ID: 1103007145

View in Genome Browser
Species Human (GRCh38)
Location 12:117430340-117430362
Sequence TGGAGAGAAGGGCCCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 1, 2: 4, 3: 37, 4: 274}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103007145_1103007151 -2 Left 1103007145 12:117430340-117430362 CCCCAGGAGGGCCCTTCTCTCCA 0: 1
1: 1
2: 4
3: 37
4: 274
Right 1103007151 12:117430361-117430383 CACATGTCTTACTTCCTCTATGG 0: 1
1: 0
2: 0
3: 5
4: 190
1103007145_1103007154 10 Left 1103007145 12:117430340-117430362 CCCCAGGAGGGCCCTTCTCTCCA 0: 1
1: 1
2: 4
3: 37
4: 274
Right 1103007154 12:117430373-117430395 TTCCTCTATGGAGGAGGAGATGG 0: 1
1: 0
2: 0
3: 39
4: 359
1103007145_1103007152 1 Left 1103007145 12:117430340-117430362 CCCCAGGAGGGCCCTTCTCTCCA 0: 1
1: 1
2: 4
3: 37
4: 274
Right 1103007152 12:117430364-117430386 ATGTCTTACTTCCTCTATGGAGG 0: 1
1: 0
2: 0
3: 15
4: 131
1103007145_1103007153 4 Left 1103007145 12:117430340-117430362 CCCCAGGAGGGCCCTTCTCTCCA 0: 1
1: 1
2: 4
3: 37
4: 274
Right 1103007153 12:117430367-117430389 TCTTACTTCCTCTATGGAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103007145 Original CRISPR TGGAGAGAAGGGCCCTCCTG GGG (reversed) Intronic
900418711 1:2546476-2546498 GGTAGCGCAGGGCCCTCCTGCGG + Intergenic
900634892 1:3658103-3658125 TGGCAGGAAGGGCCCTGCTGGGG + Intronic
901317904 1:8321526-8321548 TGGAGGAAAGGGCCTTCCTGGGG - Intronic
901325768 1:8364315-8364337 TGGGCAGAGGGGCCCTTCTGTGG + Intronic
901864544 1:12095862-12095884 TGGAGAGAAATGGGCTCCTGAGG - Intronic
902931041 1:19731752-19731774 TGGCGAGAAGGGCTCTGCTCTGG + Intronic
902944457 1:19824799-19824821 TGGTGAGAAGCGACTTCCTGTGG + Intergenic
904046895 1:27614600-27614622 TGGAGAGATGGGAGCTCATGTGG + Intronic
905655787 1:39685069-39685091 GGGAGAGAAGCTCCCTGCTGGGG - Intronic
906204902 1:43981481-43981503 TGGAGGGTAGGGCCTGCCTGTGG + Intronic
906270878 1:44477719-44477741 TGGAGAGAAGAGCTCTCCCCAGG - Intronic
906506247 1:46382046-46382068 TGGAGTGAAAGGCCCACCTATGG - Intergenic
906728207 1:48059319-48059341 AGGACAGAGGGGCCCACCTGGGG - Intergenic
911198646 1:95021438-95021460 TGGAGAGCAGCACCCTTCTGAGG + Intronic
912679003 1:111716560-111716582 TGCTGAGAAGCGGCCTCCTGTGG + Exonic
913225282 1:116693534-116693556 TGGGGAGCAGGAGCCTCCTGGGG + Intergenic
915428911 1:155850464-155850486 TGGGGAAAAGTGCTCTCCTGTGG - Intronic
916322846 1:163523762-163523784 TGGAGAAAAGGGCCCTGTTTTGG - Intergenic
916658597 1:166900190-166900212 TAGAGAGAAGGAGCCTGCTGTGG - Intergenic
916728901 1:167549179-167549201 TGGAAAGAAGGGCTTTCCTACGG + Intronic
916927962 1:169542688-169542710 TGGTGAGAAGGGGCTTTCTGAGG + Exonic
917621437 1:176800703-176800725 TGGAGAGAGTTGCCCACCTGGGG - Intronic
917856933 1:179108632-179108654 TACAGAGAAGGACCCTCCAGGGG - Exonic
920067175 1:203277188-203277210 AGGAGGGAAGGGGCCTGCTGAGG + Intergenic
920721231 1:208388881-208388903 TAGAGAGAAGGGACCAGCTGGGG + Intergenic
921343146 1:214154376-214154398 GGGAGAGAAGGGCCCAACTAGGG - Intergenic
922182085 1:223243340-223243362 TGGAGAGATGGGGCTTCCTGGGG + Intronic
922976346 1:229786911-229786933 TGGACAGAATGGCCCAACTGAGG - Intergenic
923140279 1:231156037-231156059 AGAAGAGAAGACCCCTCCTGAGG - Intergenic
924070789 1:240276162-240276184 AGCAGTGAAGGGCCCACCTGAGG + Intronic
1063474256 10:6314867-6314889 TGGAGAGAAGAGACGTCCTGGGG - Intergenic
1065020998 10:21501336-21501358 TGGAGAGAAGGAATCTCCTTGGG - Intergenic
1067242499 10:44508432-44508454 TGGTGAGAAGTGGCATCCTGTGG + Intergenic
1070280167 10:75042981-75043003 TGGAGAGAAGGGCACAGCTTAGG - Intronic
1072340174 10:94439639-94439661 AGGAGAAAGGGGCTCTCCTGTGG - Intronic
1072512187 10:96138975-96138997 TATAGGGAAGGGCCCTTCTGAGG + Intronic
1073122948 10:101133125-101133147 GGCAGAGATGGGGCCTCCTGGGG + Intronic
1074031974 10:109697760-109697782 TGGATAGAGGAGCTCTCCTGTGG - Intergenic
1074474148 10:113754391-113754413 TGGAGAGAAGGGACTCCCTCAGG - Intronic
1074523803 10:114247771-114247793 TGAAGAGAAGGGCCCTGATGTGG - Intronic
1075723084 10:124598530-124598552 TGGAGAGCAGGCCCCACCTCAGG - Intronic
1076265252 10:129104402-129104424 TGCAGGGGAGGGGCCTCCTGTGG - Intergenic
1076542048 10:131220661-131220683 TGTAGAGAAGGGCTTGCCTGAGG + Intronic
1077265455 11:1646740-1646762 TCCAGAGAGGGGCCCACCTGTGG + Intergenic
1077546214 11:3171159-3171181 AGGAAAGCAGGGCCCTCCTGGGG + Intergenic
1078508680 11:11969568-11969590 TGGTGAGAAGGACCCTCCTGAGG + Intronic
1080389797 11:31834432-31834454 TGGAGAGAAGCTACCACCTGAGG + Intronic
1082813011 11:57489966-57489988 TGGACAGAAGGGCCCTGCTAGGG + Intronic
1082859664 11:57842676-57842698 TGCTAAGAAGAGCCCTCCTGGGG + Intergenic
1082890869 11:58137326-58137348 TGGAGATGATGGCCCTCCGGGGG + Intronic
1082988275 11:59186209-59186231 GGGAGGGAAGGGCCCGCATGTGG - Intronic
1083685320 11:64371739-64371761 TGGGCAGAAGGCCCCTCCAGGGG + Exonic
1084208009 11:67607167-67607189 TGGGGAGAAGGGCTCTCCAGAGG - Intronic
1084414842 11:69025810-69025832 TTGGGTGAGGGGCCCTCCTGAGG + Intergenic
1084709725 11:70836461-70836483 TGGAGGGAAAGGACTTCCTGTGG + Intronic
1086156926 11:83677768-83677790 TGGAGACAAAGACCCTCCTAAGG - Intronic
1088961748 11:114674050-114674072 AGGAGAGAAGGGGCCTCCAGGGG + Intergenic
1089583410 11:119495487-119495509 TGGGGAGGAGGGTCCTCATGAGG - Intergenic
1089704031 11:120264506-120264528 AGGAGAGAAGGGCCTTTCAGAGG + Intronic
1090263522 11:125339632-125339654 TGGACTGAGGGGCCCTGCTGGGG - Intronic
1090400153 11:126443768-126443790 CCCAGAGCAGGGCCCTCCTGAGG - Intronic
1090965076 11:131591271-131591293 GGGAAAGGGGGGCCCTCCTGGGG + Intronic
1093535370 12:20217146-20217168 TGGAGAGATGGGGCCTGATGTGG + Intergenic
1094479484 12:30870299-30870321 AGGTGAGAAAGGCTCTCCTGGGG - Intergenic
1096465920 12:51847844-51847866 TGGAGAGCTGGGCGCTCCGGGGG + Intergenic
1096686677 12:53292680-53292702 TGGGGAGAGGGGCAGTCCTGAGG + Intronic
1100901855 12:99250374-99250396 TGGAGGGACGGCCCCTCCTGGGG - Intronic
1101241842 12:102846877-102846899 GGGAGAGAAGGGACTTACTGTGG + Exonic
1101718698 12:107332790-107332812 AGGAGAACAGGGCCTTCCTGCGG - Intronic
1102064727 12:109964818-109964840 TGGAGAGAAGTGCCCCGGTGAGG + Intronic
1102221788 12:111199922-111199944 TGTAGAAAAGAGCCTTCCTGCGG - Intronic
1103007145 12:117430340-117430362 TGGAGAGAAGGGCCCTCCTGGGG - Intronic
1104763837 12:131313871-131313893 AAGAGAGAAAGGGCCTCCTGGGG - Intergenic
1104768522 12:131345905-131345927 TGGAGACCAGCACCCTCCTGGGG - Intergenic
1105624374 13:22098839-22098861 TGGAGAGCAGGGCCTGTCTGAGG + Intergenic
1105845977 13:24294132-24294154 TTGGGAGCGGGGCCCTCCTGGGG + Intronic
1106127148 13:26909836-26909858 GGGAGGGAAGGGCTCTGCTGGGG + Intergenic
1110404567 13:75135425-75135447 TGGTCAGAAGGGCCCCACTGTGG - Intergenic
1112956494 13:105065589-105065611 TGGAGAGAAGGTTCCCCCTTGGG + Intergenic
1113358118 13:109602388-109602410 TGGAGCGAAAGGCCCTCCTAGGG - Intergenic
1113480459 13:110616176-110616198 TGGATACGGGGGCCCTCCTGGGG + Intronic
1113661527 13:112109302-112109324 GGGAGAGCAGGGCCCCTCTGTGG + Intergenic
1114852019 14:26392979-26393001 TGGAGAGATTGACCCTCCTAGGG - Intergenic
1118759802 14:68873324-68873346 AGGAGAGATGGGCCTTCATGAGG + Intergenic
1119226412 14:72947682-72947704 AGGAGAGCAGGGTCCTCCTAGGG + Intronic
1120389925 14:83893564-83893586 TGGAGTAGAGGGCTCTCCTGAGG - Intergenic
1120556905 14:85938922-85938944 TTGAGAGAAGGGTTTTCCTGAGG + Intergenic
1121563778 14:94893763-94893785 TGGAGAGAAGTCCCCAGCTGGGG - Intergenic
1121867793 14:97379048-97379070 TGGAGAGACTGCCCCTCCTAGGG + Intergenic
1122341439 14:101031066-101031088 TGGAGAGAAGGCCTGCCCTGAGG + Intergenic
1122422496 14:101586526-101586548 GAGAGACAAGGGGCCTCCTGAGG - Intergenic
1122751324 14:103935661-103935683 TAGAGAGAAGGGCCCACCTGGGG + Intronic
1123129477 14:105973965-105973987 TGGAGGGAAGGGTCCACGTGGGG - Intergenic
1123129557 14:105974304-105974326 CGGAGAGAATGGTCCACCTGGGG - Intergenic
1123579571 15:21704067-21704089 TTGAGGGAAGGGTCCACCTGGGG - Intergenic
1123616198 15:22146578-22146600 TTGAGGGAAGGGTCCACCTGGGG - Intergenic
1126345826 15:47693086-47693108 TGGAGATAAGGTCCCTACAGAGG + Intronic
1127465852 15:59243971-59243993 TGGAGAGAGGGGTCCTCCATCGG + Intronic
1128612169 15:69083052-69083074 TGGGGAGAAGGGGCTCCCTGAGG - Intergenic
1128979479 15:72175981-72176003 TGGAGGAAAGGGCCCTGCTGTGG - Intronic
1129032733 15:72630202-72630224 TGGAGAGGAGGTACCTGCTGGGG - Intergenic
1129264950 15:74388475-74388497 TGGAGAGCAGGGGTCTCCTGAGG - Intergenic
1129407520 15:75329024-75329046 TGGAGAGAAGGTGCCTACTGGGG - Intergenic
1129734299 15:77951328-77951350 TGGAGAGGAGGTGCCTGCTGCGG + Intergenic
1129771057 15:78203902-78203924 TGGAGAGAGGGGCCCTCCTGGGG - Intronic
1129841286 15:78744663-78744685 TGGAGAGGAGGTGCCTGCTGCGG - Intergenic
1129844473 15:78761932-78761954 TGGAAAGGAGGCCCTTCCTGTGG + Intronic
1130087243 15:80787803-80787825 TGGAGAGAAGGGCCCACACATGG - Intronic
1130227021 15:82066736-82066758 TGGCAACAAGGGCCCTCCTCTGG - Intergenic
1131199225 15:90382594-90382616 TGGAGAGTAGAGCCAGCCTGTGG + Intergenic
1202988441 15_KI270727v1_random:438312-438334 TTGAGGGAAGGGTCCACCTGGGG - Intergenic
1132498493 16:274771-274793 TGGTGAGAAGGACCCGGCTGAGG - Intronic
1133103808 16:3494439-3494461 AGTGGAGAAGGGCCCGCCTGAGG + Intronic
1134058273 16:11183440-11183462 TGGGGTGAAGGGGCTTCCTGGGG + Intergenic
1137592166 16:49700393-49700415 AGCAGAAAAGGCCCCTCCTGAGG + Intronic
1138093487 16:54194679-54194701 GGGAGAGAAAGGCCTTCCTGGGG + Intergenic
1139282491 16:65782866-65782888 GGCAGACAAGGGGCCTCCTGTGG - Intergenic
1141033240 16:80607490-80607512 TGGAGACAAGGCCACTCCTGCGG - Intronic
1142586490 17:978173-978195 TGGACAGAAGGGCTATTCTGGGG - Intronic
1143152369 17:4815612-4815634 TGGGGAGAAGGGCTGTCATGTGG - Intronic
1143764271 17:9127287-9127309 TGGTGAGAAGTGGCCCCCTGTGG + Intronic
1144344948 17:14341033-14341055 TGGGGAGAGGGGCCCTCATATGG + Intronic
1144494034 17:15735957-15735979 TGGAGAGGAGGGGCAGCCTGAGG + Intronic
1144764438 17:17725010-17725032 TGGGGAGGAGGTCCCTCCTGGGG + Intronic
1144906226 17:18640722-18640744 TGGAGAGGAGGGGCAGCCTGAGG - Intronic
1145018015 17:19411498-19411520 GGGTGGGAAGGGCCCTCCTTGGG + Intronic
1145755926 17:27390032-27390054 GGGTGGGAAGGGGCCTCCTGGGG - Intergenic
1145760128 17:27420947-27420969 GGAAGACAAGGGCCTTCCTGTGG - Intergenic
1145974516 17:28976546-28976568 TGGGGAGAAGGGACTGCCTGTGG - Intronic
1147162268 17:38575042-38575064 GGGAGGGAAGGGCATTCCTGGGG + Intronic
1147660399 17:42114086-42114108 TGGAGAGAAGAGCCGGGCTGGGG + Intronic
1148340798 17:46872436-46872458 TGAAGGGAAGGGGCCTCCTCAGG - Intronic
1148395517 17:47304994-47305016 TGGCTGGAAGGGCCCTCCAGAGG + Intronic
1148618370 17:49016477-49016499 TGGGTAGAAGAGCCCTCCAGAGG + Intronic
1150657777 17:67051588-67051610 TGGAGGGAGGGGGCCTCCAGTGG - Intronic
1151182349 17:72338439-72338461 TGGAGAGAAGGGCCCACACCTGG + Intergenic
1151278613 17:73055161-73055183 GGAAGAGAAGGGCTCTTCTGGGG + Intronic
1152021624 17:77782751-77782773 TGGAGAGAAGGGACCTCGGAGGG + Intergenic
1152466586 17:80469985-80470007 TCGAGGGCAGGGCCGTCCTGGGG + Exonic
1153386143 18:4498960-4498982 TGGAAAGCAGGGCTCACCTGTGG + Intergenic
1155154126 18:23144073-23144095 TGGAAGGAAGGGGCCTCTTGTGG - Intronic
1156578814 18:38351422-38351444 TGGCAACAAGGGGCCTCCTGCGG - Intergenic
1157597151 18:48870870-48870892 TGGAAGGAAGGGCCTTCGTGAGG - Intergenic
1157614574 18:48978907-48978929 TGGAAGGAAGGGCCTTCCTGAGG + Intergenic
1157622335 18:49023821-49023843 TGGACAGAAGGGAGCTCCTTGGG - Intergenic
1161436892 19:4268858-4268880 CACAGAGAAGGGACCTCCTGGGG - Exonic
1161575306 19:5051586-5051608 GCGAGAGGAAGGCCCTCCTGAGG + Intronic
1162247983 19:9418732-9418754 TGGATAGAGAGGACCTCCTGGGG - Intronic
1163714706 19:18866960-18866982 TGGACAGACGCGCCCTCCCGGGG - Exonic
1163815390 19:19461932-19461954 TGGAGAGTAGCCCCGTCCTGGGG - Intronic
1163816282 19:19466465-19466487 TGGAGAGACAGGCCCTCCACAGG - Intronic
1164806865 19:31123669-31123691 TGGAGAAAAGGGCCACCTTGGGG - Intergenic
1164911472 19:32015770-32015792 TGGAGTGGAGGGCTGTCCTGGGG - Intergenic
1165717544 19:38056176-38056198 TGCAGAGAAGGGACCGACTGGGG - Intronic
1168272403 19:55257575-55257597 TGGGAAGAAGGGCCTTCCGGGGG - Intronic
1168450605 19:56463380-56463402 TGGATAGAGGGGCCCTCTTGAGG - Intronic
924988307 2:289553-289575 GGGAGGCAAGTGCCCTCCTGCGG - Intergenic
925035330 2:680509-680531 TGGAGATAAGGGCACTTCTGTGG - Intergenic
925171295 2:1751746-1751768 TGGAGAGAAGAGGGGTCCTGAGG + Intergenic
925351087 2:3201107-3201129 TGGAGAGAGGGGCCCAGCTCAGG - Intronic
926348752 2:11975610-11975632 TGGGTAGAGGGGCTCTCCTGTGG + Intergenic
927379510 2:22462625-22462647 TGGTGAGAAGTGCCCTCCACAGG + Intergenic
928130067 2:28642852-28642874 TAGAGGTAAGGGCTCTCCTGTGG - Exonic
928361332 2:30664501-30664523 TGGTCAGAAGGGCCCTGCTAAGG + Intergenic
928729536 2:34215339-34215361 TGGGGAAATGGGCCTTCCTGGGG + Intergenic
929730234 2:44482688-44482710 TGAAAAAAAGGGCCCTCCTAGGG - Intronic
932300796 2:70665619-70665641 GAGAGAGAAGGGCCTTCCAGAGG - Intronic
935496824 2:103792359-103792381 TGGAGAGATGGTCCCTCCCAGGG - Intergenic
936233448 2:110724378-110724400 TGGAGGGGAGGGCATTCCTGAGG + Intergenic
936635549 2:114252383-114252405 TGGAGAGAAGGAAACTCTTGAGG - Intergenic
937671285 2:124539940-124539962 AGGAGAGAAGAGCCCTGCAGTGG - Intronic
938639337 2:133264084-133264106 TGGAGAGAAACTCCATCCTGGGG - Intronic
940397076 2:153201943-153201965 TGGAGAGAGGGGCCATCCTGTGG - Intergenic
942641328 2:178063796-178063818 TGGAGAGAATGCCCCTCCCAGGG - Intronic
942851715 2:180495138-180495160 TGGAGAGCAGGGCCCTTCCCAGG + Intergenic
945181864 2:207100180-207100202 TGGAGAGAAGGGCCCTCCCTGGG + Intronic
946586650 2:221196528-221196550 TGGTGACAAGGCCCATCCTGAGG - Intergenic
948150733 2:235742683-235742705 TGGAGGCAAGGTCCCTCCTGTGG + Intronic
948943921 2:241209917-241209939 TGCAGTGAATGGCCCTGCTGGGG - Intronic
948999086 2:241602087-241602109 TGCAGAGTTGGGGCCTCCTGTGG - Intronic
1168760833 20:348245-348267 TGGAGAGGAGGGCTCGCCGGAGG - Intronic
1168819085 20:761471-761493 TTGAGAGAAGGCCCCTGCTGAGG + Intronic
1172906378 20:38373205-38373227 TGGAAAACAGGGCTCTCCTGGGG + Intronic
1173226232 20:41163869-41163891 TGGTCAGATGGGCCCTCCTGGGG - Intronic
1173790734 20:45826368-45826390 TGGAGAAAAGGCCCCTCATGGGG + Intronic
1174777224 20:53355249-53355271 GGGAGACAAGAGCCCTCCTTTGG + Intronic
1179006234 21:37517798-37517820 TGCAGAGAAGGGCACTGCTGGGG + Intergenic
1179287399 21:39989686-39989708 TGGAGAGATGGGCTCTCCTTAGG - Intergenic
1179874562 21:44261536-44261558 GGGAGGGCAGGGCCCTCATGAGG + Intronic
1179985032 21:44915678-44915700 TGGAGAGAAGTGCCGTCAGGTGG + Intronic
1180160699 21:45997625-45997647 AGGGAAGCAGGGCCCTCCTGGGG - Intronic
1180967954 22:19800320-19800342 TGCAGAGAAGAGCCCTCCGGGGG + Intronic
1181171076 22:21010514-21010536 TGCAGAAAAGAGCTCTCCTGGGG + Intronic
1181172187 22:21015936-21015958 TGGCGAGGAGAGCCCACCTGGGG - Exonic
1184665529 22:45987012-45987034 TGGGGAGCAGGGGCCACCTGGGG + Intergenic
1184981367 22:48097850-48097872 GGGAGGGCAGGGCCTTCCTGTGG + Intergenic
950331821 3:12161857-12161879 TAGGGAGAAGGGGCCTCCTGGGG + Intronic
950500644 3:13361496-13361518 TGGAGGGAGGAGTCCTCCTGTGG - Intronic
954030705 3:47818094-47818116 TCGAGAGATGGTCCCTCCTGGGG - Exonic
954400661 3:50317932-50317954 GGGAGAGAAGGGGCCTCCCAGGG + Exonic
954445219 3:50542696-50542718 TGGAGGGAAGGATGCTCCTGAGG + Intergenic
954450675 3:50569675-50569697 TGGAGAGAGGGGGCCTCATCTGG + Intronic
955071797 3:55577896-55577918 TTGAGAGAAGGGCTTTGCTGAGG + Intronic
955955862 3:64289133-64289155 TGCAGAGATGTGCCCTCCTTAGG + Intronic
956168175 3:66412286-66412308 GGGAGAGAAGGAACTTCCTGTGG + Intronic
957862238 3:85969037-85969059 TGGAGAGAAGTGCCCACTTTGGG - Intronic
960674782 3:120183404-120183426 TGGAGATTGGGGTCCTCCTGAGG + Intronic
961477259 3:127156724-127156746 TTCAGAGTAGGCCCCTCCTGTGG + Intergenic
961919325 3:130409361-130409383 TGGAGAGAAGGGCTTCCCAGGGG + Exonic
965165242 3:165188622-165188644 TCCAGAGAAGGCCCCTCCCGTGG - Exonic
965792840 3:172408251-172408273 TGGAGATCAGGGCTCTCCTGGGG - Intergenic
966077640 3:175957148-175957170 AGGAGAGTATGGCCCTCTTGTGG - Intergenic
966772597 3:183517425-183517447 AGCAGAGAATGCCCCTCCTGGGG - Intronic
967224196 3:187275276-187275298 TGGACAGAAGGGGCCGCCTTGGG + Intronic
968446255 4:653828-653850 TGGAGGGAGGGGCACACCTGTGG - Intronic
968641368 4:1716676-1716698 TGGAGAAGAGGGCACTGCTGTGG - Exonic
968966964 4:3773648-3773670 GGGCGGGAAGGGCACTCCTGGGG - Intergenic
969267335 4:6073182-6073204 TGGAGGGAAGGACACCCCTGAGG - Intronic
969711221 4:8845233-8845255 TGGAGAGAAAGGGCCTTCTGAGG + Intergenic
973141274 4:46771331-46771353 TGGAGAGAAGGGGTCCCCTTGGG + Intronic
973240729 4:47953765-47953787 TGGAGAGAGGATCCTTCCTGAGG - Intronic
975827215 4:78332276-78332298 TGGAGAGACTGGCCCTCCCGGGG - Intronic
977983655 4:103356949-103356971 TGGAGGGCAGGGTCCTGCTGTGG - Intergenic
985550665 5:531934-531956 TGGAGAGCTGAGCGCTCCTGGGG - Intergenic
985713111 5:1441523-1441545 AGGAGAGATGGGCCCTTCCGAGG - Intronic
986299606 5:6467630-6467652 TGGAAAGCAAGGCTCTCCTGTGG - Intronic
986593537 5:9396432-9396454 TAGAGAGACTGGCCCTCCTAGGG + Intronic
988582380 5:32479385-32479407 TGGTGAGAATGGCTTTCCTGGGG + Intergenic
989827284 5:45872837-45872859 TGGAGGGAAGGGCCTGCCTCTGG + Intergenic
990984289 5:61626697-61626719 TGCAGAGAAGGGGCCACCTTAGG + Intergenic
991520943 5:67495863-67495885 GGGAGAGAATGGGCCTGCTGGGG - Intergenic
994602671 5:101926641-101926663 TGGGGAGAATGGCCCTCCAAAGG + Intergenic
995623737 5:114055430-114055452 GGGAGGGAAGCGCCCTCCTGAGG + Intergenic
995627621 5:114096625-114096647 GGGAGAGAGGGACCTTCCTGGGG - Intergenic
996430575 5:123371637-123371659 TGGAGAGAAGGGCTCTCTGATGG + Intronic
997240426 5:132302515-132302537 TGGAGAGAATGGACGTTCTGGGG + Intronic
997437606 5:133886198-133886220 TGTAAAGAAGGGGCCTCTTGAGG - Intergenic
998658205 5:144205569-144205591 TGGAGAGATGTGCCCTGCTAGGG - Exonic
999073942 5:148777385-148777407 GGGACAGAAGGGCCCTGCTATGG - Intergenic
999600215 5:153254120-153254142 TGGAGAGAAATGCCTTCTTGGGG - Intergenic
999694179 5:154173651-154173673 TGGAGAGAGTGGCCTGCCTGAGG + Intronic
1001257285 5:170193528-170193550 TGCAGCCAAGGGCCCTCCAGTGG - Intergenic
1002814739 6:669254-669276 TGAAGATAAGGAACCTCCTGTGG + Intronic
1004158457 6:13191725-13191747 TGGGGAGACTGTCCCTCCTGGGG - Intronic
1004356387 6:14933179-14933201 GGGAGAGAAGACCCGTCCTGCGG - Intergenic
1006171962 6:32098115-32098137 TGAAGAGAAGGGGCCTGCTCTGG + Intronic
1006406075 6:33845835-33845857 TGGACAGATGGGCCGTGCTGTGG - Intergenic
1007193830 6:40041999-40042021 TTGGGTGCAGGGCCCTCCTGTGG - Intergenic
1007254179 6:40517061-40517083 TGGAAAGAACAGCCCTCCTGTGG + Intronic
1007273662 6:40657773-40657795 AGGAAAGAAGGGCTCTCCAGGGG - Intergenic
1007380751 6:41488691-41488713 TGGAGAGGAGGGCGGTCCAGGGG + Intergenic
1007778263 6:44236139-44236161 TGGGGAGCAGGGGCCTCCTCTGG + Intergenic
1007959864 6:45948949-45948971 TGGAGAGAAGGAACATACTGGGG + Intronic
1008770335 6:54971069-54971091 TGGAGAAAAGGGTCTTTCTGTGG - Intergenic
1010975429 6:82307275-82307297 TGGAGACAGAGGCTCTCCTGGGG - Intergenic
1015195437 6:130520694-130520716 TGGAGAGACTGCCCCTCCAGGGG + Intergenic
1015889680 6:137957632-137957654 TAAAGAGAAGGGCCTTGCTGAGG - Intergenic
1018247796 6:161839215-161839237 TGGAGAGAAAGGTGCCCCTGAGG + Intronic
1018487220 6:164253499-164253521 TGGAGATAAAGGGCTTCCTGAGG + Intergenic
1018907200 6:168082467-168082489 CGGACAGCAGGGACCTCCTGGGG - Intergenic
1019429506 7:992207-992229 TCCAGGGAAGGACCCTCCTGGGG + Intergenic
1019518746 7:1451162-1451184 TGGACAGCAGGGCCCTTCTGGGG + Intronic
1019747507 7:2709041-2709063 TGGAGAGAAGGGCACTCTCAGGG - Intronic
1020079055 7:5276737-5276759 TGGGGTGAAGGGCCCTGCTTGGG - Intronic
1020210255 7:6153765-6153787 AGCAGAGAGGGGCCCTCCCGAGG + Exonic
1021738435 7:23661700-23661722 TGGAGAGAATGGCCCTGTTTGGG + Intergenic
1022015951 7:26348333-26348355 TGAAGACAAGGGCAGTCCTGTGG - Intronic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1023852726 7:44159201-44159223 TGGAGCGTAAGGCCCGCCTGTGG + Exonic
1025199843 7:56955441-56955463 TGGGGTGAAGGGCCCTGCTCGGG + Intergenic
1025672103 7:63621491-63621513 TGGGGTGAAGGGCCCTGCTCAGG - Intergenic
1027546741 7:79536404-79536426 TGGAGATAAGGAGCCACCTGAGG - Intergenic
1027782125 7:82532650-82532672 TGGAGAGAAGGGGATTCTTGTGG - Intergenic
1032657064 7:133942163-133942185 TAGAGAGAAGGGCCTCCCTAAGG - Intronic
1032983955 7:137316701-137316723 AGGAGAGGAAAGCCCTCCTGGGG + Intronic
1033278465 7:139989729-139989751 TGCAGAGATGGGCCCGCATGGGG - Intronic
1033725101 7:144107520-144107542 TGAAGAGAATGGTCCTCCTTTGG + Intergenic
1036416115 8:8550236-8550258 TGGAAAGAAGAGTCATCCTGTGG - Intergenic
1036681552 8:10878059-10878081 TGCAGAGCAGAGCCCTTCTGGGG - Intergenic
1037623130 8:20584509-20584531 TGGAGAGAAGGTAAATCCTGGGG - Intergenic
1037865682 8:22440844-22440866 AGGAGAGAAGGGGCCGGCTGCGG + Intronic
1039448480 8:37651381-37651403 TGTAGGGGAGGGCCTTCCTGGGG - Intergenic
1039709109 8:40037664-40037686 TGGATAGAAGAACCCTCCTGAGG - Intergenic
1039957783 8:42220527-42220549 GGGAGTGAGGGCCCCTCCTGTGG - Intergenic
1040031803 8:42831836-42831858 AAAAAAGAAGGGCCCTCCTGGGG - Intergenic
1040031857 8:42832155-42832177 AGCTAAGAAGGGCCCTCCTGGGG - Intergenic
1040122662 8:43700095-43700117 TGGAGAGAGGGGCCAGCCTCAGG - Intergenic
1040915527 8:52564187-52564209 GGGACAGAAGGGCCCCTCTGCGG - Intronic
1043416296 8:80054003-80054025 TTGAGAGCAGGGATCTCCTGAGG - Intronic
1046694912 8:117329121-117329143 TGGAGAGTAGTGCCATCTTGTGG - Intergenic
1046902062 8:119534402-119534424 AGGAGAGAAGAGCCTGCCTGAGG + Intergenic
1046970808 8:120221212-120221234 TGTAGAAAAGGGCCCTGATGAGG - Intronic
1047833668 8:128663624-128663646 TGGAGAGAAGGGCTTTTATGAGG + Intergenic
1048445464 8:134489635-134489657 GAGAGAGAAGAGCCCTCCTGGGG - Intronic
1049017944 8:139934675-139934697 TGCAGGGATGGGGCCTCCTGTGG - Intronic
1049090518 8:140510875-140510897 TTGGGAGAAGAGCCTTCCTGCGG - Intergenic
1049644227 8:143728878-143728900 TGGCGAGGAGGGCCCTGGTGTGG + Intronic
1051337388 9:16078243-16078265 TGGAGAGAATGGCACACCTTTGG - Intergenic
1053417804 9:37957712-37957734 TGGAGCGCAGGGTCCTCGTGAGG + Intronic
1056753521 9:89368259-89368281 TGCAGAGAATGGCCCCTCTGGGG - Intronic
1060230049 9:121819509-121819531 TGGAGAGCTGGGCACTCCGGGGG - Intergenic
1060232554 9:121836449-121836471 CAGTGAGAAGGGACCTCCTGGGG - Intronic
1060414677 9:123421900-123421922 TGGAAAGAAGGGGCTTCTTGTGG - Intronic
1060794939 9:126507115-126507137 TGGTGACAAGAGCCCTGCTGGGG - Intergenic
1060926962 9:127461777-127461799 TGGCGAGCAGAGCGCTCCTGCGG - Intronic
1061131855 9:128712958-128712980 TGGAGAGGGTGGCCTTCCTGGGG + Intronic
1061572026 9:131483764-131483786 TGGTGAGATGGGGCCTCCTGAGG - Intronic
1062074350 9:134576377-134576399 TGCAGAGAAGGGCACTGCTCTGG + Intergenic
1062200300 9:135299373-135299395 TGCAGAGAACAGCGCTCCTGAGG + Intergenic
1062574043 9:137198358-137198380 TGGGGAGAAGGGGCCTTCGGAGG - Intronic
1185919816 X:4078733-4078755 GGGAGGGATGGCCCCTCCTGGGG + Intergenic
1186086869 X:6000266-6000288 TGCAGAAAAGGGACATCCTGTGG - Intronic
1189298957 X:39938221-39938243 TGGAGGGAAGGGACCCCCAGAGG - Intergenic
1198466263 X:136907317-136907339 TGGAGCGGCGGGCCCTCCTAAGG + Intergenic
1199990361 X:152984276-152984298 TTGAGAGAAGTGCCATCCTCGGG - Intergenic
1200033451 X:153313750-153313772 TTGAGAGAAGTGCCATCCTCGGG - Intergenic
1201520568 Y:14869219-14869241 TGGATAGAACGCCACTCCTGGGG - Intergenic