ID: 1103014979

View in Genome Browser
Species Human (GRCh38)
Location 12:117487310-117487332
Sequence TGTTAGTCAAAGATCATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103014979_1103014984 14 Left 1103014979 12:117487310-117487332 CCACCCATGATCTTTGACTAACA 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1103014984 12:117487347-117487369 TGCTTAAGGCGACAGTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 70
1103014979_1103014982 0 Left 1103014979 12:117487310-117487332 CCACCCATGATCTTTGACTAACA 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1103014982 12:117487333-117487355 TTTTTTTCTTCATCTGCTTAAGG 0: 1
1: 0
2: 8
3: 106
4: 1431
1103014979_1103014983 13 Left 1103014979 12:117487310-117487332 CCACCCATGATCTTTGACTAACA 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1103014983 12:117487346-117487368 CTGCTTAAGGCGACAGTCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103014979 Original CRISPR TGTTAGTCAAAGATCATGGG TGG (reversed) Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
905250442 1:36644847-36644869 TGTTTGGAAAAGATCATGGCGGG - Intergenic
905995602 1:42378767-42378789 TGTTAAACAAAAATTATGGGAGG + Intergenic
908839905 1:68269041-68269063 TGTTATTCAAACATCATAGAGGG - Intergenic
909419054 1:75442643-75442665 TGATAGCCAAGGATCATGGTGGG - Intronic
914177561 1:145292191-145292213 CGTTAGTAAAAGATAAGGGGAGG + Intronic
917289842 1:173460917-173460939 TGTTGGCCACAGAACATGGGCGG - Intergenic
918089247 1:181274256-181274278 TTTTGGTCTAGGATCATGGGTGG - Intergenic
919364701 1:196642929-196642951 TGTAATTCAAAGATCAAGAGTGG + Intergenic
919521851 1:198599018-198599040 TGGTGGTCAAAGTTCATGGTTGG + Intergenic
920287085 1:204888051-204888073 TGTTATTCACAGTTCATGGCCGG + Intronic
922629569 1:227091975-227091997 TGTTAGTCAAAGTGAAAGGGAGG - Exonic
922761848 1:228137937-228137959 TGTTTTTAAAAAATCATGGGAGG + Intergenic
924581664 1:245329311-245329333 TGTTAGTGGCAGATGATGGGCGG - Intronic
1064143100 10:12806643-12806665 TTTGAGTCAAGGATCAAGGGTGG - Intronic
1064346150 10:14534370-14534392 TGTTAGTCACAGCTCCAGGGCGG - Intronic
1064409845 10:15095927-15095949 TTTTGGTCAAAGATCATTGGAGG - Exonic
1064733562 10:18357716-18357738 GGATAGTCAAAGATCGTGAGAGG + Intronic
1067977900 10:51046707-51046729 TGTCAGTCAAAACCCATGGGTGG + Intronic
1072112011 10:92331431-92331453 TTTTAGGTAAAGATTATGGGGGG - Intronic
1072306686 10:94114381-94114403 TGTTAGCCTGAGATCCTGGGTGG - Intronic
1074838794 10:117327298-117327320 TGTTAAACAAAAATTATGGGAGG + Intronic
1076460198 10:130638041-130638063 TGTTGGGCAGAGATCATGGAAGG + Intergenic
1078033628 11:7780315-7780337 TGTTAGCCAGAGAATATGGGTGG - Intergenic
1078789635 11:14529365-14529387 TTTTATTCAATGAGCATGGGAGG - Intronic
1078862071 11:15257834-15257856 TGGAAGTCACAGATCAAGGGTGG - Intergenic
1079465916 11:20730784-20730806 TGTAAGACAAAGATGATGGCAGG + Intronic
1079695777 11:23480829-23480851 TATTAGTCAAAGATCAATTGTGG - Intergenic
1081622946 11:44629806-44629828 TGATAGTCAATGATCATTGCTGG + Intergenic
1083295356 11:61712416-61712438 TGTTAGCCTAAGACCCTGGGCGG + Intronic
1089764401 11:120752369-120752391 TGTCAGTATCAGATCATGGGGGG - Intronic
1091649530 12:2299558-2299580 ATTTTCTCAAAGATCATGGGGGG - Intronic
1092085565 12:5756524-5756546 TGCTGGTCAGAGATTATGGGTGG + Intronic
1092935600 12:13360798-13360820 GGTTAGTAAAAGATTCTGGGAGG - Intergenic
1092968970 12:13673153-13673175 TCTCAGTCAAAGATGAGGGGAGG + Intronic
1098427881 12:70386465-70386487 AGATAGGCAAAGATCATGGATGG + Intronic
1101991778 12:109491725-109491747 TGTTAATAAAAGATCCTGGAAGG + Intronic
1102976828 12:117212784-117212806 TGTTAGGCTCAGATCAAGGGTGG - Exonic
1103014979 12:117487310-117487332 TGTTAGTCAAAGATCATGGGTGG - Intronic
1105743322 13:23351785-23351807 TGTTAATCACACATCATGTGTGG - Intronic
1106446938 13:29842458-29842480 TGTCAGTAAAAGAGAATGGGAGG - Intronic
1109885451 13:68536577-68536599 TGTTAGTCATAGTACAGGGGAGG + Intergenic
1111697765 13:91646841-91646863 TGTCTGTCACAGAGCATGGGTGG + Intronic
1121874967 14:97442677-97442699 TGTCATGCAAAGATCCTGGGAGG - Intergenic
1122403369 14:101480874-101480896 TGTTAGTCAGGGCTCAGGGGCGG + Intergenic
1123830328 15:24129669-24129691 TCTTAGTCAAAAAACATGTGAGG + Intergenic
1123860355 15:24460079-24460101 TCTTAGTCAAAAAACATGCGAGG + Intergenic
1123863985 15:24498699-24498721 TCTTAGTCAAAAAACATGCGAGG + Intergenic
1126518835 15:49565725-49565747 TGATAGTTAAAGATCTTCGGTGG + Intronic
1127286403 15:57537408-57537430 TGTGAGTGAAAGATCAGAGGGGG + Intronic
1134188549 16:12103398-12103420 GGTTTGTCAAAGATCATTTGTGG - Intronic
1138126035 16:54439332-54439354 TGATAGAGATAGATCATGGGTGG + Intergenic
1138637044 16:58348264-58348286 TGTTAAACAAAAATCCTGGGAGG - Intronic
1139241903 16:65401723-65401745 TGTTAAACAAAAATTATGGGAGG - Intergenic
1139970543 16:70771416-70771438 TGTTTGTCCAGGATGATGGGGGG - Intronic
1149478004 17:56979439-56979461 TGTTGTTAAAAGATGATGGGGGG - Intronic
1151914787 17:77109627-77109649 TGTTAAACAAAAATCATAGGAGG - Intronic
1156469258 18:37367276-37367298 TGTTAGTCAAAGAGAGGGGGTGG + Intronic
1158551626 18:58440945-58440967 TGTTTGTCAAATATAAAGGGGGG + Intergenic
1161158509 19:2748064-2748086 TGATAAGCAAACATCATGGGTGG - Intergenic
1161623567 19:5312276-5312298 TGTCAGTGAAAGAGCATGGCAGG + Intronic
1161762908 19:6187554-6187576 TGCTGGTCAAGGAGCATGGGTGG + Intronic
1162906362 19:13826282-13826304 TATTGGTTAAGGATCATGGGTGG + Intronic
1168394766 19:56038554-56038576 AGTCACTCAAAGAACATGGGTGG + Intronic
1168416257 19:56170813-56170835 TTTTAGGGAAAGTTCATGGGAGG - Intergenic
924996520 2:366553-366575 TTTTAGTCAAAGATAGTAGGGGG - Intergenic
925904572 2:8532525-8532547 TGTTACTGAAAGGGCATGGGGGG + Intergenic
926238652 2:11068705-11068727 TGTGACACAAAGTTCATGGGAGG - Intergenic
928807043 2:35171382-35171404 CCTGAGTCAAAGATTATGGGTGG + Intergenic
929012562 2:37459831-37459853 TGATAGTAAAAGGTCATTGGTGG + Intergenic
930511627 2:52352661-52352683 TGTTCCTCAAAGTTCATGTGTGG + Intergenic
933060031 2:77725517-77725539 TGCTGGTCAAAGATCATTTGTGG - Intergenic
933275950 2:80284595-80284617 TGAATGTCAGAGATCATGGGAGG - Intronic
935727170 2:106033772-106033794 TATTAGTAAAAGATGATGGATGG + Intergenic
935828753 2:106977290-106977312 TGTTAGTCTTAGATCTTGGGAGG + Intergenic
936655809 2:114485627-114485649 TGTTAATCAAAGATCATGAGAGG - Intronic
940724342 2:157318887-157318909 TGTGATTCAAAGTTCAGGGGTGG - Exonic
943099172 2:183467500-183467522 TGTTAAACAAAGTTTATGGGAGG + Intergenic
944677326 2:202044574-202044596 TGTTAGTTAGATATCATGGAGGG + Intergenic
946978275 2:225177528-225177550 TGTTGGTCCAAGATCAAGGCTGG + Intergenic
948504054 2:238415903-238415925 TGCTAGGCATTGATCATGGGTGG + Intergenic
1171119290 20:22554415-22554437 TGTTAGCCAAAGGTCATGTGTGG - Intergenic
1172056696 20:32159158-32159180 TGTTACTCACAGCTCCTGGGAGG + Intronic
1172739560 20:37155126-37155148 AGTCAGTCAAAGACCATGAGCGG - Exonic
1174846655 20:53949436-53949458 TGTGAGACAAAGATCATGCAGGG + Intronic
1175512689 20:59543419-59543441 TGTTAAACAAAAATTATGGGAGG + Intergenic
1177530150 21:22347915-22347937 GGTTAGTCAAAGTTCATTGGTGG - Intergenic
1177531646 21:22366588-22366610 TGTAACTCAAAGATAATGTGAGG + Intergenic
1178271570 21:31194520-31194542 TGTTAAACAAAAATTATGGGAGG + Intronic
1181429255 22:22867990-22868012 TGATGGTCAGAGAGCATGGGTGG - Intronic
951075195 3:18382782-18382804 TGTTTGTCATAGAGGATGGGAGG - Intronic
953795463 3:45982399-45982421 ACTTGGCCAAAGATCATGGGTGG + Intronic
956604876 3:71064544-71064566 TGTGAGCCAAAGAGCAAGGGGGG + Intronic
956888585 3:73586566-73586588 TGTTAGGAAAAGATCAAGGAAGG - Intronic
957285241 3:78209181-78209203 TGTGAGTCAAAGGTCTTGGCAGG - Intergenic
957572867 3:81970407-81970429 TCTTAATCAAAGCCCATGGGAGG - Intergenic
957677528 3:83388884-83388906 GGTAAGACAAAGATCATGGATGG + Intergenic
958590648 3:96154529-96154551 TGTCAGCCAAAGAACATTGGTGG - Intergenic
959898049 3:111627472-111627494 TGTTGGCCATAGAACATGGGTGG - Intronic
961019597 3:123493962-123493984 TGTTAGTGAAAGCACATGGAAGG - Exonic
964899031 3:161635246-161635268 TGTTAAACAAAAATCATAGGAGG - Intergenic
965318617 3:167223432-167223454 TATAAGTCAAACATCCTGGGAGG + Intergenic
970445118 4:16116895-16116917 TGTTAGTCAAGGCTCAAGGAAGG - Intergenic
972634933 4:40875225-40875247 TGGGAGTTAAAGATCAGGGGTGG + Intronic
973791869 4:54385334-54385356 TGTTAGGCAAAGAGGATGGCAGG + Intergenic
978750539 4:112241433-112241455 TGTAAGTCTCAGTTCATGGGCGG + Intronic
979900916 4:126217235-126217257 TGTTAAACAAAAATTATGGGAGG - Intergenic
988020785 5:25617836-25617858 TGTTATTCATATATCATGGTTGG - Intergenic
990148589 5:52790244-52790266 TTTTAGTCAAAAATCTTTGGTGG + Intronic
992324819 5:75650376-75650398 TGTGAGCCAAAGAACATAGGAGG + Intronic
993679388 5:90856788-90856810 TTATAATCAAATATCATGGGTGG - Intronic
994386598 5:99140759-99140781 TGTTAGTCAATGAATTTGGGAGG + Intergenic
1000393909 5:160752818-160752840 TGTTAGTCAAAGAACATTTGGGG + Intronic
1000693572 5:164352319-164352341 TATTAGACAAAGGCCATGGGCGG + Intergenic
1004906542 6:20241995-20242017 TGTTAAACAAAAATCATGGGAGG - Intergenic
1005271586 6:24170336-24170358 TGTCACTCAAACTTCATGGGAGG + Intergenic
1006086398 6:31598756-31598778 TGGTGGTCAGAGAGCATGGGAGG + Intergenic
1007930144 6:45683381-45683403 TGTTAGTCAAAGAGATTGGTGGG + Intergenic
1008348361 6:50457480-50457502 TGTCAGTCAAACACCATAGGTGG - Intergenic
1009880003 6:69554953-69554975 TGTAAGCCAGAGATCCTGGGAGG - Intergenic
1011482723 6:87811207-87811229 TGCTATTCAAATATCATGTGAGG - Intergenic
1012690040 6:102299046-102299068 TGGAACTGAAAGATCATGGGAGG + Intergenic
1013015017 6:106153068-106153090 TGTTAGTCAACTTTCTTGGGTGG + Intergenic
1020531465 7:9342555-9342577 ATTTAGTCCAAGATCTTGGGAGG - Intergenic
1020836675 7:13161776-13161798 TATTAGTCAAATATAATGGCAGG + Intergenic
1028722218 7:94046601-94046623 TGTTGCTCAAAGACCATGTGAGG + Intergenic
1030777406 7:113551870-113551892 TGTTAGTCAAAAAACATGTTTGG - Intergenic
1032543178 7:132721227-132721249 TGTTACTCAAAGATCAGCGGTGG - Intronic
1035094587 7:156343173-156343195 TGTTACTCAAAGAACATGAGAGG + Intergenic
1035185548 7:157123169-157123191 TGTTACTCACAGATCCTGAGAGG - Intergenic
1036100976 8:5784575-5784597 TGTTAAACAAAAATTATGGGAGG - Intergenic
1036280417 8:7395596-7395618 TGTTTGATAAAGATCAAGGGAGG + Intergenic
1036341053 8:7915974-7915996 TGTTTGATAAAGATCAAGGGAGG - Intergenic
1040793273 8:51258781-51258803 TGTTTCTCAAAGATATTGGGGGG + Intergenic
1040957806 8:52997234-52997256 TGTTAAACAAAGTTTATGGGAGG - Intergenic
1041623455 8:59999534-59999556 TGTCAGCCAAAGAACATGAGTGG - Intergenic
1042584116 8:70316518-70316540 TGTTAAACAAAAATTATGGGAGG + Intronic
1046838012 8:118824744-118824766 TGTAAGTCCAAGATCAAGGCAGG - Intergenic
1052537557 9:29766499-29766521 TGTTTGTCAAAGATCAAAGTGGG + Intergenic
1052750931 9:32489795-32489817 TTTTCTTCAAAGATCGTGGGAGG - Intronic
1058919236 9:109597514-109597536 TATCAGTCAAACATAATGGGTGG - Intergenic
1058999625 9:110335150-110335172 TGTCAGTTAGGGATCATGGGAGG - Intronic
1187017774 X:15347302-15347324 TCTTCGTCAAACATCATGTGTGG + Exonic
1188072155 X:25730067-25730089 TGTTGGTCAGAAATCATGGCAGG + Intergenic
1188422337 X:30005291-30005313 TGTTAGTGAAAGATGAAGGGGGG - Intergenic
1190693193 X:52929457-52929479 GGTTTGTCAAAGATCAGAGGTGG - Intronic
1197122205 X:122906187-122906209 TGTTAGCCACAGATCACTGGCGG - Intergenic
1199460231 X:148075855-148075877 TGTGAGCCAAAGACTATGGGTGG + Intergenic
1199546764 X:149014190-149014212 AGTTAGTCCAAGGTAATGGGTGG + Intergenic