ID: 1103019561

View in Genome Browser
Species Human (GRCh38)
Location 12:117523044-117523066
Sequence CCTGATTTAAGGAGGCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103019553_1103019561 18 Left 1103019553 12:117523003-117523025 CCACTTCTGTCTTGTGCAGAGTT 0: 1
1: 0
2: 0
3: 21
4: 258
Right 1103019561 12:117523044-117523066 CCTGATTTAAGGAGGCTTGGAGG 0: 1
1: 0
2: 2
3: 11
4: 140
1103019554_1103019561 -10 Left 1103019554 12:117523031-117523053 CCACCATTTTTACCCTGATTTAA 0: 1
1: 0
2: 1
3: 28
4: 289
Right 1103019561 12:117523044-117523066 CCTGATTTAAGGAGGCTTGGAGG 0: 1
1: 0
2: 2
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103019561 Original CRISPR CCTGATTTAAGGAGGCTTGG AGG Intronic
904208169 1:28868511-28868533 GCTGCTCTAAGGAGGCTTGCTGG + Intergenic
904465786 1:30706889-30706911 CCTGATTTAAGGAGTCTCCAGGG - Intergenic
904498796 1:30902404-30902426 CCAGATTCCAGGAGGCCTGGTGG - Intronic
907422302 1:54355682-54355704 CCAAATTTAAGGAGGCTTCTTGG + Intronic
908027504 1:59968441-59968463 CCTGCTGTCAGGACGCTTGGAGG + Intergenic
911733009 1:101309268-101309290 CTTGTTTTAAGGAGGCCTGCAGG + Intergenic
912367466 1:109146509-109146531 CCAGATTCAAGGAGGCTGGAGGG + Intronic
913088302 1:115458994-115459016 CCTGGTTTCAGGAGCCCTGGGGG - Intergenic
915565654 1:156711250-156711272 CCTGCTATAAGGAGGGGTGGGGG - Intergenic
916146415 1:161744125-161744147 CCTGATTGCAGGAGGCAAGGAGG - Intergenic
916472975 1:165141743-165141765 TCTGAATTAAGTGGGCTTGGGGG + Intergenic
919887491 1:201945572-201945594 GATCATTTCAGGAGGCTTGGGGG - Intronic
922073928 1:222223363-222223385 CATGATTTGATGAGGCCTGGGGG + Intergenic
1067404221 10:46006278-46006300 CCCAATCTAAGGAGCCTTGGAGG + Intronic
1067452234 10:46388884-46388906 CCAGATTTAAGTAGTCCTGGCGG + Intronic
1067585003 10:47470871-47470893 CCAGATTTAAGTAGTCCTGGCGG - Intronic
1067945550 10:50686101-50686123 CCTGCTTTAGGGAGGCTTCTTGG + Intergenic
1069384022 10:67868001-67868023 CCTTGTTTAAGGAAGTTTGGGGG - Intergenic
1070867061 10:79712974-79712996 CCTGCTTTAGGGAGGCTTCTTGG + Intronic
1070880851 10:79851095-79851117 CCTGCTTTAGGGAGGCTTCTTGG + Intergenic
1071633975 10:87235197-87235219 CCTGCTTTAGGGAGGCTTCTTGG + Intronic
1071647423 10:87367414-87367436 CCTGCTTTAGGGAGGCTTCTTGG + Intronic
1072305163 10:94100314-94100336 CCTGATTTAGGGAGGGTGAGGGG - Intronic
1074681250 10:115909990-115910012 CCTGATTTGGGGAGGAGTGGAGG + Intronic
1080724286 11:34879956-34879978 CCTGCTTTAAAGAAACTTGGTGG + Intronic
1081851850 11:46279362-46279384 CCGGAGTCAAGGAGGCATGGGGG + Intronic
1084962561 11:72724983-72725005 TCTGAGTTCAGGAGGCTTGCTGG - Intronic
1085167632 11:74417416-74417438 CCTGTTTTAAAGAGGCTTCTTGG - Intergenic
1086130158 11:83393047-83393069 CCAGATTTAAGGAGGCAAGAGGG - Intergenic
1088585298 11:111355772-111355794 CCGGATTTCAGGAGGCTGGAAGG - Intronic
1091132154 11:133155555-133155577 GGTGAAGTAAGGAGGCTTGGGGG - Intronic
1091294028 11:134459913-134459935 CCTGATGGGAGGAGCCTTGGAGG + Intergenic
1093305764 12:17515549-17515571 CTGGAGTTAAGGTGGCTTGGAGG - Intergenic
1093799031 12:23349445-23349467 GATGATTTAAGGAGGTTAGGAGG + Intergenic
1094245126 12:28282247-28282269 GATGATTTAAGGAGCATTGGGGG + Intronic
1100773738 12:97951935-97951957 ACTGAGTTAGGGAGGCTTAGTGG + Intergenic
1102349806 12:112184115-112184137 GAAGATTTAAAGAGGCTTGGGGG + Intronic
1102608725 12:114091983-114092005 CATGGCTAAAGGAGGCTTGGAGG - Intergenic
1103019561 12:117523044-117523066 CCTGATTTAAGGAGGCTTGGAGG + Intronic
1105321207 13:19323942-19323964 CAAGAGTGAAGGAGGCTTGGTGG - Intergenic
1106160784 13:27199545-27199567 CTTGATTTATGGAGGCTGAGAGG - Intergenic
1108097448 13:46918667-46918689 CCTGAATCCAGGAGGCTGGGAGG - Intergenic
1108706382 13:52992173-52992195 CGTGATTTAATGAGGCTTGGAGG + Intergenic
1111137459 13:84067005-84067027 CCTGATTTAGGGAGGATGAGAGG - Intergenic
1111353657 13:87067457-87067479 CATGATTTGAGGAGGCTGAGAGG - Intergenic
1114509780 14:23248738-23248760 CCTTATAAAAAGAGGCTTGGGGG - Intronic
1117194425 14:53325364-53325386 TCTTTTTTCAGGAGGCTTGGTGG + Intergenic
1118448887 14:65879280-65879302 CCCAATCTAAGGAGACTTGGAGG + Intergenic
1119755677 14:77117489-77117511 CCTGTTTTCTGGAGCCTTGGAGG + Intronic
1125579438 15:40775209-40775231 CCAGATTGCAGGAGCCTTGGAGG - Intronic
1129513039 15:76138911-76138933 CTTGATTTCATGGGGCTTGGTGG + Intronic
1132816328 16:1829058-1829080 CCGGAGATAAGGAGGCTTTGTGG + Intronic
1135055471 16:19228431-19228453 CCTGATTTAAGGGGGCAGGCAGG - Intronic
1136022284 16:27447877-27447899 CCTGAGTCAAGGAGACATGGGGG - Intronic
1137751527 16:50864414-50864436 CCTGCTGGATGGAGGCTTGGAGG + Intergenic
1138103735 16:54275477-54275499 CCTGGTGGAAGGAGGCTTTGGGG - Intergenic
1138802782 16:60055012-60055034 ACTAAGTTAAGGTGGCTTGGAGG - Intergenic
1138859123 16:60733810-60733832 CCTAATTTATGGAGGTTTTGGGG + Intergenic
1139363472 16:66418377-66418399 CTTGATTTAAGGAAGCTCGGAGG + Intergenic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139609322 16:68043815-68043837 CCTAAATTAAGCAGGCATGGGGG - Intronic
1141761622 16:86032556-86032578 CCTGAATTAAGGATGCTTCGTGG - Intergenic
1146785294 17:35714989-35715011 CCAGATATAAGGAGGCTTCCTGG - Intronic
1150319710 17:64202372-64202394 GCAGAATTAGGGAGGCTTGGAGG - Intronic
1150328352 17:64274646-64274668 CCTGGTTTCCGGAGGCTGGGAGG + Intergenic
1151517052 17:74603322-74603344 CCTTATTTCACTAGGCTTGGAGG - Intergenic
1153891674 18:9522310-9522332 CCAGATTTGAAGAGGCTTGTGGG + Exonic
1155529611 18:26753637-26753659 ACAGAATTATGGAGGCTTGGTGG + Intergenic
1156048963 18:32908585-32908607 CCTGACTTTAGGAGGCATGCAGG + Intergenic
1157374883 18:47153369-47153391 CCTGCTTTAGGGAGGGTGGGAGG - Intronic
1158028001 18:52925887-52925909 ACAGATTTAAGGAGGATTGAGGG + Intronic
1161794371 19:6378079-6378101 CTTCATGTAAGGAGGCTGGGTGG - Intronic
1162533378 19:11248633-11248655 CCTGGTGTAAGGAGCCATGGTGG + Intronic
1164849555 19:31470313-31470335 CTTTATTTAAAGTGGCTTGGGGG - Intergenic
1165783069 19:38444914-38444936 TCTGAGTTTAGGAGCCTTGGGGG - Intronic
925483892 2:4306272-4306294 ATTGATTTTAGGATGCTTGGTGG + Intergenic
925882268 2:8362815-8362837 TCTGATGTAAGGATACTTGGAGG + Intergenic
938153749 2:128909937-128909959 CCTCACTGAAGGAGGCTGGGGGG - Intergenic
940020094 2:149147153-149147175 TCTGCTTCCAGGAGGCTTGGGGG + Intronic
940108506 2:150125197-150125219 TCTGATTAAAGTGGGCTTGGGGG + Intergenic
942939957 2:181605238-181605260 CCTGAGTTAAGGAGAACTGGGGG + Intronic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
947914156 2:233820920-233820942 CATGATTTAATGAGGCTCAGTGG + Intronic
1169936515 20:10889574-10889596 CCTTTTTTAAGCAGGCTTTGAGG + Intergenic
1172240728 20:33410999-33411021 CCTGAGGTAAGGAGACATGGGGG + Intronic
1172808370 20:37629581-37629603 ACTGCTTTAAGGAGGCTGAGAGG + Intergenic
1174131177 20:48344250-48344272 CCTTAGTTAATGAGGCTTCGAGG - Intergenic
1179104310 21:38384279-38384301 CCAGCTGCAAGGAGGCTTGGAGG + Intronic
1179771845 21:43625702-43625724 GCTGATTTGCAGAGGCTTGGGGG - Intronic
1182455514 22:30447910-30447932 GCCTATTTAAGGAGGCTTTGGGG + Intergenic
1182769451 22:32783553-32783575 TCGGATTTAAGGGGGCTTAGAGG + Intronic
1183237816 22:36632843-36632865 GCTGAGATAAGGAGGCTTGAAGG - Intronic
1184696078 22:46139824-46139846 CCTGAGTTAAGGCGGGTGGGGGG - Intergenic
1184962557 22:47942005-47942027 GCTGGTTTAAGGGGGCTTGGGGG + Intergenic
1185288828 22:50014180-50014202 CCTGGTATAAGGAGGGCTGGAGG - Intergenic
950404980 3:12798561-12798583 CCTGTTTTCCGGAGGCTTGGAGG + Intronic
956943151 3:74187551-74187573 TATGATTTAAAGAGGCTTTGAGG + Intergenic
963779717 3:149475097-149475119 CCTGATTTAAAAAGGATTGTGGG - Intronic
970801598 4:19978791-19978813 CATGCTTGAAGGAGGCTTGGGGG + Intergenic
972344195 4:38179023-38179045 CCTGATTTCCTGTGGCTTGGTGG + Intergenic
975525223 4:75341421-75341443 CCTGTTGCAATGAGGCTTGGTGG + Intergenic
975814945 4:78207817-78207839 CCTGAATTGAGAAGGCTTGATGG - Intronic
975992438 4:80270896-80270918 TCTGATTTATCTAGGCTTGGGGG - Intronic
976938417 4:90668322-90668344 CCCCATTGAAGGATGCTTGGAGG - Intronic
981225971 4:142294694-142294716 CCTCATTTATGGTGGCTTGTGGG - Intronic
981517300 4:145623844-145623866 CCTGATCTAAGGAGCCTTGGAGG + Intronic
983732394 4:171011847-171011869 CAAGAGTGAAGGAGGCTTGGTGG + Intergenic
984620691 4:181949107-181949129 CATGAGTTAAGGTTGCTTGGAGG - Intergenic
987790985 5:22567373-22567395 CCTGCTTTAAGGAAGCCTGAGGG + Intronic
989346222 5:40432855-40432877 ACAGAATTAAGGAGGCTTTGAGG - Intergenic
997471322 5:134118708-134118730 CCTGATTGATGTAGGCTTGCAGG + Intronic
998110293 5:139496414-139496436 CCCAATCTAAGGAGACTTGGAGG - Intergenic
998936645 5:147236129-147236151 CTTTATCTAGGGAGGCTTGGTGG + Intronic
999711243 5:154320482-154320504 CTTGATTGAAGCAGGGTTGGGGG - Intronic
999816206 5:155178887-155178909 CCTCATTTATGCAGGCATGGGGG + Intergenic
1005671786 6:28113666-28113688 CCTGACTTCTGGAGGCTTGAAGG - Intergenic
1005820725 6:29596520-29596542 CTTGAGTTAAGGGGGCGTGGAGG - Intronic
1006010511 6:31039100-31039122 CCTGATTTCAGTGGGCATGGTGG - Intergenic
1008985019 6:57531762-57531784 TCTGATGAATGGAGGCTTGGAGG - Intronic
1010999379 6:82570655-82570677 CCTGCTTTAAGAAGGCTTCCTGG - Intergenic
1013687870 6:112606882-112606904 CTTGATCTAAGGAGGCCAGGAGG + Intergenic
1016995818 6:149961987-149962009 CATGATTTAAGGGTGGTTGGAGG - Intergenic
1017799287 6:157878087-157878109 CCTAATTTCAGGTTGCTTGGGGG + Intronic
1019002249 6:168763963-168763985 CAAGAGTGAAGGAGGCTTGGAGG - Intergenic
1021531926 7:21656374-21656396 CTTGTTTTAAAGAGGCTTTGTGG + Intronic
1022322598 7:29301209-29301231 CCTCATTTAAGGATGCATGAGGG - Intronic
1023207590 7:37767486-37767508 TATGATTTAAGGAGTTTTGGGGG - Intronic
1030856456 7:114563498-114563520 CCTGATTTAACTGGGCTTGGTGG - Intronic
1030859153 7:114602620-114602642 CAGGATTTAAGGAGGCTTTGGGG - Intronic
1033587249 7:142783179-142783201 CTGAATTTAAGGAGTCTTGGGGG + Intergenic
1034257906 7:149734429-149734451 CCTGATCTCAGGAGCCTTGAAGG + Exonic
1035330690 7:158095147-158095169 GCTGATTGCAGGAGGCTTTGGGG - Intronic
1041976642 8:63806597-63806619 GCTGATTTTAGAAGTCTTGGAGG + Intergenic
1044160725 8:88911625-88911647 CCTTGTTTAAGGACTCTTGGTGG + Intergenic
1048628981 8:136219781-136219803 ACTGACTTAAGGTGGCTTGCTGG + Intergenic
1049233088 8:141494354-141494376 CCTGCTTGATGGAGACTTGGGGG - Intergenic
1056311785 9:85348329-85348351 GCTGGTTTAAGGAGGATTTGAGG - Intergenic
1057353377 9:94317954-94317976 CCTGCTTTAGGGAGGCTTCTCGG - Intergenic
1057457755 9:95229572-95229594 ACTGAGTTAAGGAAGCCTGGAGG + Intronic
1057502984 9:95610605-95610627 CCTGAGTAACTGAGGCTTGGCGG + Intergenic
1057504869 9:95625842-95625864 CCTGATTTCTGGAAGCCTGGGGG - Intergenic
1057654374 9:96939638-96939660 CCTGCTTTAGGGAGGCTTCTCGG + Intronic
1057879159 9:98780155-98780177 CCTGTCTTAAAGGGGCTTGGGGG - Intronic
1059246086 9:112850758-112850780 CTTGATTTGGGGAGGCGTGGGGG + Intronic
1061485966 9:130920678-130920700 TCTGGTTTAAGGAGGTTTGGCGG - Intronic
1061684949 9:132267939-132267961 CTTGATTAAAGGAGGCTTTGTGG - Intronic
1186124597 X:6399498-6399520 CCTGATTTTGGAAGGCTTTGAGG - Intergenic
1186221226 X:7351411-7351433 CCTGATTTACAGGGGCTTGGGGG - Exonic
1186313872 X:8348175-8348197 CCTTACTTAAGGGGGATTGGGGG + Intergenic
1187037949 X:15562095-15562117 TCTGTGTTAAGGAGGCTGGGAGG + Intronic
1187426310 X:19180435-19180457 CCTGGTTCAAGGATGCTGGGTGG - Intergenic
1188514294 X:30968699-30968721 CCTGTTTTAATGAGGATTGGGGG - Intronic
1189017897 X:37303217-37303239 CCTGTTTTAGAGAGGATTGGGGG + Intergenic
1190299350 X:49047517-49047539 GGTGATTGAAGGTGGCTTGGGGG + Intergenic