ID: 1103005460

View in Genome Browser
Species Human (GRCh38)
Location 12:117416974-117416996
Sequence CTTTCCTCCTTGGAGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103005455_1103005460 17 Left 1103005455 12:117416934-117416956 CCAATCTTAGGTATGGATCTTCT 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1103005460 12:117416974-117416996 CTTTCCTCCTTGGAGTGTCCTGG 0: 1
1: 0
2: 3
3: 22
4: 225
1103005454_1103005460 18 Left 1103005454 12:117416933-117416955 CCCAATCTTAGGTATGGATCTTC 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1103005460 12:117416974-117416996 CTTTCCTCCTTGGAGTGTCCTGG 0: 1
1: 0
2: 3
3: 22
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103005460 Original CRISPR CTTTCCTCCTTGGAGTGTCC TGG Intronic
901112110 1:6806121-6806143 CTTTCCTCACTGAAGTGTCTTGG + Intronic
901136432 1:6999892-6999914 TTTTCCTCCCTGTAGTGCCCTGG + Intronic
901319941 1:8333737-8333759 GTTTCCTCCTTGGAGTGAGCAGG + Intronic
901704345 1:11062036-11062058 CTTTCCCCCATGCAGTGTCCTGG - Intergenic
901935300 1:12622425-12622447 CTTTCCTCCTCGGTGAGGCCTGG + Intergenic
902155442 1:14481932-14481954 CATGCCTGCATGGAGTGTCCAGG + Intergenic
902708974 1:18225981-18226003 CCTCTCTCCTAGGAGTGTCCTGG + Intronic
902818853 1:18931315-18931337 ATTTCCTCCTTGGAGTGGCCTGG - Intronic
903375045 1:22860516-22860538 CTCTCCCCCTTGCAGTGTCCTGG - Intronic
906212945 1:44022259-44022281 CTTTCTTCTCTGGAGTGACCTGG - Intronic
906241120 1:44242813-44242835 CTTCCCTCCTTGAAGTTTCCCGG - Intronic
906476319 1:46171773-46171795 ATCTGATCCTTGGAGTGTCCTGG - Intronic
907125465 1:52046534-52046556 TTTTTCTCCTTGGACTGTCTTGG - Intronic
907927857 1:58971572-58971594 CTTTCCCTCTTAGAGAGTCCTGG + Intergenic
909901974 1:81149134-81149156 TTTTTCTCCTTGAAGTCTCCTGG - Intergenic
910800437 1:91139486-91139508 TTTTCCTACTTGAAGTTTCCAGG + Intergenic
910869146 1:91815858-91815880 CTTTCTTCCTTGGGGTGTTTGGG - Intronic
914000820 1:143692697-143692719 CTTGGCTCCTTGGAGTGGACTGG + Intergenic
914198139 1:145460898-145460920 CTTGGCTCCTTGGAGTGGACTGG + Intergenic
914477241 1:148034027-148034049 CTTGGCTCCTTGGAGTGGACTGG + Intergenic
914510783 1:148330059-148330081 CTTGGCTCCTTGGAGTGGACTGG + Intergenic
915395115 1:155577539-155577561 CTTTCTTCATTGAAGTGTCTTGG + Intergenic
915411272 1:155702640-155702662 CTTTCCTCATTGAATTGTCTTGG + Intronic
917195379 1:172458924-172458946 CTTTCCTCATTGAACTGTCTTGG - Intronic
919340023 1:196293536-196293558 CTTTTCTCCATGGTGTGGCCTGG - Intronic
920366601 1:205451174-205451196 CTTTCCTCCTTGGCCACTCCAGG + Intronic
920999277 1:211026352-211026374 CTATACTCCTTGGAGTTTCCAGG - Intronic
923779497 1:237009466-237009488 CTTTCCTCCCTTTAGTGTTCAGG + Intergenic
924071401 1:240283981-240284003 CTTTCCTCCTTCGTCTGGCCTGG + Intronic
1062925336 10:1312125-1312147 CTTTCTGGCTTGCAGTGTCCTGG + Intronic
1063197517 10:3757530-3757552 CTTTGCTCCTAGGACTGCCCGGG - Intergenic
1063828300 10:9923829-9923851 TTCTGCTCCTTGGAGTTTCCTGG + Intergenic
1066316330 10:34250871-34250893 CTTTCCTCCTGGAAGTGTGGAGG - Intronic
1066543201 10:36471300-36471322 CTTTCCACCTTGGAGTTTCAGGG - Intergenic
1067660526 10:48233707-48233729 CCCTCCTCCTTGGAGGGTTCTGG + Intronic
1067690463 10:48498308-48498330 CTCTCCTCCTTGGGGTGTGCTGG + Intronic
1067756640 10:49010632-49010654 CCTTCCTCCTTTTAGTTTCCTGG + Intergenic
1069963071 10:72089845-72089867 CATTCTTCCTGGGTGTGTCCTGG + Intergenic
1070993964 10:80759012-80759034 CTTTCCCCATTGAAGTGTCTTGG + Intergenic
1072766430 10:98098369-98098391 CTTTTCTCCTGGGCGTGGCCAGG + Intergenic
1072943215 10:99785906-99785928 CTTTCCTCCTTTAAGATTCCAGG - Intronic
1073756429 10:106585817-106585839 CTTTCATCCTTTGACTGTTCTGG - Intronic
1074157544 10:110811916-110811938 CTCTCCTCCTGGGGGTGTGCGGG - Intronic
1075885320 10:125895478-125895500 CTTTCCTCCTTCTGGTGTTCCGG + Intronic
1076218957 10:128717832-128717854 CTCTCCACCGTGGAGTCTCCCGG - Intergenic
1078399192 11:11009314-11009336 CTTTTCTCATTAGAGTCTCCCGG + Intergenic
1078980971 11:16534728-16534750 CTTTCCTGCTTGGGGTGTTTGGG - Intronic
1083015934 11:59454130-59454152 CTGTCTTCTTTGGAGTCTCCTGG + Intergenic
1085295262 11:75427928-75427950 CTTGCTCCCCTGGAGTGTCCTGG - Intronic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1091415067 12:275622-275644 CTTTCTTCCTTGGACTTACCTGG - Intergenic
1092454425 12:8629958-8629980 CTCTCATCCTTGAAGAGTCCTGG - Intergenic
1093865992 12:24228083-24228105 CCTTCCTCCCTGGTGTGCCCGGG + Intergenic
1094016446 12:25869952-25869974 CTTTCCTCATTGAATTGTCTTGG - Intergenic
1094827790 12:34286264-34286286 CTTTCCTCCATGGAGGACCCAGG - Intergenic
1096014868 12:48261319-48261341 CTTTCCTCATTGAATTGTCTTGG + Intergenic
1096410991 12:51377132-51377154 CCCTCCTCCTTTGAGTGCCCAGG + Intronic
1097166136 12:57087654-57087676 CTTTCCGCCTTGTGGGGTCCGGG - Intronic
1098610360 12:72449901-72449923 CTTTTCTCCTTCTAGTTTCCTGG + Intronic
1099592000 12:84604704-84604726 GTTTTCCCCTTGGAGTGTGCTGG - Intergenic
1101889850 12:108703598-108703620 AGTTTCTCCTTGGAGTGTTCTGG - Intronic
1102431073 12:112883176-112883198 CTTTCCCCATAGGAGTGTCCAGG - Intronic
1103005460 12:117416974-117416996 CTTTCCTCCTTGGAGTGTCCTGG + Intronic
1103826875 12:123745949-123745971 ACTTCCTCCTTGGAGAGCCCAGG - Intronic
1107189313 13:37560472-37560494 CTGCCCTCATTGAAGTGTCCGGG - Intergenic
1108075475 13:46674926-46674948 TTTTTCTCCTTGGAGTTCCCTGG + Intronic
1110336349 13:74335567-74335589 CTTTCCTCCTTCCTGTTTCCTGG + Intergenic
1113072257 13:106433445-106433467 CTCTTCTCTTTGCAGTGTCCTGG + Intergenic
1113234066 13:108249805-108249827 CTTTCCCCATTGAAGTGTCCTGG - Intergenic
1113911018 13:113841286-113841308 CTGTCCTCCTAGGCGGGTCCAGG + Intronic
1113922244 13:113919617-113919639 TTTGCCTCTTTGGAGTTTCCAGG - Intergenic
1114694473 14:24613608-24613630 CTCTCCTCCTTTGAGTCTCATGG + Intergenic
1115697657 14:35917693-35917715 CTTTCTTTCCTAGAGTGTCCAGG + Intronic
1115802702 14:37013424-37013446 TTTTCCCCCTTGGAGCATCCTGG - Intronic
1117220109 14:53595405-53595427 CTTTCCTCATTGAATTGTCTTGG + Intergenic
1118650669 14:67890311-67890333 CTTTCCTATGTTGAGTGTCCTGG - Intronic
1119472882 14:74910252-74910274 CTTTCCGCCTCTGGGTGTCCTGG + Intronic
1121089909 14:91174036-91174058 CTTTCCTCCCTGGAGGTTGCGGG - Intronic
1121758611 14:96423986-96424008 CCTTCCTGCTTGGAGCATCCGGG + Intronic
1122743215 14:103883522-103883544 CTTTCCTCCTGGGAGTCTCCTGG + Intergenic
1202898321 14_GL000194v1_random:22432-22454 CTTTCGTCCGTGGGGTGCCCAGG + Intergenic
1124200247 15:27673287-27673309 CTTTCCTTCTGGGTGTTTCCAGG + Intergenic
1125280315 15:38035793-38035815 CTTGCCTCCTGTGAGTGCCCTGG - Intergenic
1125511476 15:40294605-40294627 CTTTCCTCCTTGCTGCCTCCAGG - Intronic
1126196319 15:45935936-45935958 CTTTCTTCCATTTAGTGTCCAGG + Intergenic
1127145588 15:56019691-56019713 TTTACCTCCTTGGACTTTCCAGG - Intergenic
1128646328 15:69381224-69381246 TTCTCCTCCCTGGAGTGGCCAGG + Intronic
1128980201 15:72180166-72180188 CTTTCCTCCTGGGGATATCCAGG + Intronic
1129459507 15:75693494-75693516 GTCTCCTCCTTGGAGGTTCCTGG + Intronic
1129745660 15:78018697-78018719 CTTTCTTGCTTGGAGTTTCAAGG - Intronic
1129756695 15:78103177-78103199 CTTACCTCCCTGGAGTGCCCTGG - Intronic
1130012750 15:80164650-80164672 CTTTCCTCAGGGGAGTGGCCGGG + Intronic
1130272480 15:82459189-82459211 GTCTCCTCCTTGGAGGTTCCTGG - Intergenic
1130464833 15:84186542-84186564 GTCTCCTCCTTGGAGGTTCCTGG - Intergenic
1130487856 15:84408262-84408284 GTCTCCTCCTTGGAGGTTCCTGG + Intergenic
1130499433 15:84486995-84487017 GTCTCCTCCTTGGAGGTTCCTGG + Intergenic
1130587123 15:85191156-85191178 GTCTCCTCCTTGGAGGTTCCTGG - Intergenic
1132320661 15:100922753-100922775 CTTTCCTCCTTCGACTTTTCAGG + Intronic
1132813478 16:1813927-1813949 CTTTCCTCCCTGGATTGCCTTGG - Intronic
1134402709 16:13924701-13924723 CCTTCCTCCTAGGATTGTCAGGG + Intronic
1134644236 16:15853630-15853652 CTTTCCTCCATTGTGTGGCCAGG + Intronic
1141827617 16:86492196-86492218 CTTCCCTCCTTGGAGTTCCCGGG + Intergenic
1142211559 16:88811040-88811062 CTTTCCTCAGGGCAGTGTCCAGG + Intronic
1142583987 17:959323-959345 CAGCCCTCCTTGGAGTGTCGCGG - Intronic
1142614863 17:1128188-1128210 TTTTCCTGGTTGGAGTCTCCTGG - Intronic
1142922239 17:3199281-3199303 CATCCCTCCTTGGAGGGTCTAGG - Intergenic
1144209362 17:13001567-13001589 CTTTCCTGGTTGGATTGTACTGG + Intronic
1144737767 17:17564458-17564480 CTCTCCTGCTTGTAGTTTCCTGG - Intronic
1146657191 17:34641573-34641595 CTTTTCTCCTTGGGGTGGCCTGG - Intergenic
1147756890 17:42774478-42774500 CCTTCCTCCTTTGAATATCCAGG + Intronic
1147904858 17:43816218-43816240 CTTGCTTTCTTGGGGTGTCCAGG - Intronic
1148130151 17:45257413-45257435 CTTGCCTCCTCGGAGGCTCCCGG + Intronic
1148901824 17:50884348-50884370 CTTTGTTCCTTGCAGTATCCTGG + Intergenic
1149066758 17:52489665-52489687 GTGTCCTCCTTTGAGTGTCTAGG + Intergenic
1151717090 17:75836422-75836444 CTTTCCATCTTGCAGGGTCCTGG - Exonic
1155587250 18:27380899-27380921 CTTTCATCATTCGAATGTCCTGG - Intergenic
1158483364 18:57842706-57842728 CTGTCATCCTTGGGGTTTCCTGG + Intergenic
1160036577 18:75307248-75307270 CTTTCCTCATTGGATGGTCCTGG + Intergenic
1161421907 19:4180660-4180682 CTTTCCTCCTGGATGTGTCCTGG - Intronic
1162282618 19:9711385-9711407 TTTTCTTCCTTTGAGTCTCCTGG - Intergenic
1163034419 19:14562884-14562906 CTTTGCTCCTGGGAGAGTCATGG + Intronic
1163048370 19:14662197-14662219 CTTTCCCCCATGGTCTGTCCTGG + Intronic
1163672766 19:18638121-18638143 ATTTCCTCCTTGGCCTGACCTGG - Intronic
1164793327 19:31006191-31006213 CTTTGCTCCTTGGTGTGGGCAGG + Intergenic
1165263972 19:34645348-34645370 CTGTCCTCCCTGGAGTGTCCTGG - Intronic
926393689 2:12420061-12420083 CTTTCCTGCTTACAGTCTCCAGG + Intergenic
928287310 2:30003806-30003828 CTTTCCTCATTGAATTGTCTTGG - Intergenic
929876617 2:45801741-45801763 CGTTCTTCCCTGGTGTGTCCTGG + Intronic
930873015 2:56185716-56185738 CTTTTCTCCTTGGAGAGCGCCGG + Intronic
931819268 2:65935175-65935197 CTTTTCTCCTCTGTGTGTCCTGG - Intergenic
932216845 2:69971929-69971951 GTTTCCTCCTAGGATTGTCCTGG + Intergenic
934063327 2:88317463-88317485 CACTCCTCCTTGGACTGTCCAGG - Intergenic
934145656 2:89091016-89091038 CTTTTATTCTTGCAGTGTCCTGG - Intergenic
934223601 2:90109554-90109576 CTTTTATTCTTGCAGTGTCCTGG + Intergenic
936820414 2:116513051-116513073 CTTTCCTCCTTTCAGTGTGAAGG - Intergenic
938140209 2:128789331-128789353 CTTTCCTCCCTGCAGGGTGCAGG + Intergenic
938610721 2:132945088-132945110 CTTTCCCCAGTGGAGTGTCTTGG - Intronic
939953979 2:148509593-148509615 CTGTCCTCTCTGGAGCGTCCTGG - Intronic
942804284 2:179911438-179911460 CTTTGCTCCTTGGGATGCCCTGG + Intergenic
943389888 2:187252311-187252333 CTTTCCTGCTTGCAGTGAGCAGG - Intergenic
944401841 2:199336124-199336146 CCTTCCTCCTTGGTGTCTCTAGG + Intronic
944484473 2:200190488-200190510 CTCTCCTCCTTTCAGAGTCCAGG - Intergenic
944912997 2:204328470-204328492 CTTTCCTTCTTCGAGGCTCCAGG + Intergenic
945828468 2:214753836-214753858 CTTTCTTCTTTGGACAGTCCTGG + Intronic
946378516 2:219328941-219328963 ATTTCTTCCTTAGAGGGTCCCGG + Exonic
948595724 2:239078231-239078253 CTTTTCTCCTACGAGTCTCCGGG + Intronic
1171277502 20:23870475-23870497 CATTGCTCCTAGGAGAGTCCTGG + Intergenic
1172149742 20:32781256-32781278 CTTTTCTCCGTGGCGTGGCCTGG - Intronic
1172866608 20:38104530-38104552 CTTTCCCCATTGAAGAGTCCTGG - Intronic
1174028746 20:47603411-47603433 CTGTTCTCATGGGAGTGTCCAGG + Intronic
1175862550 20:62157988-62158010 CTTACCACCTGGGAGTGCCCTGG + Intronic
1179415985 21:41199235-41199257 CTTTCCTCCTTGTGGTGCCGGGG + Intronic
949610339 3:5697764-5697786 TTTTCCACCTTTGAGTCTCCTGG + Intergenic
949877720 3:8637364-8637386 CTTTCCTCCTTGGCATCTCAGGG - Intronic
949981277 3:9503206-9503228 TTTTCCTCCCTTCAGTGTCCAGG - Intronic
952629344 3:35445965-35445987 CTTTCCTCCATGGAGAGACATGG - Intergenic
952937685 3:38413124-38413146 ACTGACTCCTTGGAGTGTCCAGG + Exonic
959990472 3:112626086-112626108 TTTTCCCCCTTGGAATGTCAGGG + Intronic
961507634 3:127381141-127381163 CTTTCCTCCAAGGAATGGCCAGG - Intergenic
962379257 3:134884006-134884028 CTTGCCACCTTGGTGTGGCCTGG - Intronic
963915225 3:150853310-150853332 CTTTCCCCATTGAAGTGTCTTGG + Intergenic
969381803 4:6804950-6804972 CTCTCCTTCTTGGAGGTTCCGGG + Intronic
969902538 4:10363101-10363123 CTTTCCTCCTCTGGGTTTCCTGG - Intergenic
971397792 4:26245824-26245846 CTTTCCTCCTTGAATTATCTTGG + Intronic
972994238 4:44860278-44860300 TTTTCATCCTTGCTGTGTCCTGG + Intergenic
973757599 4:54091150-54091172 CCCTCCTGCTTAGAGTGTCCAGG + Intronic
974378640 4:61109291-61109313 CTTTACTCCTGGGTGTGTCCTGG + Intergenic
976200580 4:82574199-82574221 CTTTCCCCTTTGGACTGTCTTGG + Intergenic
978757368 4:112317501-112317523 CTTTCCTCATTGGATGGTCTTGG + Intronic
979478129 4:121182443-121182465 CTTTCCACTTTAAAGTGTCCAGG - Intronic
980246959 4:130258575-130258597 CTTCCCTGCTTGAATTGTCCCGG + Intergenic
981350781 4:143727063-143727085 CTTTTCTCCATGCAGTGTCAGGG - Intergenic
985335905 4:188893987-188894009 CTTTCCTAATTGCTGTGTCCAGG + Intergenic
985959976 5:3293966-3293988 CTTTCCTCCCTTGGGTGCCCAGG - Intergenic
986599355 5:9456236-9456258 GTTTCCTCCTTGGCATGGCCAGG - Intronic
987517337 5:18929181-18929203 CTTTCCTCATTGAATTGTCGTGG + Intergenic
990339374 5:54807550-54807572 TTTTCCTCATTGGAGTCTCTAGG - Intergenic
993587291 5:89746800-89746822 CTTTCCTCCTTGTAGTTCTCAGG - Intergenic
993955629 5:94228954-94228976 CTCTCATCCTTGGAGTGGCTGGG - Intronic
995230700 5:109758855-109758877 CTTTCCTCACTGAATTGTCCTGG + Intronic
995744287 5:115387545-115387567 GCTTCCTCCTTGGAGAGACCAGG + Intergenic
997410127 5:133684616-133684638 CTTTCTGCCTTCGAGTATCCAGG + Intergenic
999187171 5:149720305-149720327 ATTTCCTTCTTAGAGTGTCTTGG - Intergenic
1001575202 5:172758698-172758720 CTTCCCTCCTGGGTGGGTCCTGG - Intergenic
1001723871 5:173880269-173880291 CTTTTCTCCTTGGTGTTCCCTGG - Intergenic
1002131183 5:177082663-177082685 CTTTCTTCCTAGGAGTGTTGGGG - Intergenic
1002140197 5:177133444-177133466 CGCGCCTCCTTGGAGTGTCGGGG - Intronic
1002800015 6:513380-513402 TTTTCCTCCTTGGTTTGTGCTGG - Intronic
1003406610 6:5831665-5831687 GTTTCCTCCCTTGAGTTTCCGGG - Intergenic
1004737037 6:18417459-18417481 CTTTCCTCTTTGAATTGTCTTGG - Intronic
1004792289 6:19040046-19040068 CTTTCCTCCTAGCATTTTCCAGG - Intergenic
1004939029 6:20536509-20536531 CTTTCCCCCTTGAATTGTCTAGG + Intronic
1005316724 6:24609817-24609839 CTTTCCCCATTGAATTGTCCTGG - Intronic
1005506794 6:26476242-26476264 CTTTCCAACTTGGAGTGCTCTGG - Intronic
1005515069 6:26546679-26546701 TGTTCTTCCTTGGAGTGTCTTGG + Intergenic
1006103590 6:31702465-31702487 CTTTCCTTCTTAGATTGTCTAGG - Intronic
1007302146 6:40875622-40875644 CTTTTCTCCTTGGGGATTCCTGG + Intergenic
1008967610 6:57329401-57329423 CTTTCCTCATTGAATTGTCTTGG + Intronic
1010367503 6:75068493-75068515 CTTTCCTCATTGAATTGTCTGGG + Intergenic
1011785003 6:90833835-90833857 TCCTCCTCCTTTGAGTGTCCTGG + Intergenic
1011853874 6:91664393-91664415 CTTTGCACCTTGGAGGCTCCTGG - Intergenic
1012430494 6:99159074-99159096 CTGTGCTCCTTGGAGTGTGAGGG + Intergenic
1013347180 6:109272244-109272266 CTTTCCTCATTAAATTGTCCTGG + Intergenic
1018691821 6:166352244-166352266 CTCTCCTCCTCGGAGTGGGCAGG - Intergenic
1019604666 7:1902492-1902514 CTTTACTCCTTCGAGTGTTACGG + Intronic
1021549735 7:21857708-21857730 CTTTCCTCATTGAATTGTCTTGG - Intronic
1023053426 7:36272962-36272984 CTTTCCTCCCAGGAGGGGCCGGG - Intronic
1024547275 7:50532905-50532927 CCTTCCTCCTAGGACTCTCCTGG - Intronic
1024698132 7:51877575-51877597 CATTCCTCCCTGGAGCTTCCAGG + Intergenic
1026410884 7:70121078-70121100 CTTTCCCCATTGAAGTGTCTTGG - Intronic
1026550490 7:71364336-71364358 TTTTCCTTCTCTGAGTGTCCTGG + Intronic
1027878103 7:83797716-83797738 CTTTCCTCCTTGGAGGTTGCAGG + Intergenic
1028280414 7:88919162-88919184 CTTCCCTACTTGGGGTGTCTTGG + Intronic
1029217170 7:98959055-98959077 CTTGCCTCCCTGCAGTGTGCAGG + Intronic
1029662318 7:101970896-101970918 CTGACCTCCTTGGAGTGTAGAGG + Intronic
1030520532 7:110592454-110592476 CTTTTCTCCTTGAAATTTCCAGG - Intergenic
1031868147 7:127062447-127062469 CTTTCATGCTTGCAGTGTCATGG - Intronic
1032843538 7:135733807-135733829 CTTTTCTCCTTGTAGTTTCCTGG - Exonic
1034674345 7:152881861-152881883 CTCTGCTCCTTGCGGTGTCCTGG + Intergenic
1037430394 8:18806806-18806828 GTTTCCCCTTTAGAGTGTCCTGG - Intronic
1037908608 8:22729879-22729901 CTTTCCTCATTGGTCAGTCCTGG + Intronic
1038737033 8:30179496-30179518 CTTTTCTCTTTGTGGTGTCCTGG + Intronic
1040753776 8:50744777-50744799 CTTTCCTCATTGGATGGTCTTGG - Intronic
1040996332 8:53406433-53406455 ATTTCCTCCATAGAGTGTGCTGG - Intergenic
1043757975 8:84028418-84028440 CTTGCCTCCTTGGTGGATCCAGG + Intergenic
1045143794 8:99316220-99316242 CTTTGCTACTTGGAGTGGCAGGG + Intronic
1046084491 8:109415511-109415533 ATTTCCTCCTGGTAGAGTCCGGG - Intronic
1046117595 8:109803087-109803109 CTTACCTCCTTGGAGAGTAGGGG - Intergenic
1047778241 8:128091185-128091207 GTTTACTCCTCGGACTGTCCCGG + Intergenic
1050589297 9:7145893-7145915 ATTTCATCCTCAGAGTGTCCTGG - Intergenic
1051723215 9:20061612-20061634 CTTTCCTCATTGAATTGTCTTGG - Intergenic
1054791216 9:69258774-69258796 CGTTCCACCTTCGAGAGTCCAGG + Intergenic
1055152390 9:73018107-73018129 CTTTCCTCATTGAATTGTCCTGG + Intronic
1055588034 9:77777113-77777135 CTTTCCACATTGGATTGTCTTGG - Intronic
1055639825 9:78310998-78311020 CTTTCCTCAGGGGAGTGTTCTGG + Intronic
1056658961 9:88530927-88530949 CTCTCCTCCTTTTGGTGTCCTGG - Intergenic
1057889904 9:98862031-98862053 CTGTCCTGCTTGGAGAGTGCAGG + Intergenic
1057949343 9:99357321-99357343 CTTCCTTCCTTAGAGTTTCCAGG + Intergenic
1058729884 9:107839482-107839504 CTTTCTTCCTTGACGTGTCCAGG + Intergenic
1060203001 9:121663049-121663071 AATTCATCCTTGGAGTGTTCAGG + Intronic
1061617590 9:131790453-131790475 CTTGCCTCCTTGGGGAGCCCAGG - Intergenic
1061958658 9:133976974-133976996 CCTTCAGCCTTGGGGTGTCCAGG - Intronic
1062055482 9:134467746-134467768 CATCCCTCCCTGGAGTGGCCAGG + Intergenic
1062185475 9:135216017-135216039 CTCTCCACCTTGGTGGGTCCTGG + Intergenic
1062253640 9:135610819-135610841 CTTTTCTCCTTCCACTGTCCCGG - Intergenic
1185959315 X:4530258-4530280 CTTGTGTCCTTGAAGTGTCCTGG - Intergenic
1191654741 X:63584596-63584618 CTTTCTTCCATGGACTTTCCAGG - Intergenic
1192807697 X:74524644-74524666 CTCTCTTGCTTGGGGTGTCCTGG - Exonic
1196519665 X:116658548-116658570 CTTACCTTCTTGGAGTGGCATGG - Intergenic
1198529188 X:137533144-137533166 ATTTGCTTCTTGGAGTGTCTGGG - Intergenic
1200869922 Y:8086733-8086755 CTTTTCTCCTGGCAGTGTCCTGG + Intergenic