ID: 1103019553

View in Genome Browser
Species Human (GRCh38)
Location 12:117523003-117523025
Sequence AACTCTGCACAAGACAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103019553_1103019557 10 Left 1103019553 12:117523003-117523025 CCACTTCTGTCTTGTGCAGAGTT 0: 1
1: 0
2: 0
3: 21
4: 258
Right 1103019557 12:117523036-117523058 ATTTTTACCCTGATTTAAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 175
1103019553_1103019555 7 Left 1103019553 12:117523003-117523025 CCACTTCTGTCTTGTGCAGAGTT 0: 1
1: 0
2: 0
3: 21
4: 258
Right 1103019555 12:117523033-117523055 ACCATTTTTACCCTGATTTAAGG 0: 1
1: 0
2: 3
3: 18
4: 178
1103019553_1103019558 15 Left 1103019553 12:117523003-117523025 CCACTTCTGTCTTGTGCAGAGTT 0: 1
1: 0
2: 0
3: 21
4: 258
Right 1103019558 12:117523041-117523063 TACCCTGATTTAAGGAGGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 95
1103019553_1103019561 18 Left 1103019553 12:117523003-117523025 CCACTTCTGTCTTGTGCAGAGTT 0: 1
1: 0
2: 0
3: 21
4: 258
Right 1103019561 12:117523044-117523066 CCTGATTTAAGGAGGCTTGGAGG 0: 1
1: 0
2: 2
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103019553 Original CRISPR AACTCTGCACAAGACAGAAG TGG (reversed) Intronic