ID: 1103011426

View in Genome Browser
Species Human (GRCh38)
Location 12:117461289-117461311
Sequence CCTAACAAACAAACTCATTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103011420_1103011426 26 Left 1103011420 12:117461240-117461262 CCAGCCTGGGTGACAGAGCAAGA 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243
Right 1103011426 12:117461289-117461311 CCTAACAAACAAACTCATTGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
1103011421_1103011426 22 Left 1103011421 12:117461244-117461266 CCTGGGTGACAGAGCAAGACTCT 0: 9006
1: 40776
2: 94422
3: 151455
4: 150809
Right 1103011426 12:117461289-117461311 CCTAACAAACAAACTCATTGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
1103011422_1103011426 -10 Left 1103011422 12:117461276-117461298 CCACAACAACAAACCTAACAAAC 0: 1
1: 0
2: 5
3: 44
4: 470
Right 1103011426 12:117461289-117461311 CCTAACAAACAAACTCATTGGGG 0: 1
1: 0
2: 0
3: 17
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103011426 Original CRISPR CCTAACAAACAAACTCATTG GGG Exonic
903471505 1:23590876-23590898 ACAAACAAACAAAGGCATTGAGG - Intronic
906273633 1:44500562-44500584 CCTATCATACACGCTCATTGGGG - Intronic
908120042 1:60977520-60977542 CCCAACAAAAAAATACATTGTGG + Intronic
908736053 1:67278036-67278058 ACAAACAAACAAAATCATGGTGG + Intergenic
909562615 1:77023258-77023280 CCTAGCAAACTAATACATTGGGG + Intronic
909884643 1:80925557-80925579 CCTAACAAACTAATACATGGGGG + Intergenic
910824261 1:91389110-91389132 CCCAACAAAAAAACCCACTGGGG - Intronic
911388382 1:97206162-97206184 CCTAAAAAAAAAACTCAAAGGGG + Intronic
911679002 1:100692317-100692339 CCAAACACACAACCTCACTGGGG - Intergenic
912235826 1:107849455-107849477 CCTAACAAAAAAAAACAATGGGG + Intronic
912668322 1:111603035-111603057 CCCAACCATCAAACTCACTGAGG + Intronic
916899223 1:169202526-169202548 CCTAACACAGTAACTCAGTGAGG + Intronic
917151675 1:171952403-171952425 CCGAAAAAACAAACTCTTTGTGG - Intronic
917649971 1:177066668-177066690 CCCAAAATACAACCTCATTGAGG + Intronic
921587108 1:216960573-216960595 ACAAACAAACAAACACATGGAGG - Intronic
921605209 1:217144141-217144163 CATAACAAAGAAAGTCTTTGAGG - Intergenic
923275388 1:232390940-232390962 CCTCACAAACTCACTCATTCAGG + Intergenic
924133373 1:240936536-240936558 CCTAACTAACAAACGAAATGCGG + Intronic
1065735225 10:28745371-28745393 CCTAACTTCCAAACTCCTTGGGG - Intergenic
1065985186 10:30943878-30943900 ACAAACAAACAAACAAATTGCGG + Intronic
1066979723 10:42401157-42401179 TCTAAAAAGCTAACTCATTGTGG - Intergenic
1070617830 10:77982513-77982535 TCTAACAGACTAACTCCTTGGGG + Intronic
1070682922 10:78461866-78461888 CATTAGAAACAAATTCATTGTGG + Intergenic
1076106849 10:127830194-127830216 ACTTAGAAACAAAGTCATTGTGG - Intergenic
1082712396 11:56569298-56569320 ACAAACAAACAAACAAATTGGGG + Intergenic
1082913090 11:58399489-58399511 CCTATAAAACACACTCATTTAGG + Intergenic
1083626276 11:64073715-64073737 CCTCCCAAACACACTCCTTGGGG + Intronic
1089413519 11:118267155-118267177 CCTAACAAATATACCCATTGGGG + Intergenic
1089725044 11:120469703-120469725 CCTAGCAAACAAGCTCAGTGTGG - Intronic
1090752925 11:129763375-129763397 CCAAACACACAACCTCACTGGGG + Intergenic
1091161166 11:133422138-133422160 ACAAACAAACAAACACATCGGGG - Intronic
1092732647 12:11548491-11548513 CCTAGCAAACGAACCCAGTGTGG + Intergenic
1098504060 12:71228013-71228035 CCTACCAAACAAACTAAATAAGG + Intronic
1099310124 12:81009178-81009200 CCTGACAAAAAAACACATAGCGG + Intronic
1101412869 12:104483754-104483776 CCCAATAAACAAACTCACTAAGG - Intronic
1102725056 12:115055453-115055475 CCAAACCCAAAAACTCATTGAGG - Intergenic
1103011426 12:117461289-117461311 CCTAACAAACAAACTCATTGGGG + Exonic
1103521606 12:121539718-121539740 ACAAACAAACAAACACATTAGGG - Intronic
1104177842 12:126350437-126350459 CCTAAGAAAGACACTAATTGAGG - Intergenic
1105721469 13:23120004-23120026 CCAAACAAACAAACTCAAAATGG + Intergenic
1107685114 13:42889367-42889389 CCTAACATACACACTTATTGGGG + Intronic
1108662431 13:52599364-52599386 CAAAAGAAACAAACGCATTGAGG - Intergenic
1108804738 13:54140563-54140585 CATAACAAACACACTCCTTGTGG + Intergenic
1109784824 13:67159744-67159766 ACTAAAAAACAAATTCATTCAGG + Intronic
1109980666 13:69902099-69902121 TCTTATAAAAAAACTCATTGTGG - Intronic
1112823375 13:103362357-103362379 ACTAATAAACAAATTCAGTGAGG - Intergenic
1113559774 13:111269471-111269493 CCTGACAAACACACTCATTAAGG - Intronic
1114329113 14:21618166-21618188 CCAAACACACACCCTCATTGGGG - Intergenic
1117145678 14:52835100-52835122 CCTTAGAAACAAACTAATTGTGG + Intergenic
1117805073 14:59483150-59483172 CCTAACAAAAAAACTCTATGAGG + Intronic
1120052849 14:79888277-79888299 CATCATTAACAAACTCATTGTGG + Intergenic
1120278614 14:82410321-82410343 CTTAACAAATAAAGTCAGTGTGG - Intergenic
1120748505 14:88175307-88175329 CCCAAGAAACAAAATCATTCAGG + Intergenic
1121235518 14:92388966-92388988 ACAAACAAACAAACTCACTTTGG + Intronic
1121509444 14:94501511-94501533 CCTAACAAACACACAAGTTGGGG - Intronic
1121790017 14:96692149-96692171 CTGAAAAAACAAACTCATGGTGG + Intergenic
1125759134 15:42085095-42085117 CATCACCAACAAAGTCATTGTGG - Exonic
1127201107 15:56652080-56652102 ACTAAGAAACAAACTACTTGCGG + Intronic
1135944253 16:26851823-26851845 CCTCACAATCAAACACTTTGAGG - Intergenic
1137692288 16:50437368-50437390 GCAAACAAACAAACAAATTGAGG + Intergenic
1137866520 16:51902763-51902785 CATAAAAAGCAAACTCTTTGAGG + Intergenic
1138058752 16:53865050-53865072 CTTAACAAACCTACTCATTAAGG + Intronic
1140443655 16:75006418-75006440 ACAAACAAACAAACTGACTGAGG - Intronic
1141306472 16:82868918-82868940 CAAAACAAAAAAACTCACTGTGG + Intronic
1141711796 16:85703992-85704014 ACAAACAAACAAACACACTGGGG + Intronic
1142324775 16:89407517-89407539 CCTAAGAAACAAACTCCTTCTGG + Intronic
1145755662 17:27388456-27388478 CCTTCCAAAAAAACTCCTTGAGG - Intergenic
1147676890 17:42213206-42213228 CCTAAAAAAAAAAATAATTGTGG - Intronic
1149303791 17:55329388-55329410 CATAAGAGACAAACTCAGTGAGG - Intergenic
1149651201 17:58277751-58277773 GCTCACAAACAGACTCACTGTGG + Intronic
1164532685 19:29060248-29060270 ACAAACAAACAAACTCTATGAGG - Intergenic
1166154502 19:40900814-40900836 CCAAACAAACAAACGGACTGGGG - Intergenic
1166173611 19:41049776-41049798 CCAAACAAACAAACGGACTGGGG + Intergenic
1166803752 19:45473027-45473049 CAAAACAAACAAACACATGGGGG + Exonic
1167835508 19:52065151-52065173 CCTTACAACTAAACTCAATGTGG - Exonic
925528171 2:4827751-4827773 TGTAACAAACTAACTCATAGTGG + Intergenic
929029809 2:37639846-37639868 CCCAACAAAGAAACCCTTTGAGG - Intergenic
933228095 2:79774090-79774112 CTTAACTAACAAACTGGTTGTGG + Intronic
933623123 2:84567524-84567546 CCTAACAAAAACAATCAATGGGG + Intronic
935387745 2:102518870-102518892 ACAAACAAACAAACCCATTAAGG + Intronic
936987767 2:118327859-118327881 CCTAACAAACAAATATGTTGTGG - Intergenic
941743323 2:169059790-169059812 CCTGACAAAAAAAATCAATGGGG + Intergenic
942861178 2:180614154-180614176 CTGAACACACAACCTCATTGGGG - Intergenic
943331909 2:186570020-186570042 GCAAACAAACAAACACAATGGGG + Intergenic
945839127 2:214867468-214867490 CCTAACAAACAAGCGTAATGGGG + Intergenic
946096109 2:217275266-217275288 CATAATCAACAAACTCCTTGGGG - Intergenic
1171475284 20:25403871-25403893 ACTCACAAACACACTCTTTGTGG + Intergenic
1180591895 22:16946438-16946460 TACAAAAAACAAACTCATTGTGG + Intergenic
1181952799 22:26566775-26566797 ACAAACAAACAAACTCCTTAAGG + Intronic
1183131633 22:35842786-35842808 CAAAACAAAAAAACTCCTTGGGG - Intronic
952687208 3:36163541-36163563 CCAAAGAAACAATCTCCTTGAGG - Intergenic
955408895 3:58643155-58643177 GCTCACAAACAATCTCAATGTGG - Intronic
955755106 3:62218266-62218288 CCTAACAGACACAGTCATGGTGG - Intronic
956638750 3:71394469-71394491 CCTAGCAGACAAATTCATGGTGG - Intronic
956967522 3:74479272-74479294 CATAACAAATCAAGTCATTGTGG + Intronic
963159234 3:142133505-142133527 CCAAACAAACAAACTGCTTTTGG - Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
966603997 3:181803898-181803920 ACAAACAAACAAACACATTGTGG + Intergenic
968529538 4:1083662-1083684 ACAAACAAACAAACTCAGTGGGG + Intronic
969978841 4:11133124-11133146 CATAACAAACACTCTCATTTGGG + Intergenic
970207404 4:13668874-13668896 CCTAACAGATAAAATCTTTGTGG - Intergenic
972097421 4:35365016-35365038 CCGAACAAACATCCTCATTGGGG - Intergenic
972760451 4:42098047-42098069 TATAAAAGACAAACTCATTGTGG - Intergenic
977820316 4:101464158-101464180 CAAAACAAAAAGACTCATTGAGG - Intronic
984083290 4:175277415-175277437 ACAAACAAACAAACAAATTGTGG - Intergenic
985222728 4:187725289-187725311 CATAGAAAACAAACTCATTGAGG + Intergenic
986858009 5:11893940-11893962 ACTAAGTAACATACTCATTGAGG + Intronic
987138003 5:14917698-14917720 CATAACTAAAAAACGCATTGTGG + Intergenic
989088593 5:37703392-37703414 CCTCACAAACATGCCCATTGTGG - Intronic
989711139 5:44398788-44398810 CCTTACAAACAATTTCATTTTGG - Intergenic
993643153 5:90430617-90430639 CCTAATACACACACACATTGTGG + Intergenic
994339197 5:98605787-98605809 CCTAAGAAACAAATTAATTAAGG - Intergenic
994999213 5:107105983-107106005 CCTAAAAAACAAACCCAAGGAGG + Intergenic
995120204 5:108527975-108527997 CCTAACAAACACATTAAATGAGG + Intergenic
1000289421 5:159856211-159856233 ACCAACAAACAAGCTCATTCAGG + Intergenic
1002420417 5:179144060-179144082 GCTAACAAACAAATTAACTGAGG + Intronic
1011194323 6:84766311-84766333 CCTGAGAAACAAACTCAGTTGGG + Intergenic
1012231320 6:96763584-96763606 ACTTAAAAACAAAATCATTGGGG + Intergenic
1012381772 6:98628648-98628670 CCTGACAAGGAAACTCTTTGGGG + Intergenic
1012600339 6:101089042-101089064 CCTAACAAACAAAATCAGAAAGG - Intergenic
1012818623 6:104056693-104056715 CCTAACAAAAACAATCAATGGGG + Intergenic
1015548167 6:134383739-134383761 CCTAACAAACATAAACATTGGGG + Intergenic
1015711467 6:136146064-136146086 CCTAAATAACAAACTGATTTTGG + Intronic
1016195275 6:141328601-141328623 CAAAACAATCAAACTCATAGAGG + Intergenic
1018224743 6:161617506-161617528 CCTTTAAAACAGACTCATTGAGG + Intronic
1020578451 7:9964184-9964206 TAAAAAAAACAAACTCATTGAGG - Intergenic
1020968163 7:14899462-14899484 ACTAAATAACAAACTCTTTGGGG - Intronic
1021363736 7:19749978-19750000 TCTAACAATCAAAGTCATTTAGG - Intronic
1021707137 7:23378981-23379003 CTTACCACACCAACTCATTGTGG + Intronic
1022319801 7:29277909-29277931 CCTAACTTACAAGGTCATTGAGG - Intronic
1023139135 7:37083628-37083650 CCCAGCAAACAAACCCAATGTGG - Intronic
1023215349 7:37856540-37856562 CCTACCAAACGATCTCATTCTGG + Intronic
1024920812 7:54552631-54552653 ACTAAAATACAAACTCCTTGAGG - Intronic
1025006209 7:55356989-55357011 GCTAACAAAAAAACCCATGGAGG + Intergenic
1028517728 7:91697072-91697094 ACTAAGAAACAAACACTTTGAGG + Intronic
1029909401 7:104128823-104128845 CCTAAGACCCAAAGTCATTGTGG - Intronic
1033443911 7:141403952-141403974 CCTAGAAAACTAACACATTGGGG - Intronic
1034920958 7:155081433-155081455 CCCAATAAACAAATTCTTTGGGG - Intronic
1035407491 7:158609165-158609187 CCACAGAAACAAACTCTTTGGGG + Intergenic
1039101492 8:33946687-33946709 CCAAACAAACAAACCTTTTGTGG - Intergenic
1041729421 8:61049813-61049835 CCTAAAAAAAAGACTCATTATGG - Intergenic
1041841376 8:62275896-62275918 CTTAAGAAATAAACTTATTGAGG + Intronic
1042030581 8:64471584-64471606 CTTAAGAAACAAACTCATGGTGG + Intergenic
1044498585 8:92923062-92923084 CCTTACTAATAAACACATTGAGG + Intronic
1044857227 8:96488957-96488979 CCTCACAAACAAATTTTTTGTGG - Intergenic
1045736264 8:105299246-105299268 CCTAGCAAACTAACACATTGTGG - Intronic
1045760943 8:105606880-105606902 GCAAACAAACAAACAAATTGTGG - Intronic
1046226567 8:111287878-111287900 CTTAACAAACAACCTTAGTGAGG - Intergenic
1047007044 8:120631247-120631269 CCTAACACATAAACTCATGAGGG + Intronic
1047694235 8:127387036-127387058 CTTTACAAACAAAGTTATTGAGG + Intergenic
1049974713 9:850331-850353 CCAAAAAAACAAACACACTGTGG + Intronic
1052099870 9:24432544-24432566 GCTAACAAACAGACACAATGGGG - Intergenic
1052894482 9:33734628-33734650 CCAAACACACAACCTCACTGGGG + Intergenic
1056068064 9:82957655-82957677 CCCATCAAGCAAATTCATTGAGG + Intergenic
1059368375 9:113805211-113805233 CCTACCACACAGAGTCATTGTGG + Intergenic
1059649205 9:116299402-116299424 CCTAGCAGACAAATTTATTGTGG + Intronic
1059780129 9:117517494-117517516 CCTTCCAAACAAGCTCATTTGGG - Intergenic
1059819228 9:117953426-117953448 CATAACATACAAACTCCTTATGG - Intergenic
1059836558 9:118161113-118161135 CCTAAAAGACAAACTCAGAGAGG - Intergenic
1060286314 9:122256115-122256137 CATGAAAAAGAAACTCATTGTGG - Intronic
1060812818 9:126619467-126619489 CCCAACCATCAAACTCATTCAGG + Intronic
1062323676 9:136002773-136002795 CCTACCACACACACACATTGAGG - Intergenic
1188493782 X:30762292-30762314 CCTAAAAAATAAAATCATTGAGG + Intergenic
1193944685 X:87720890-87720912 GGTAACAAACAAGTTCATTGTGG - Intergenic
1194138478 X:90177909-90177931 ACTAACAAAGAAACTGAATGAGG - Intergenic
1196714973 X:118802063-118802085 CCTAACAAAGTAATTAATTGGGG - Intergenic
1197456702 X:126684831-126684853 CCTAACAGACTAACACATAGAGG + Intergenic
1198450759 X:136765336-136765358 CTTTACAAAGAAACTCATTCAGG - Intronic
1199706116 X:150426867-150426889 CCTAGCAAACTAATACATTGGGG - Intronic
1200484276 Y:3748146-3748168 ACTAACAAAGAAACTGAATGAGG - Intergenic