACCTGATTGTGTGGG + Intronic
1146647913 17:34587535-34587557 TTGTGGGGTCCTCAGTCTCTGGG - Intronic
1156211077 18:34943429-34943451 TTGTGAGTCCCCTTTTCTGTTGG - Intergenic
1157326077 18:46669584-46669606 TTGTGTTGTCCTTATTGTGTGGG - Intronic
1157582295 18:48780746-48780768 CTGTGGGGCCCTTATTCCACTGG - Intronic
1160381133 18:78457087-78457109 TTTTGGCCACCTTATTCTGTTGG + Intergenic
1161365410 19:3876443-3876465 TTTAGGGGCCATTATTCTGCCGG - Intergenic
1161675212 19:5643227-5643249 CTGTGGGGCCCTTTCTGTGTTGG + Intronic
1162222902 19:9193891-9193913 TTGTGTGGTTCTTATTATGTTGG + Intergenic
1165044601 19:33094793-33094815 TTTTGGGTTCCTTATGCTGTGGG + Intronic
1165203449 19:34164026-34164048 TTGTGGGCCCCTTCTTCTAGTGG - Intergenic
927924649 2:27002695-27002717 TGGTGGGGCCCTTGTGCTGATGG + Intronic
931969590 2:67571070-67571092 TGGTGTTGCCCTTATTCTGCAGG - Intergenic
938782751 2:134600315-134600337 TTGTTGGGTCATTATCCTGTTGG - Intronic
944290844 2:198002786-198002808 TTGTGGGACCTGTATTCTGCAGG + Intronic
947487390 2:230564497-230564519 TTGTGTGACAATTATTCTGTAGG + Intergenic
1171974460 20:31585521-31585543 TTGTGCGGTTTTTATTCTGTGGG - Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1173008724 20:39161188-39161210 TTATAGGGCCTTTATTATGTTGG + Intergenic
1174537871 20:51266644-51266666 TTGTTGGGTCCTGCTTCTGTGGG + Intergenic
1175410123 20:58762281-58762303 TTGTGGGACTCTAATTGTGTAGG - Intergenic
1185020749 22:48373479-48373501 TTGTGGTGTCCTGAGTCTGTGGG - Intergenic
1185103723 22:48855534-48855556 CTCTGGGACCTTTATTCTGTTGG + Intergenic
949224561 3:1678598-1678620 TTATGGTGCCCTTAATCTTTAGG - Intergenic
951003405 3:17591274-17591296 TTGAGGGGCCATGATTCTCTGGG - Intronic
951164939 3:19474058-19474080 ATGTGGGGCATTTCTTCTGTTGG + Intronic
953317425 3:41941926-41941948 TGCTGGGGCCCAGATTCTGTTGG - Intronic
953665041 3:44919380-44919402 TTGTAGGGCAGGTATTCTGTAGG - Intronic
953795814 3:45985156-45985178 CTGTGTGGGCCTTGTTCTGTGGG + Intronic
957549736 3:81688396-81688418 TTGTTGAGTACTTATTCTGTGGG - Intronic
961680772 3:128598583-128598605 TTTAAGGGCCCTTATGCTGTTGG + Intergenic
962141246 3:132792864-132792886 TTATGGGGCCCTGACTCTGCAGG + Intergenic
962756299 3:138467817-138467839 TGCTGGGGTCCTTAATCTGTGGG - Intronic
965762547 3:172094557-172094579 TTGTGTGTCCATTCTTCTGTTGG + Intronic
968750809 4:2387926-2387948 ATGTGGGGCCCTTTTCCTGTGGG - Intronic
968936129 4:3611500-3611522 TTCAGGGGCCCTCATTGTGTGGG - Intergenic
969565154 4:7972932-7972954 CTGTGGGGCCCTTATTTTTCAGG + Intronic
974005392 4:56551349-56551371 TTCTGGGACCCTTTTTCTTTGGG + Intronic
976937042 4:90649448-90649470 TCGTGGGGCCCTGAATCAGTAGG + Intronic
984318299 4:178157649-178157671 TTGTCAGGCCGTTATTGTGTAGG - Intergenic
984335115 4:178379859-178379881 TAGTCAGGTCCTTATTCTGTAGG - Intergenic
990676503 5:58192211-58192233 TTGTGTGGCCATTATCCTGTGGG + Intergenic
991202638 5:64012077-64012099 TTGTGGCACCTTGATTCTGTAGG + Intergenic
999473476 5:151876873-151876895 GGGTGGGGCCCTAATTCAGTAGG + Intronic
999843329 5:155452168-155452190 CTGTAGGGCCCTATTTCTGTTGG + Intergenic
1001123986 5:169002998-169003020 CAGTGGGGCACTTATTCTTTGGG + Intronic
1003274060 6:4633515-4633537 TTATGGAGCTCATATTCTGTTGG + Intergenic
1004303519 6:14479475-14479497 TTGACGGTCTCTTATTCTGTGGG + Intergenic
1005392660 6:25349494-25349516 CTGTGGGGCTCATATACTGTTGG + Intronic
1008349691 6:50475110-50475132 TTTTGGGGGGCTTATTTTGTTGG - Intergenic
1009777700 6:68226412-68226434 TTGTTGGGGTCTTATTTTGTTGG - Intergenic
1011791418 6:90903126-90903148 TTGAGGGGCCATTCTTCTGGTGG - Intergenic
1012434729 6:99203632-99203654 TGGTCAGGCCCTTCTTCTGTAGG + Intergenic
1014369174 6:120583860-120583882 TAGTGAGGTCCTTCTTCTGTAGG + Intergenic
1014389353 6:120841752-120841774 TTGTGGGGCCATTATTCAGCTGG + Intergenic
1017160835 6:151364293-151364315 TTGTGAGGCCCTTCTTTTATTGG + Exonic
1023727835 7:43162811-43162833 TTATGGAGCACTTGTTCTGTGGG + Intronic
1025835411 7:65088690-65088712 TTGTGGGGCTCTTGTTGTGATGG + Intergenic
1026092125 7:67309005-67309027 TTGTGGGGACATTGGTCTGTCGG + Intergenic
1028839373 7:95411156-95411178 TTGAGTGGCTCTAATTCTGTGGG + Intronic
1030906081 7:115184657-115184679 TTCTCAGGCCCTTATTTTGTCGG - Intergenic
1032793116 7:135257011-135257033 TTGTGGGCCCCTTGTTCAGCAGG - Intronic
1035057781 7:156047707-156047729 TTGTGTGTCCATTCTTCTGTGGG - Intergenic
1040636712 8:49283805-49283827 TTGAGGGAGCCTCATTCTGTAGG - Intergenic
1046442742 8:114280242-114280264 TTGTAGAGCCATTATTCTGCAGG + Intergenic
1048491028 8:134894148-134894170 TTGTGGCTCCCTTCTTCTCTGGG + Intergenic
1050260800 9:3838825-3838847 TTGTGGAGCCCTTGCTCTCTGGG + Intronic
1050584147 9:7092617-7092639 TTGCTGGGCACTTCTTCTGTGGG + Intergenic
1051985551 9:23082248-23082270 TTGTGGAGACCTTATTCTAGAGG + Intergenic
1053844459 9:42221945-42221967 TTGTGGTGCACTGATTCTTTTGG - Intergenic
1060733923 9:126054399-126054421 TTCAGGAGCCCTTACTCTGTGGG - Intergenic
1061454721 9:130689048-130689070 TGGTGGGGCTCATATCCTGTGGG + Intergenic
1185839068 X:3371780-3371802 TTCTGGGGCCCTTTTTCTAAGGG - Intergenic
1186380737 X:9055939-9055961 TTGTGGGGGCCATATTTTCTGGG + Intronic
1186449711 X:9661903-9661925 TTGTGGGGGCCTGATGCTGAGGG + Intronic
1186468330 X:9802052-9802074 GTGTGGTGCTCTTAGTCTGTTGG + Intronic
1196285599 X:113875959-113875981 TTGTGGCTCCCTGTTTCTGTAGG - Intergenic
1197896090 X:131317250-131317272 TTGTAGGCCCCTTCTCCTGTGGG - Intronic
1198283332 X:135165023-135165045 TTGTGGGGTCAATGTTCTGTCGG - Intronic
1200774863 Y:7161103-7161125 GTGTGGGGCCCTCATCCTATAGG + Intergenic