ID: 1103019554

View in Genome Browser
Species Human (GRCh38)
Location 12:117523031-117523053
Sequence TTAAATCAGGGTAAAAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103019554_1103019561 -10 Left 1103019554 12:117523031-117523053 CCACCATTTTTACCCTGATTTAA 0: 1
1: 0
2: 1
3: 28
4: 289
Right 1103019561 12:117523044-117523066 CCTGATTTAAGGAGGCTTGGAGG 0: 1
1: 0
2: 2
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103019554 Original CRISPR TTAAATCAGGGTAAAAATGG TGG (reversed) Intronic