ID: 1103023466

View in Genome Browser
Species Human (GRCh38)
Location 12:117555100-117555122
Sequence CTGGGTGAGGGGTAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1561
Summary {0: 1, 1: 1, 2: 10, 3: 138, 4: 1411}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103023466_1103023476 7 Left 1103023466 12:117555100-117555122 CCTCCCTCCTACCCCTCACCCAG 0: 1
1: 1
2: 10
3: 138
4: 1411
Right 1103023476 12:117555130-117555152 AGCCCCACATGCCGAGACCCAGG 0: 1
1: 0
2: 0
3: 12
4: 141
1103023466_1103023477 8 Left 1103023466 12:117555100-117555122 CCTCCCTCCTACCCCTCACCCAG 0: 1
1: 1
2: 10
3: 138
4: 1411
Right 1103023477 12:117555131-117555153 GCCCCACATGCCGAGACCCAGGG 0: 1
1: 0
2: 2
3: 11
4: 112
1103023466_1103023479 9 Left 1103023466 12:117555100-117555122 CCTCCCTCCTACCCCTCACCCAG 0: 1
1: 1
2: 10
3: 138
4: 1411
Right 1103023479 12:117555132-117555154 CCCCACATGCCGAGACCCAGGGG 0: 1
1: 0
2: 0
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103023466 Original CRISPR CTGGGTGAGGGGTAGGAGGG AGG (reversed) Intronic
900093589 1:931137-931159 CACGGTCAGGGGTGGGAGGGAGG - Intronic
900180505 1:1308997-1309019 CCCGGTGAGGGGTAAGGGGGAGG + Intronic
900194910 1:1371258-1371280 CTGGGTGAGGGGCCAGAGGTGGG - Intergenic
900213996 1:1471613-1471635 CGGGGTGAGCGGGCGGAGGGCGG - Intergenic
900754014 1:4420991-4421013 CTGGATGAGGGCTGGCAGGGTGG - Intergenic
900855775 1:5182066-5182088 TGGGGTGGGGGGTAGGGGGGAGG - Intergenic
901197799 1:7449948-7449970 GTGGCTTGGGGGTAGGAGGGAGG + Intronic
901453959 1:9352825-9352847 CTGGGGGAGGGAGGGGAGGGTGG - Intronic
901459748 1:9384450-9384472 ATGGGAGAGGAGGAGGAGGGTGG - Intergenic
901638882 1:10683220-10683242 CTGGGTTAGGAGTAGGTGTGGGG + Intronic
901813079 1:11778813-11778835 GAAGGTGAGAGGTAGGAGGGTGG + Exonic
902079884 1:13813705-13813727 GTGGATGAGGGGTAGCAGAGGGG + Intronic
902291770 1:15440228-15440250 CGGGGAAAGGGGTGGGAGGGTGG - Intronic
902613688 1:17612065-17612087 ATGGGTGAAGGGTAAAAGGGAGG - Intronic
902682975 1:18056770-18056792 CTGGGCCAGGATTAGGAGGGAGG + Intergenic
902813722 1:18904210-18904232 TTGGGGGAGGGGTAGGAGGACGG - Intronic
902857707 1:19221159-19221181 CTGGGGGAGGTATGGGAGGGAGG - Intronic
902939936 1:19793719-19793741 CTGGAGGAGGGGCAGGAGGGTGG + Intronic
902943894 1:19820053-19820075 CTTGGTGAGGGGTGGGGGTGGGG - Intergenic
903280851 1:22249033-22249055 CTGGGTGTGGGGCAGGGGGGAGG + Intergenic
903424399 1:23242887-23242909 CTGGGGTAGGGGTGAGAGGGAGG + Intergenic
903572860 1:24319238-24319260 CTTGGTGAGGGGGTGGGGGGTGG - Intergenic
903606462 1:24578460-24578482 TTGGGAGTGGGGTGGGAGGGAGG + Intronic
903815171 1:26059611-26059633 TTGGGCGAAGGGTAGGAAGGAGG - Intronic
903906142 1:26688403-26688425 TTGGGTGGGGGGTCGGGGGGGGG - Intergenic
903959065 1:27045104-27045126 CTGGGGGTGGGATAGGAGGTAGG + Intergenic
904313893 1:29647331-29647353 CTGGGTGAGGGACCGGAGGCAGG + Intergenic
904338120 1:29810968-29810990 ATGTGTGAGGCGAAGGAGGGTGG + Intergenic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
904790397 1:33016026-33016048 CTGGGTTATGGGCAGGAGGGAGG + Intronic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
905075819 1:35269278-35269300 CTGGGTGGGGGGGAGGGGAGGGG + Intronic
905175601 1:36133736-36133758 CTAGAGGAGGGGTGGGAGGGTGG - Intergenic
905255836 1:36683654-36683676 TGGGGTGGGGGGAAGGAGGGAGG - Intergenic
905806701 1:40882423-40882445 CTGAGAGATGGGGAGGAGGGGGG + Intergenic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906211910 1:44016826-44016848 GGGGGTGAGGGGGAGGAGAGTGG - Intronic
906528255 1:46508912-46508934 CTGGGGCAGGGGAAGGAGTGGGG - Intronic
907417688 1:54325951-54325973 CTGGGTGGGGGGTGGCGGGGGGG - Intronic
907794504 1:57701542-57701564 CAGGGGTAGGGGGAGGAGGGAGG + Intronic
908474586 1:64474911-64474933 CTGGATGAGGCCTGGGAGGGAGG + Intronic
908525140 1:64980715-64980737 GTGGGGTAGGGGGAGGAGGGTGG - Intergenic
909285214 1:73807538-73807560 GTGGGGTAGGGGTAGGGGGGAGG + Intergenic
909778255 1:79511399-79511421 TGGGGTGGGGGGGAGGAGGGAGG - Intergenic
909948712 1:81693342-81693364 ATGGTTGAGGGAGAGGAGGGAGG - Intronic
910269776 1:85381489-85381511 CTGGGGGAAGGTTGGGAGGGGGG - Intronic
910308728 1:85798375-85798397 CGGGGTTGGGGGTCGGAGGGAGG + Intronic
910734129 1:90433456-90433478 TGGGGGGAAGGGTAGGAGGGGGG + Intergenic
910927263 1:92410134-92410156 CTGGGCGAGGGGTGGGGTGGGGG - Intergenic
911003312 1:93190590-93190612 CTGGGTGATGGTTAGGGAGGTGG + Intronic
911090788 1:94015423-94015445 CTGGGTGAGGGGTTGGGGAATGG + Intronic
911098546 1:94075905-94075927 CTGGGAGAGGGGTCTGAGAGAGG + Intronic
911245337 1:95510386-95510408 CTGGGCGGGGGGTAGGGGGATGG + Intergenic
911264965 1:95732512-95732534 CTAGGGGAGGGGTGGGATGGTGG - Intergenic
911666062 1:100554016-100554038 CTGGGGAAAGGGTGGGAGGGGGG - Intergenic
911746270 1:101445133-101445155 GTGGGTGGGAGGTAGGGGGGAGG - Intergenic
911971480 1:104443365-104443387 CTGTGTGAAAGGTGGGAGGGGGG - Intergenic
912422000 1:109548835-109548857 CTCGGTGAGGGGCTGGAGGCGGG + Exonic
912455211 1:109792466-109792488 GGGGATGAGGTGTAGGAGGGTGG - Intergenic
912771061 1:112464725-112464747 CTGGAGCAAGGGTAGGAGGGGGG + Intergenic
912832972 1:112969871-112969893 CTGGTTGGGGGGGAGGGGGGAGG + Intergenic
912881997 1:113424416-113424438 CTGGATGTGGGGTAGGAAGGAGG - Intronic
912950318 1:114116262-114116284 CTGCCTCAGGGGAAGGAGGGAGG + Intronic
913174138 1:116258407-116258429 GGGGGTTAGGGGGAGGAGGGAGG + Intergenic
913260466 1:116993063-116993085 CTGGGGAAAGGGTAGGAGTGGGG + Intergenic
913652517 1:120931871-120931893 GTGGGTTGGGGGGAGGAGGGAGG + Intergenic
913995756 1:143651147-143651169 TTGGGGGTGGGGAAGGAGGGAGG + Intergenic
914134223 1:144884039-144884061 CGGGGTGGGGGGTGGGGGGGGGG + Intergenic
914902164 1:151716670-151716692 CTGGGGTGGGGGTGGGAGGGGGG - Exonic
915170281 1:153972814-153972836 CTTGGTGAGGGGCAGGTGAGAGG - Exonic
915701339 1:157799640-157799662 TGGGGTGCGGGGGAGGAGGGAGG + Intronic
915862405 1:159458812-159458834 GTGGGGGAGGGGGAGGGGGGAGG + Intergenic
915895899 1:159810319-159810341 CTGGGTGTGGAGTGGCAGGGGGG + Intronic
915901916 1:159853795-159853817 CTGGGTGAAGTGCAGGAAGGAGG - Intronic
915903410 1:159862126-159862148 CTGGAGGTGGGGTAGGAGAGGGG - Intronic
916002963 1:160634287-160634309 CTGGGTGAGGGATTGCAGGTGGG - Intronic
916124441 1:161556782-161556804 CTCGGACAGGGGTAGGGGGGTGG + Intergenic
916134333 1:161638132-161638154 CTCGGACAGGGGTAGGGGGGTGG + Intronic
916399267 1:164428544-164428566 CTGGGGGATAGGGAGGAGGGAGG + Intergenic
916443098 1:164846716-164846738 TTGGGGCAGGGGCAGGAGGGAGG + Exonic
916491576 1:165306882-165306904 CAGGGGGAGGCGGAGGAGGGTGG - Intronic
916881241 1:169021492-169021514 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
916883256 1:169043253-169043275 GTGGGTGGAGGGTAGGAGGAGGG + Intergenic
917168562 1:172143507-172143529 GTGGGAGAGGGGGAGGAAGGTGG - Intronic
917508574 1:175650819-175650841 GTGGGGGAGGGGTAGTAAGGAGG - Intronic
917521749 1:175753508-175753530 CTCGGGGAGGGGAAGGAAGGAGG - Intergenic
917869448 1:179229140-179229162 CTGCCCGAGGGGTCGGAGGGTGG - Intronic
917930008 1:179816616-179816638 CTAGGAAAGCGGTAGGAGGGAGG - Intergenic
918403905 1:184192795-184192817 CAGGGTTGGGGGTGGGAGGGTGG + Intergenic
918444360 1:184602121-184602143 CAGGGTGAGGGTGAGGATGGTGG - Intronic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
919592635 1:199523605-199523627 CAGGGGAAAGGGTAGGAGGGAGG - Intergenic
919626976 1:199920676-199920698 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
919719258 1:200814131-200814153 CGGGGGGAGGGGTGGGCGGGTGG + Intronic
919813194 1:201421826-201421848 GTGTGTGAAGGGTGGGAGGGAGG - Intronic
919921109 1:202166982-202167004 CAAGGTGAGGGGGAGGAGGGAGG - Intergenic
919975135 1:202605529-202605551 CTGGGAGAGGTGAAGAAGGGTGG - Intronic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920053166 1:203175518-203175540 GTGGGGCAGGGGGAGGAGGGAGG - Intronic
920101718 1:203521157-203521179 CTGGGGGCGGGTTAGGGGGGTGG - Intergenic
920189039 1:204180635-204180657 GTGGGGTAGGGGTAGGAGTGAGG + Intergenic
920331518 1:205211586-205211608 CTGGGGGGCGGGGAGGAGGGAGG - Intergenic
920347237 1:205314204-205314226 CTGGGGGAGGAGTGGGATGGAGG - Intronic
920416061 1:205800028-205800050 CTGGGTGGGGGGTTGGAAGGGGG + Intronic
920453333 1:206077526-206077548 CTTTGGGAGGGGAAGGAGGGAGG + Intronic
920718403 1:208363642-208363664 AAGGGTCAGGGGTAGGAGGAGGG + Intergenic
920761125 1:208784600-208784622 CTGGTTAAGGGGGAGGAGAGGGG - Intergenic
920825874 1:209423856-209423878 CTGGGTGAGGGGGAGGTGTGGGG + Intergenic
921262296 1:213395034-213395056 CTGCGGCAGGGGAAGGAGGGTGG - Intergenic
921601576 1:217111739-217111761 CTGGGAGAGTGGTAGTTGGGAGG + Intronic
921794442 1:219326297-219326319 GTGGGTGGGGGGTTGGGGGGTGG + Intergenic
921840958 1:219827819-219827841 GTGGGAGAAGGGTAGGAGGTGGG - Intronic
922268247 1:224008499-224008521 GTGGGGGAGGGGGAGGGGGGAGG + Intergenic
922367271 1:224877801-224877823 CTGGGGGAAAGGTAGGAGGGGGG + Intergenic
922698629 1:227744903-227744925 CAGGGATAGGGGCAGGAGGGAGG + Intronic
922720913 1:227899908-227899930 TTGGGCCAGGGGTAGGAGGCGGG + Intergenic
922783200 1:228269619-228269641 CAGGGTCAGGGGTGAGAGGGAGG - Intronic
922889757 1:229052582-229052604 GTGGGGGAAGGGTGGGAGGGGGG + Intergenic
923051819 1:230395208-230395230 CTCGGGGATGGGGAGGAGGGAGG - Intronic
923240706 1:232082702-232082724 CTGGGGTGGGGGTAGGGGGGAGG + Intergenic
923334098 1:232951776-232951798 GGGGGTGAGGAGGAGGAGGGTGG + Intronic
923482446 1:234397454-234397476 ATGGGGGAGGGGAAGGAGGGAGG + Intronic
923536713 1:234858045-234858067 TTGGGGTAGGGGTAGGAGTGGGG + Intergenic
923636590 1:235703901-235703923 TAGGGTGAGGGATAGGAGGAGGG - Intronic
924118879 1:240776426-240776448 ATTTGGGAGGGGTAGGAGGGTGG - Intronic
924172667 1:241357516-241357538 GTGGGTGGGTGGTAGGTGGGTGG + Intergenic
924194528 1:241591747-241591769 CTGGGAGAGAGGGAGAAGGGAGG + Intronic
924406638 1:243754753-243754775 CTGGGTGGTGTGTGGGAGGGGGG - Intronic
924784512 1:247183128-247183150 CTGAGTGTGGGGTGGGAGGAAGG - Intergenic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1063952583 10:11237616-11237638 CTGGGTGAGGGTTACAAGGGAGG + Intronic
1064332206 10:14404455-14404477 CTGTGTGAAGGGTAGGACTGCGG - Intronic
1064605030 10:17030276-17030298 CCGGGGGTGGGGTGGGAGGGTGG - Intronic
1064682511 10:17825220-17825242 ATGGGGGAGGGGTAGAATGGTGG + Intronic
1064903565 10:20319272-20319294 CTGGGTGGTGGGTAGGAGAATGG - Intergenic
1065312729 10:24431793-24431815 ATGGGTGAGTGCTAGGAGGCAGG + Intronic
1065518759 10:26551670-26551692 CTGAGTAAGGGGTAGGAAGCAGG - Intronic
1065636752 10:27742621-27742643 CGGGGTGAGGGGTATGCTGGGGG - Intronic
1066073707 10:31849278-31849300 CTGGGTTAGGTGTAGGAGAAGGG - Intronic
1066370562 10:34815321-34815343 CTGGGGGAGGGGACGGCGGGAGG + Exonic
1066379057 10:34885794-34885816 CTGGGTGAGAGGTTCAAGGGTGG - Intergenic
1067175536 10:43943338-43943360 GTGGGTGGGGGGCATGAGGGTGG + Intergenic
1067256523 10:44647594-44647616 CTGGGTGAGGGGGATGGGTGGGG - Intergenic
1067327205 10:45280975-45280997 CTGGGGGCAGGGTCGGAGGGGGG - Intergenic
1067419457 10:46133843-46133865 GTGGGTGAGGGGTGCCAGGGTGG + Intergenic
1067504808 10:46840440-46840462 GTGGGTGAGGGGTGCCAGGGTGG + Intergenic
1067556674 10:47277892-47277914 CAGAGAGAGGGGTAGGGGGGTGG + Intergenic
1067557710 10:47284240-47284262 TTGGGTGGGGGGCAGGGGGGCGG + Intergenic
1067684005 10:48456582-48456604 CTGGGGGAAGGGCAGGAGGCAGG + Intronic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1067972669 10:50991018-50991040 CTAGGAGAGGGGGACGAGGGAGG + Intergenic
1068558362 10:58483330-58483352 ATTGGTGGGGGGTAGGAAGGAGG + Intergenic
1068637449 10:59362924-59362946 CTGGGGGTGGGGTGGGAGTGTGG - Intronic
1069161045 10:65092688-65092710 GTGGGGTGGGGGTAGGAGGGAGG + Intergenic
1069183796 10:65396827-65396849 CTGTGTCTGGGATAGGAGGGTGG - Intergenic
1069383300 10:67862135-67862157 CAAGGTCAGGGGGAGGAGGGTGG - Intergenic
1069581349 10:69569064-69569086 CTGGGGGTGGGGTGGGATGGGGG + Intergenic
1069778709 10:70941682-70941704 CTGTGTGAGGGGTGGGGAGGAGG + Intergenic
1069798293 10:71067067-71067089 CTGGGGGAGGTGTGAGAGGGAGG + Intergenic
1069957490 10:72060965-72060987 CTGGGTGAGTGGTGGGTGTGGGG - Exonic
1070509468 10:77147426-77147448 CAGGGGGAAGGGAAGGAGGGAGG - Intronic
1070825438 10:79387865-79387887 CTGGGCCAGGGGCAGAAGGGTGG - Intronic
1070829287 10:79408799-79408821 CTGGGTCAGGGACAGGAAGGAGG - Intronic
1070976640 10:80610601-80610623 CTGGGTGAGAGGCAGGGGTGAGG - Intronic
1071397535 10:85238420-85238442 CTAGATGAGGGGCAGGAGGCAGG + Intergenic
1071527047 10:86365066-86365088 CTGGGGGCTGGGTAGGAGGAGGG + Intronic
1071550305 10:86561408-86561430 CAGGGTGGGGGGTGGGGGGGCGG + Intergenic
1071929105 10:90445984-90446006 GTGGGTGGGGGGTGGGAGGAGGG - Intergenic
1072405986 10:95153367-95153389 GTGGGTTGGGGGAAGGAGGGAGG + Intergenic
1072792115 10:98325767-98325789 CTGGGTGAGGGGTTGAGGTGGGG + Intergenic
1073098953 10:100997231-100997253 CTGGGTGAGTGGTGGGGCGGCGG + Intronic
1073119173 10:101111192-101111214 CTGGGAGTGGGGTGGGTGGGAGG - Intronic
1073348462 10:102801990-102802012 GTGGGGGAGGGGTGGCAGGGTGG - Intronic
1073931032 10:108577243-108577265 CTGGCAGAGGTGTAGGAAGGAGG - Intergenic
1074152706 10:110771739-110771761 CTAGGTGAAGGGGAGTAGGGAGG + Intronic
1074208456 10:111305177-111305199 TTGGGGGAGGGGCAGGTGGGAGG + Intergenic
1074241418 10:111643078-111643100 TGGGGTGGGGGGGAGGAGGGAGG + Intergenic
1074296245 10:112192092-112192114 CAGGGTAAGGGGTAGGAGGGTGG + Intronic
1074817840 10:117156411-117156433 CTGGGGTGGGGGCAGGAGGGAGG - Intergenic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1074898897 10:117800272-117800294 CTGGGGGGGGGGGAGGTGGGGGG - Intergenic
1074919474 10:117992977-117992999 AAGGGTGAGGGGAAGGAGCGGGG + Intergenic
1075071631 10:119323842-119323864 TTGGGGGAAGGGGAGGAGGGAGG - Intronic
1075487833 10:122840405-122840427 CTGGGACAGGCGTAAGAGGGGGG + Intronic
1075618061 10:123905784-123905806 CTGGGTGAGGGTGGGGTGGGAGG - Intronic
1075747236 10:124736435-124736457 CTGGGTGAGGAGAAGGAGCCTGG - Intronic
1075899960 10:126033648-126033670 CCTGGTGAGGAGCAGGAGGGAGG - Intronic
1076007084 10:126956435-126956457 CTGAGTGAGTGGGAGGAGAGGGG + Intronic
1076371818 10:129960132-129960154 CTGGGGGAGGGGCGGGAGGCTGG + Intronic
1076595697 10:131623335-131623357 ATGGGAGAGAGGTAGGAGAGAGG + Intergenic
1076597152 10:131630933-131630955 GTGAGTGAGTGGTAGCAGGGAGG - Intergenic
1076855483 10:133113731-133113753 CTGGGAGAGGGCAAGGATGGGGG + Intronic
1076875634 10:133214321-133214343 CTGGGGGAGAGCTGGGAGGGCGG - Intronic
1077000446 11:319625-319647 CTGGCTGAGGGTTCGGAGCGTGG - Intergenic
1077093658 11:790354-790376 GTGGGTGAGGGGTCGGTGGGTGG + Intergenic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077249155 11:1553132-1553154 CTCGGTGGGGGGTGGGGGGGGGG + Intergenic
1077269378 11:1668058-1668080 GGGGGAGAGGGGAAGGAGGGAGG - Intergenic
1077384602 11:2263045-2263067 CTGGGGAGGGGGTAGGAAGGCGG + Intergenic
1077394852 11:2315800-2315822 CTGGTGGAGGGGTGTGAGGGGGG - Intronic
1077395000 11:2316342-2316364 CAGGCTGAGGGGCAGGAGGTGGG - Intronic
1077425492 11:2474039-2474061 CTGGGCCAGCGGTAGGAGGCTGG - Intronic
1077488223 11:2848742-2848764 CTGGGCGAGGGGTTGGAGGCGGG - Exonic
1078078346 11:8182158-8182180 GTGGGTGAAGGGTGGGAGGAGGG - Intergenic
1078424291 11:11236660-11236682 CTGGTTAGAGGGTAGGAGGGGGG + Intergenic
1078857936 11:15221574-15221596 CTGGGTGACGGGCAGGTGTGGGG - Exonic
1078910577 11:15727452-15727474 GAGGATGAGGGGTAGGAGAGTGG - Intergenic
1079080506 11:17410497-17410519 CTGGGTGAGGGGGAACAAGGGGG - Exonic
1079089383 11:17470078-17470100 GTAGGTGAGGTGTAGGAGGGAGG - Intronic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1079132595 11:17756336-17756358 TTGGGGGAGGAGTAGGAGAGGGG - Intronic
1079165575 11:18038902-18038924 CTGGGAGAGGGAAGGGAGGGAGG + Intronic
1079214684 11:18498070-18498092 GTGGGTGGGGGGTTGGAGGGGGG + Intronic
1079292642 11:19202043-19202065 CTGGGGGAAGGGCAGGAGGGAGG + Intronic
1079361013 11:19770387-19770409 CTGGGAGGGTGGGAGGAGGGAGG + Intronic
1079641902 11:22816171-22816193 ATGGGGGAGGGGGAGGTGGGCGG - Intronic
1080115963 11:28621864-28621886 TTGGGTGATGGGGAGGAGGAAGG - Intergenic
1080387279 11:31817632-31817654 CTGAGGGAGGGATAGGAAGGGGG - Intronic
1080649233 11:34209614-34209636 GGGGGTGAGGGGTAGGGGTGGGG + Intronic
1080649251 11:34209658-34209680 GAGGGTGAGGGGTAGGGGTGAGG + Intronic
1080649259 11:34209671-34209693 AGGGGTGAGGGGTAGGGGTGGGG + Intronic
1081204588 11:40260403-40260425 GTGGGTTAGGGGGAGGGGGGAGG + Intronic
1081533917 11:43983734-43983756 GTGGGGGTGGGGTAGGGGGGTGG + Intergenic
1081814239 11:45929643-45929665 CTGGGGAAGGGGTAGGGGGGTGG + Intronic
1081915996 11:46730532-46730554 GTGGGTGAGGGGAGAGAGGGGGG + Intronic
1082029659 11:47594945-47594967 CGGGGTGAGGGGCAGTAAGGAGG + Intergenic
1082101753 11:48178576-48178598 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1082137076 11:48561718-48561740 TGGGGTGAGGGGTGGGAGGAGGG - Intergenic
1082812106 11:57484618-57484640 CTGGGTTAGGGGTTGGGGGTCGG - Exonic
1082824139 11:57565959-57565981 TAGGCTGAGGGATAGGAGGGGGG - Intronic
1083205538 11:61146573-61146595 CTGGGAGGGGAGGAGGAGGGAGG + Intronic
1083230857 11:61317849-61317871 TTGGGGGATGGGTTGGAGGGAGG - Intronic
1083271838 11:61576707-61576729 GTGGGTGGGGAGTAGGATGGGGG + Intronic
1083455968 11:62778787-62778809 GTGGTTGAGGGGGAGGAGGCTGG + Intronic
1083721604 11:64606436-64606458 AGGGGTGGGGGGTGGGAGGGAGG - Exonic
1083927169 11:65815025-65815047 CTGGTTTAGGGGTGGGAGAGTGG - Intergenic
1083994223 11:66264241-66264263 CTGGAGGATGGGAAGGAGGGAGG + Intronic
1084043180 11:66554513-66554535 CTGGGTCGGGGGGAGGTGGGAGG - Intronic
1084165436 11:67373030-67373052 CGCCGGGAGGGGTAGGAGGGCGG - Intronic
1084165684 11:67373770-67373792 CCGGGGTGGGGGTAGGAGGGGGG + Intronic
1084171675 11:67404100-67404122 CTGGCTGCGGGGTCAGAGGGGGG - Intronic
1084420839 11:69059727-69059749 CTGGGAGAGGCGTTGGAGGCAGG + Intronic
1084537278 11:69764560-69764582 CTGGGGGAGGGGTGGGTGGGGGG + Intergenic
1084590661 11:70088129-70088151 CTGCGTGGGGGGCAGTAGGGGGG + Intronic
1084771161 11:71343703-71343725 CTGGGTTCCGGGTGGGAGGGAGG - Intergenic
1085057112 11:73411458-73411480 TTGGGTGATGGGGAGTAGGGGGG + Exonic
1085068188 11:73517387-73517409 CTGCATGAGGGGAAGGGGGGTGG - Intronic
1085199263 11:74691858-74691880 CAGGGTGAGGGGAAGCAGGGTGG + Intergenic
1085254238 11:75163502-75163524 CTGAGAGAGGGGCAGGATGGTGG + Intronic
1085464271 11:76713489-76713511 GTGGTTGATGGGTGGGAGGGTGG + Intergenic
1085523301 11:77150594-77150616 CTGGGCGAGAGGGAGGAGGCAGG + Intronic
1085741929 11:79084707-79084729 ATGGGGTAGGGGTGGGAGGGAGG + Intronic
1085745690 11:79112493-79112515 TAGGGTGAGAGGTAGGTGGGTGG + Intronic
1086314705 11:85579232-85579254 AAGGGTGAAGGGTAGGAGGAGGG + Intronic
1086693537 11:89817038-89817060 CAGGGTCAGTAGTAGGAGGGAGG - Intergenic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1087432907 11:98076124-98076146 CGGGGAGAGGGGAAGGAAGGTGG - Intergenic
1087953082 11:104249356-104249378 CTGGGTGGGGTGGAGTAGGGTGG + Intergenic
1088472220 11:110198683-110198705 CTGGGAGTGGGGTTGGGGGGTGG - Intronic
1088508291 11:110548360-110548382 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1088514014 11:110609138-110609160 CTGGGTAGGGGGCAGGAGGGAGG - Intronic
1088561648 11:111121631-111121653 TTGGGTGAGGGGCAGAGGGGAGG + Intergenic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088723182 11:112612404-112612426 CAGGGTTGGGGGTGGGAGGGGGG + Intergenic
1088757350 11:112896939-112896961 TGGGGTGGGGGGGAGGAGGGAGG - Intergenic
1088760412 11:112924037-112924059 CTGGGTGAGACAGAGGAGGGTGG + Intergenic
1088971118 11:114775439-114775461 CCTGTTGAGTGGTAGGAGGGAGG + Intergenic
1089173725 11:116533775-116533797 CTGGGGGAGAGGCAGGAGGCTGG - Intergenic
1089182162 11:116590540-116590562 GGGGGTGAGGAGGAGGAGGGTGG - Intergenic
1089191820 11:116659322-116659344 CTGGGTGACGAGGTGGAGGGTGG - Intergenic
1089230923 11:116975361-116975383 CTGGTGGAGGGATAGGAGTGGGG - Intronic
1089453613 11:118612995-118613017 GTGGGTGAGGGGCAGTGGGGTGG + Intronic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1089696121 11:120217259-120217281 CTGGGTGAGGGGGATGAGTTTGG + Intronic
1090398941 11:126436156-126436178 GTGGGTGAGAGGGAGGAGGCAGG - Intronic
1090406482 11:126478829-126478851 CTGCGTGAGTAGTGGGAGGGAGG + Intronic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090551687 11:127826791-127826813 CTGGGGGTGGAGTGGGAGGGAGG - Intergenic
1090611630 11:128476286-128476308 GTGGGTTAGGGGTATGTGGGAGG - Intronic
1090663738 11:128901154-128901176 ATGGGTGTGAAGTAGGAGGGTGG + Exonic
1090713186 11:129406586-129406608 CTTGGGGAGGTGGAGGAGGGAGG + Intronic
1091068692 11:132542628-132542650 CTGGGTGTGGGGGGTGAGGGTGG - Intronic
1091111125 11:132969100-132969122 CAGGGGGAAGGGTGGGAGGGGGG - Intronic
1091657311 12:2354989-2355011 CTGGGTGTGGGGTGGGGTGGAGG + Intronic
1092046506 12:5434738-5434760 GTGGGTGTGGTGTAGGAGGGCGG + Intronic
1092048862 12:5453805-5453827 CTTAGTGAAGGGGAGGAGGGAGG + Intronic
1092199357 12:6570512-6570534 CTGGGGGAGGGGAGGGAGTGAGG - Exonic
1092261787 12:6956796-6956818 GTGGGGCAGGGGTAGGAGGAAGG - Intronic
1092488272 12:8921704-8921726 CTGGTTGAGGGGTGGGGAGGTGG - Exonic
1092549107 12:9478391-9478413 CTTGGGAAGGGGTGGGAGGGTGG + Intergenic
1092880696 12:12885675-12885697 CTGGGTGTGGGGCGGGGGGGCGG + Intergenic
1093253703 12:16839695-16839717 CTGGGTGGAGGGTGGGAGGAGGG + Intergenic
1093284467 12:17241422-17241444 CTGGGAAAAGGGTGGGAGGGGGG - Intergenic
1094079701 12:26519997-26520019 CTGGCTGGGAGGTAGGTGGGAGG + Intronic
1094352675 12:29544356-29544378 GTGGGAGAAGGGTAGGATGGGGG - Intronic
1094410123 12:30159199-30159221 ATGGGAGAGGTGTAGGAAGGAGG - Intergenic
1094503888 12:31044076-31044098 CTTGGGAAGGGGTGGGAGGGTGG - Intergenic
1094816104 12:34186409-34186431 CTGGGTGGGGGGTGGGGGAGTGG + Intergenic
1095069488 12:37823515-37823537 GTGGGTTAGGGGGAGGGGGGAGG - Intergenic
1095943710 12:47741625-47741647 CTGGGTGGGGGAAGGGAGGGAGG + Intronic
1096124593 12:49110217-49110239 CTGGGTGAGGGGTGGGAGGGAGG + Intronic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096148225 12:49293646-49293668 CTGGCTGGGGGTAAGGAGGGCGG - Intronic
1096498453 12:52051734-52051756 CTGGGTGCGGGGTAGGAGGTAGG + Intronic
1096540200 12:52302829-52302851 TTGGGTGGGGGGTGGGGGGGGGG + Intronic
1096567732 12:52495357-52495379 ATGTGTGTGGGGGAGGAGGGTGG + Intergenic
1096608619 12:52786296-52786318 GTGGGGTAGGGGAAGGAGGGAGG + Intergenic
1096718437 12:53504589-53504611 CTAGGTGAGAGGAAGGAGAGAGG - Intronic
1096803879 12:54128443-54128465 CTGGGTTGGGGGTGGGGGGGTGG - Intergenic
1096870352 12:54588692-54588714 CTGGGGGAGGGGGAGGGGGCCGG - Intergenic
1096946589 12:55414305-55414327 CTGGTTGAGGGGTGGGGAGGTGG + Intergenic
1096983480 12:55742524-55742546 CTGGGAAAGGGGTGGGGGGGGGG - Intergenic
1097174717 12:57136049-57136071 CCGGCTGAGGGGGAAGAGGGGGG - Intronic
1097612174 12:61837740-61837762 CAGGGGGTGGGGTAGGAGTGCGG + Intronic
1097844205 12:64350138-64350160 TAGGGGGAAGGGTAGGAGGGAGG + Intronic
1098006933 12:66007518-66007540 GTGGGACAGGGGAAGGAGGGAGG - Intergenic
1098166660 12:67705396-67705418 CTGGGGAAGGGGTAGAAGCGGGG + Intergenic
1098646839 12:72912575-72912597 GTGGGGTAGGGGGAGGAGGGAGG - Intergenic
1098824646 12:75279984-75280006 CTGGGTGAGGGGTATAAAGGAGG - Intronic
1098916488 12:76261829-76261851 CTGGAAGAGGGGTAGGGAGGAGG + Intergenic
1099395345 12:82131713-82131735 GAGGGTGAGGGGTGGGAGGAAGG + Intergenic
1100029285 12:90166204-90166226 CTAAGTGAGGGGTAGGAGGTGGG - Intergenic
1100221209 12:92506218-92506240 AGGGGTGAGGGATGGGAGGGTGG + Intergenic
1100274307 12:93058019-93058041 CAGGGTCAAGGGCAGGAGGGAGG + Intergenic
1100329197 12:93569781-93569803 AAGGGGGAGGGGTGGGAGGGAGG - Intergenic
1100888692 12:99100481-99100503 CTGGGGGAGGGGTAAGGTGGAGG + Intronic
1101315524 12:103625501-103625523 GTGGGTGGGGGGAAGGAGGAGGG - Intronic
1101527647 12:105546233-105546255 GTGGGTGAGGGGAATGAGGAAGG + Intergenic
1101727313 12:107398699-107398721 CTGGGGGACAGGTAGGGGGGTGG + Intronic
1101838397 12:108310947-108310969 CTGGGCGGGGGGTGGGGGGGCGG - Intronic
1102025039 12:109709649-109709671 CTGGGGGTGGGGTGGGAGGCTGG + Intergenic
1102029002 12:109729342-109729364 CTGGGTGAGGGGCATGCTGGGGG + Intronic
1102438883 12:112946527-112946549 ATGGGGGAGTGGTGGGAGGGAGG - Intronic
1102470554 12:113157668-113157690 CTGTGTCAGGGCTAGGAGGCAGG - Exonic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102566985 12:113803324-113803346 CTGGGTCTGGGGAAGGAGAGTGG - Intergenic
1102567342 12:113805270-113805292 GTGGGTGGGGGGAAGGAGGGGGG + Intergenic
1102596141 12:113993906-113993928 CTGAGTAGGGGGTGGGAGGGAGG - Intergenic
1102599329 12:114017281-114017303 TTGTGGGAGGGGGAGGAGGGAGG + Intergenic
1102634135 12:114308031-114308053 GTGGATGAGGGGTAGGGTGGAGG - Intergenic
1102676760 12:114664726-114664748 CTGGGGGCGGGGTGGGCGGGGGG + Intergenic
1102756123 12:115342472-115342494 CGGGGTGGGGGGCAGGTGGGGGG - Intergenic
1102880460 12:116481197-116481219 CTGGGCGTGGGGGCGGAGGGTGG - Intergenic
1102913676 12:116737566-116737588 CAGGGAGAGGGGAAGGAAGGAGG + Intronic
1102932991 12:116876657-116876679 CTGGCGGAGGCGTGGGAGGGAGG - Intronic
1103023466 12:117555100-117555122 CTGGGTGAGGGGTAGGAGGGAGG - Intronic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103534953 12:121627624-121627646 CTGCGTGTGAGGGAGGAGGGAGG + Intronic
1103561353 12:121794703-121794725 CAGGGTGAGGAGTAAGAGGAGGG - Intronic
1103566755 12:121819913-121819935 CTGGGAGGGTGGTGGGAGGGAGG + Intronic
1103741661 12:123095515-123095537 CTGGGTGACAGGTCGGAGGCGGG - Intronic
1103752600 12:123175655-123175677 TGGGGTGAGGGATGGGAGGGTGG - Intronic
1103932699 12:124458927-124458949 CTGGGTATGGGGTAGCATGGGGG + Intronic
1104191097 12:126482491-126482513 GAGGGAGAGGGGAAGGAGGGAGG - Intergenic
1104327650 12:127814970-127814992 CTTGCTGAAGGGTAGGACGGAGG + Intergenic
1104850679 12:131872056-131872078 CTGGATGTTGGGGAGGAGGGAGG + Intergenic
1104925951 12:132313970-132313992 GTGGGTGATGGGTGGGTGGGTGG - Intronic
1105262738 13:18791865-18791887 GAGGGTGAGGGGTAGTAGGAAGG - Intergenic
1105446502 13:20461974-20461996 CTGGGGGAGGAGGAGGCGGGAGG + Intronic
1105597737 13:21855328-21855350 CGGGGGGAAGGGTGGGAGGGGGG - Intergenic
1105985730 13:25564856-25564878 TTGGGGGAAGGGTGGGAGGGAGG - Intronic
1106068987 13:26388848-26388870 GTTGGTGAGGAGGAGGAGGGAGG - Intronic
1106229930 13:27813956-27813978 GTGTGTCAGGGGCAGGAGGGTGG - Intergenic
1106381969 13:29248240-29248262 CTTGGGGAAGGGTGGGAGGGGGG + Intronic
1106463851 13:29995510-29995532 GTGTGTGAGGGGCAGGAGGTGGG + Intergenic
1106463956 13:29996280-29996302 ATATGTGAGGGGTAGGAGGTGGG - Intergenic
1106570663 13:30924493-30924515 CTGGGGGGAGGGTAGGAGGTGGG + Exonic
1106986414 13:35357440-35357462 CAGGGTGGAGGGTAGGAGGAGGG - Intronic
1107013172 13:35687653-35687675 GTGGGTGCGGGGGAGGTGGGTGG - Intergenic
1107123689 13:36821415-36821437 CTTGGGGAGGCCTAGGAGGGAGG + Intronic
1107851366 13:44576371-44576393 TGGGGTGCGGGGCAGGAGGGAGG + Exonic
1107950661 13:45458698-45458720 CTGGGTGGTGGGGATGAGGGTGG - Intergenic
1108151299 13:47537521-47537543 CAGGGAGAAGGGTGGGAGGGAGG + Intergenic
1108845894 13:54678235-54678257 CTTGCTGAGGGGTTGGAGAGAGG - Intergenic
1109376446 13:61500439-61500461 CTCTGTGAGAGGTAGGAGGATGG - Intergenic
1109548535 13:63860798-63860820 CAGTGGGAGGGGTAGGTGGGTGG - Intergenic
1109590198 13:64469453-64469475 CTGGGTGGGGGGTGGTGGGGAGG - Intergenic
1109747430 13:66645262-66645284 ATGGGTGATGGGGAGGAGGAAGG - Intronic
1110270871 13:73588825-73588847 AAGGGGGAGGGGTAGGAGGAGGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110499889 13:76214887-76214909 TGGGGTGGGGGGGAGGAGGGAGG - Intergenic
1111457312 13:88502122-88502144 CAGGGTGGGGGGTGGGAGGAGGG - Intergenic
1112578957 13:100662196-100662218 CAGGGTGAGGTGGAGGAGGGTGG - Intronic
1112578978 13:100662242-100662264 CAGGGTGAGGTGGAGGAGGGTGG + Intronic
1112607009 13:100916405-100916427 TGGGGTGAGGGGTAGGGGGAGGG - Intergenic
1112648150 13:101359027-101359049 CGGGGTGAGGGGCAGGGGGAGGG + Intronic
1112682441 13:101782529-101782551 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1112690260 13:101885342-101885364 CAGGGTGGAGGGTGGGAGGGAGG + Intronic
1113200968 13:107867269-107867291 CGGGGTGGGGGGTGGGGGGGAGG - Intergenic
1113406378 13:110044659-110044681 CTGGGAGAGGTGGAGGTGGGGGG - Intergenic
1113458268 13:110464262-110464284 CAGGGTTAGGGGTAGGGGTGAGG + Intronic
1113791575 13:113031603-113031625 CTGGGAGATGGGGAGGAGGGCGG + Intronic
1113853924 13:113433713-113433735 GTGGGCGGGGGGTGGGAGGGAGG - Intronic
1113868389 13:113543478-113543500 CGGGGGGAGGGGGAGGAGGTGGG - Intronic
1113966349 13:114155677-114155699 CTGAGTGTGGGGGTGGAGGGTGG + Intergenic
1114040807 14:18676763-18676785 CCTGGAGAGGGGTAGGAGGCAGG - Intergenic
1114045845 14:18875267-18875289 CCTGGAGAGGGGTAGGAGGCAGG - Intergenic
1114118369 14:19644203-19644225 CCTGGAGAGGGGTAGGAGGCAGG + Intergenic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114712762 14:24795052-24795074 AGGGGTGGGGGGTTGGAGGGAGG - Intergenic
1114900880 14:27056114-27056136 GTGGGGTAGGGGTAGGGGGGAGG + Intergenic
1115310061 14:31969893-31969915 CTGGGGGCGGGGGAAGAGGGAGG - Intergenic
1115353916 14:32426846-32426868 TGGGGAGAGGGGTAGGAGGAAGG + Intronic
1115387361 14:32813392-32813414 CTGGGAAAGGGGTTGGGGGGGGG - Intronic
1115612389 14:35061319-35061341 CTGAGTGAGAGGCAGAAGGGCGG - Intronic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115859854 14:37672215-37672237 CTGGGTCAAGGGATGGAGGGAGG - Intronic
1115959174 14:38815676-38815698 TTGGGGGAAGGGTAGGAGCGGGG + Intergenic
1116029181 14:39550342-39550364 CGGGGTGAGGGGAGGGAGGATGG - Intergenic
1116371645 14:44141960-44141982 CTGGCTGGGGGGTAGGGGTGGGG - Intergenic
1116808302 14:49514786-49514808 CTGGGTGAGGAGAAGCAGTGCGG + Intergenic
1116844600 14:49853482-49853504 ATGGGGGTGGGGTGGGAGGGGGG + Intergenic
1117162400 14:53002231-53002253 CTGGGAGATGAGAAGGAGGGAGG - Intergenic
1117192712 14:53308935-53308957 CAGGGTGAAGCGTGGGAGGGGGG - Intergenic
1117313449 14:54551152-54551174 CTGGGTGGGGGTGAGGAGGCAGG - Intergenic
1117812449 14:59562573-59562595 CTGATGGAGGGGTAGGAAGGTGG + Intronic
1118183070 14:63512987-63513009 CTTGGTGGGGGGTAGGGGGGTGG - Intronic
1118607053 14:67512247-67512269 CTAGGGAAGGGGTAGGAGGGGGG - Intronic
1118968088 14:70607004-70607026 CTGGGTTAAGGGTGTGAGGGAGG - Intergenic
1119019569 14:71096985-71097007 CGGGGTGGGGAGGAGGAGGGAGG - Intronic
1119027331 14:71164446-71164468 CGGGGTGGGGGGTGAGAGGGGGG + Intergenic
1119502815 14:75145082-75145104 AGGGGTGAAGGGCAGGAGGGTGG + Intronic
1119772699 14:77230723-77230745 CTGGGTGTGGGGTGGTGGGGGGG - Intronic
1120478376 14:85018548-85018570 GTGGGGTGGGGGTAGGAGGGAGG - Intergenic
1120530165 14:85622243-85622265 CTGGGAGATCGGGAGGAGGGTGG - Exonic
1120996566 14:90422425-90422447 CAGGTAGAGGGGTAGGAGAGAGG - Intergenic
1121097147 14:91225459-91225481 CTGGGTGACTGGCAGGCGGGTGG - Intronic
1121273290 14:92651883-92651905 CTGGGGGAGGGGGTGGTGGGCGG - Exonic
1121276217 14:92669633-92669655 CTGGGTGGGGGTGAGGTGGGGGG + Intronic
1121332636 14:93058753-93058775 CGGGGTGCGGGTTACGAGGGAGG + Intronic
1121417734 14:93790334-93790356 CTGGGGGTGGGATAGGATGGAGG + Intergenic
1121537205 14:94699127-94699149 CTGGGTTAGGAGTTGGAGGGTGG + Intergenic
1122087324 14:99316876-99316898 CTGGGTTCGGGGAAAGAGGGCGG + Intergenic
1122166045 14:99824766-99824788 AAGGGTGGAGGGTAGGAGGGGGG - Intronic
1122283485 14:100637882-100637904 CTGGATGGGGGGTGGCAGGGAGG + Intergenic
1122665968 14:103329793-103329815 CTTGGTGGGGGGTGGGAGGGAGG + Intergenic
1122672047 14:103379848-103379870 CTTGGTGAGGGGAAAGAGGAGGG - Intergenic
1122697429 14:103562848-103562870 CGGGGTGAGGGGGCGGCGGGCGG - Intergenic
1122769813 14:104092958-104092980 CTGGGGGTGTGGGAGGAGGGTGG - Intronic
1122879354 14:104683154-104683176 CTGGGGGAGGGGTCTGCGGGTGG + Intergenic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931268 14:104933869-104933891 CTGAGTGAGGGGAGGGCGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1123022653 14:105408940-105408962 GAGGGGGAGGGGGAGGAGGGGGG - Intronic
1123043516 14:105500152-105500174 CTGGCGGAGGGGCCGGAGGGTGG - Intergenic
1202884109 14_KI270722v1_random:87983-88005 GTTGGTGGGAGGTAGGAGGGAGG + Intergenic
1124003830 15:25780528-25780550 CAGGGTGAGGGGTGAGAGGCTGG - Intronic
1124490790 15:30153867-30153889 CTGGGAGAGGTGAAGAAGGGTGG - Intergenic
1124511212 15:30327702-30327724 GTGGGGTAGGGGTAGGGGGGAGG - Intergenic
1124642439 15:31404264-31404286 CAGGGAGAAGGGTAGAAGGGAGG + Intronic
1124731703 15:32203063-32203085 GTGGGGTAGGGGTAGGGGGGAGG + Intergenic
1124752742 15:32384462-32384484 CTGGGAGAGGTGAAGAAGGGTGG + Intergenic
1124841649 15:33247629-33247651 GTGGGTGAGGGTAAGCAGGGGGG + Intergenic
1124998885 15:34751729-34751751 ATGGGGGATGGGTGGGAGGGAGG - Exonic
1125320690 15:38484463-38484485 GTGGGGGAGGGGGAGGAGGGTGG + Exonic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125420031 15:39496185-39496207 CTGGGTGAGAAATAGGAGGCTGG - Intergenic
1125611793 15:40976393-40976415 CTGGGGGGGTGGTAGGAGGGTGG + Intergenic
1125750336 15:42023518-42023540 CTGGGATAGGGGAAGTAGGGTGG + Intronic
1125876586 15:43152636-43152658 CTTGGGGAGGCGTAGGAGGGCGG - Intronic
1125929300 15:43589127-43589149 CTGGAGAAGGGGTAGAAGGGAGG + Intronic
1125942467 15:43688959-43688981 CTGGAGAAGGGGTAGAAGGGAGG + Intergenic
1126315455 15:47364758-47364780 TTGGGGGATGGGGAGGAGGGTGG - Intronic
1126675681 15:51157779-51157801 CTGGGGGAGGGGTGGCAGGGTGG + Intergenic
1127212767 15:56791504-56791526 GTGGGGGAAGGGTATGAGGGAGG - Intronic
1127281739 15:57498866-57498888 GTGGGTGAGGAGGAGGAGTGTGG + Intronic
1127292010 15:57579604-57579626 CTGGGTGAGGAGGATGTGGGTGG - Intergenic
1127292961 15:57586564-57586586 CTGGGTATGGGGATGGAGGGTGG - Intergenic
1127564543 15:60173943-60173965 GTGGGGTAGGGGTAGGGGGGAGG + Intergenic
1128061214 15:64737029-64737051 CTGGGACAGGGGTGGGAGCGGGG - Intergenic
1128108055 15:65058802-65058824 CTGGCTGGGTGGTGGGAGGGAGG - Intronic
1128226733 15:66006946-66006968 CTGGGTGAGGGAGAGGGAGGGGG - Intronic
1128527386 15:68421700-68421722 CTGGGTGGGGGGTGGGGGTGAGG + Intronic
1128671377 15:69576889-69576911 CTGGGGTAGGGATAGGAAGGAGG + Intergenic
1128674725 15:69600164-69600186 CAGGCAGAGGGGTGGGAGGGGGG + Intergenic
1128797920 15:70478575-70478597 CAGGGCGAGTGGGAGGAGGGTGG - Intergenic
1128992275 15:72271162-72271184 TGGGGTGAGGGGTAGGATGACGG + Exonic
1129161810 15:73751949-73751971 CTGGCTGGGGGGAAGGTGGGGGG - Intronic
1129244464 15:74271123-74271145 CAGGGTGATGGGCACGAGGGAGG + Intronic
1129253860 15:74323006-74323028 CTGGAGCAGGGGTAGGAGCGGGG - Intronic
1129326091 15:74800927-74800949 GTGGGGGCGGGGTAGGGGGGAGG + Intronic
1129334040 15:74842002-74842024 CTGGGGGAGGGGTGGGATGGTGG + Intronic
1129360157 15:75019478-75019500 CTTGGTGGTGGGTGGGAGGGTGG + Exonic
1129483092 15:75843342-75843364 CAGGGTGAGGGGGACGGGGGCGG + Exonic
1129643526 15:77408385-77408407 CAGGGGGAAGGGTGGGAGGGGGG + Intronic
1129703686 15:77782683-77782705 CTGGGGAAGGGGTTGGAGAGTGG - Intronic
1129753756 15:78083548-78083570 CTGGGGCAGGGGTAGGGTGGTGG + Intronic
1129772608 15:78212501-78212523 CTGGCTGCGGGGCAGGAGGCGGG + Intronic
1129787805 15:78320935-78320957 AGGGATGAGGGGTGGGAGGGAGG + Intergenic
1129836325 15:78709611-78709633 CTGGGTGGAGGGTAGTAGGGTGG - Intronic
1129935105 15:79440660-79440682 CTGGGTGGTGGGGAGGAGCGGGG - Intronic
1129946804 15:79545641-79545663 CTGGGACAGGTGAAGGAGGGGGG - Intergenic
1130553971 15:84910014-84910036 CAGGGTCAGGGGTAGGCAGGAGG - Intronic
1130890696 15:88131538-88131560 CTGGGGCAGGGGGAGGATGGAGG + Intronic
1131050942 15:89347394-89347416 CGGGGGGAGGGGTGGGAGTGAGG - Intergenic
1131359388 15:91776471-91776493 CTGGGTGGGTGGTTGGAGGCAGG + Intergenic
1131670765 15:94617304-94617326 CTTGGAGAGAGGAAGGAGGGGGG - Intergenic
1131779540 15:95841881-95841903 GTGGGGTAGGGGGAGGAGGGAGG - Intergenic
1131853398 15:96566516-96566538 CTGGGTGAGGGCAAAGAGTGGGG - Intergenic
1132104233 15:99051306-99051328 CGGGGGGAGGGGGAGCAGGGGGG - Intergenic
1132243138 15:100276079-100276101 CTGGTGGGAGGGTAGGAGGGAGG + Intronic
1132243151 15:100276112-100276134 CTGGTGGGAGGGTAGGAGGGAGG + Intronic
1132243164 15:100276145-100276167 CTGGTGGGAGGGTAGGAGGGAGG + Intronic
1132255419 15:100372865-100372887 CTTGGGGAGGGGTTGGGGGGTGG + Intergenic
1132287295 15:100672720-100672742 AAGGGAGAGGGGAAGGAGGGAGG - Intergenic
1132761833 16:1512198-1512220 GTGGGTGGGGGGCAGGATGGGGG + Intronic
1132934168 16:2472626-2472648 CTCGGTGAGGCCTTGGAGGGTGG + Exonic
1132983093 16:2749262-2749284 CTGTGGGAGGGGTTGGATGGGGG + Intergenic
1132986098 16:2768410-2768432 CTGGGGCAGGGGGCGGAGGGAGG + Intronic
1132989798 16:2786859-2786881 ATGGGGGAGGGGGATGAGGGAGG - Intronic
1133032454 16:3017850-3017872 CCAGGTGAGGGGGAGGGGGGAGG + Intronic
1133343641 16:5055447-5055469 CTGGGTTAGGCTTAGGAGGTGGG + Intronic
1133979453 16:10622450-10622472 CTGGGTGGGGGTGGGGAGGGAGG + Intergenic
1134122801 16:11596696-11596718 CAGGGGGAGAGGGAGGAGGGGGG + Intronic
1134213430 16:12297125-12297147 CAGGGTTAGGGGTCGGAGGCTGG + Intronic
1134224400 16:12380380-12380402 ATGGATGAGGGGTGGGTGGGTGG - Intronic
1134224411 16:12380407-12380429 ATGGATGAGGGGTGGGTGGGTGG - Intronic
1134224675 16:12381214-12381236 ATGGATGAGGGGTGGGTGGGTGG - Intronic
1134290712 16:12901557-12901579 AAGGGGGAGGGGGAGGAGGGCGG - Intergenic
1134511575 16:14852609-14852631 TGGTGTGAAGGGTAGGAGGGTGG + Intronic
1134699217 16:16251107-16251129 TGGTGTGAAGGGTAGGAGGGTGG + Intronic
1134782415 16:16910184-16910206 GTGGGTGAGTGGATGGAGGGAGG + Intergenic
1134868225 16:17628147-17628169 CTGGGTGAGGAAAAGGAGGAAGG - Intergenic
1134972613 16:18543568-18543590 TGGTGTGAAGGGTAGGAGGGTGG - Intronic
1135402310 16:22174555-22174577 CAGGGTGATGGGGAGTAGGGTGG - Intronic
1135960356 16:26989904-26989926 CAGGGTGAGGAAAAGGAGGGCGG - Intergenic
1136024169 16:27459323-27459345 CTTCATGATGGGTAGGAGGGAGG + Intergenic
1136040259 16:27572969-27572991 GTGAGTGAGGGGTAGGGGAGGGG - Intronic
1136480708 16:30539896-30539918 CTGGGGGTGGGGGATGAGGGTGG - Intronic
1136556806 16:31011687-31011709 CAGGTTGGGGGGTAGGTGGGCGG - Intergenic
1136561582 16:31042286-31042308 CTAGGGGAAGGGCAGGAGGGCGG + Intronic
1136713396 16:32258285-32258307 CGGGGTGGGGGGTGGGGGGGAGG + Intergenic
1136754515 16:32671146-32671168 CGGGGTGGGGGGTGGGGGGGAGG - Intergenic
1136826637 16:33365838-33365860 CGGGGTGGGGGGTGGGGGGGAGG + Intergenic
1136831703 16:33464609-33464631 CGGGGTGGGGGGTGGGGGGGAGG + Intergenic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137275961 16:46933653-46933675 GTGGGTGATGCGTAGAAGGGAGG + Intergenic
1137701696 16:50502358-50502380 CTGGGAGATGGGAAGGAGGTAGG + Intergenic
1137707508 16:50545751-50545773 GGGGGTCAGGTGTAGGAGGGAGG - Intergenic
1137715655 16:50596839-50596861 CTGAAGGAGGGGCAGGAGGGAGG + Intronic
1137817238 16:51410131-51410153 GTGGGTGAGGGGTCTGAAGGGGG - Intergenic
1138042338 16:53685707-53685729 GAGGGTGAGGGGTGGGAGGAGGG + Intronic
1138370032 16:56519645-56519667 CTGGGGGCGGGGTCGGAGAGGGG + Intronic
1138544375 16:57706936-57706958 ATGGGAGATGGGTAGGAGGATGG - Intronic
1138554617 16:57764248-57764270 CTGGGAGGGTGGTGGGAGGGAGG + Intronic
1139061257 16:63254418-63254440 CGGGGGGAAGGGTGGGAGGGGGG + Intergenic
1139582550 16:67881974-67881996 CTGGCTGAGGGGCAGCAGCGGGG + Exonic
1139598110 16:67969616-67969638 CTGGGGGAGGGGTCAGAGGGTGG - Intergenic
1139599056 16:67975777-67975799 CTGGGTGAAGGTTGGGATGGTGG + Exonic
1139678995 16:68545282-68545304 CTGGGCAAGGGGTTGAAGGGAGG - Intronic
1139797801 16:69497398-69497420 TTGGGGGAGGTGGAGGAGGGAGG - Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140087411 16:71809215-71809237 GGGGGTGGGGGGTAGGGGGGTGG + Intergenic
1140479941 16:75257010-75257032 CTGGGGGAGGGGGAAGAGAGGGG + Intronic
1140771217 16:78205768-78205790 ATGGGTGAAGGATAGGTGGGTGG - Intronic
1141001525 16:80312768-80312790 CAGGGTGACGGGGAAGAGGGTGG - Intergenic
1141043527 16:80693117-80693139 CTGGGTGTGGGGGTGGATGGCGG + Intronic
1141092439 16:81139463-81139485 ATGGGTGGAGGGGAGGAGGGCGG + Intergenic
1141896122 16:86959658-86959680 CTGGGTGAGGGGTGGGGATGGGG - Intergenic
1202992174 16_KI270728v1_random:22193-22215 CGGGGTGGGGGGTGGGGGGGAGG + Intergenic
1203056662 16_KI270728v1_random:931477-931499 CGGGGTGGGGGGTGGGGGGGAGG - Intergenic
1142562346 17:817898-817920 CTGGGTGAAGGCTGGGAAGGAGG + Intronic
1142718747 17:1762653-1762675 CTGGCTGAGGGCTGGGATGGAGG + Intronic
1142866883 17:2796572-2796594 GTGGGTGACAGGTGGGAGGGTGG + Intronic
1143341395 17:6214062-6214084 GGGGCTGAGAGGTAGGAGGGTGG + Intergenic
1143382144 17:6503234-6503256 CAGAGTGAGGGGTGGGAGGCTGG - Intronic
1143461682 17:7108316-7108338 CTGGGGGATGTATAGGAGGGAGG - Intronic
1143465855 17:7135789-7135811 CAGGGGGAGGGGTTGGTGGGCGG + Intergenic
1143583866 17:7841888-7841910 CTGGGGGAGGGGGAGGCGGAGGG - Intronic
1143634193 17:8154931-8154953 CTGGGAGAGGGCTAGAAGGGAGG + Intronic
1143943401 17:10567331-10567353 CTGGGTGAAGGGTATGTGAGAGG - Intergenic
1144045008 17:11447575-11447597 CTGGGTGTGGGGTAGAGGGTGGG - Intronic
1144343595 17:14331289-14331311 CTGGGGGTGGGGGTGGAGGGAGG - Intronic
1145261758 17:21358717-21358739 CTGGGGGAGGGGGAGGGAGGTGG + Intergenic
1145279791 17:21458615-21458637 ATGAGTGAGGGAGAGGAGGGAGG + Intergenic
1145285538 17:21503563-21503585 CTGGGTGAGGGGGAAGACTGCGG + Intergenic
1145391035 17:22455455-22455477 CCGGGGGAAGGGCAGGAGGGAGG + Intergenic
1145750593 17:27353038-27353060 ACTGGTGAGGGGTAGGAGGTGGG + Intergenic
1145829115 17:27900808-27900830 GTGGGTTAGGGGGAGGGGGGAGG - Intergenic
1146148630 17:30446317-30446339 GTGGGGTAGGGGTAGGGGGGAGG - Intronic
1146169485 17:30621688-30621710 CTGGGTGAGGAGTTGGGGAGCGG + Intergenic
1146170077 17:30625761-30625783 CTGGGTGAGGAGTTGGGGAGCGG - Intergenic
1146283503 17:31559736-31559758 CTGGGGGAGGGGGAGGTGCGGGG - Intergenic
1146739579 17:35270771-35270793 CTGGGGTAGGGGAGGGAGGGTGG - Exonic
1146911584 17:36651744-36651766 CTGGGGGAGAGGTAGGTAGGGGG - Intergenic
1146927575 17:36755519-36755541 AAGGGTGTGGGGTTGGAGGGTGG + Intergenic
1146976774 17:37120238-37120260 ATAGGTTAGGGGAAGGAGGGAGG - Intronic
1147182213 17:38693569-38693591 GTGGGTGTGGGGTGGGAAGGGGG + Intergenic
1147250535 17:39150663-39150685 CTGGGGTAGGGGGTGGAGGGAGG - Intronic
1147259060 17:39197906-39197928 TTGGGGGAGGGGTGGGGGGGCGG + Intergenic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147615159 17:41823115-41823137 GGGGCTGAGGGGTGGGAGGGAGG + Exonic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1147869648 17:43578358-43578380 CTCAGTGAGGGCTGGGAGGGAGG + Intronic
1147965944 17:44194204-44194226 CTGGGTGGGGGTCAGGAGAGAGG + Exonic
1147976903 17:44253068-44253090 GGGGGTGAGGGGCAGGAGGATGG + Intronic
1147986280 17:44309217-44309239 CTGTGTGAGGGGGAAGGGGGTGG + Intronic
1147995765 17:44359706-44359728 CTGGCTGGGGGGTAGGGGGTGGG - Intronic
1148155775 17:45424662-45424684 GTGGGGGAAGGGTGGGAGGGGGG + Intronic
1148324780 17:46776905-46776927 CTGGGAGAGGGGGAGGAAGGAGG - Intronic
1148751668 17:49948890-49948912 CTGAGGGAGGAGTGGGAGGGAGG + Intergenic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149332754 17:55603737-55603759 CGGGGTGGGTGGTGGGAGGGAGG + Intergenic
1149338500 17:55662627-55662649 ATGGGTGAAGGGAAGGAAGGAGG - Intergenic
1149497782 17:57131204-57131226 CTGGGTGCGGGGTGGGGGTGGGG - Intergenic
1149523432 17:57335847-57335869 ATGTGTGAGGAGTAGCAGGGAGG + Intronic
1149602576 17:57902947-57902969 CATGGTGAGGGGTTGGAGTGTGG - Intronic
1149814809 17:59713250-59713272 GTGGGTTGGGGGAAGGAGGGAGG + Intronic
1150289790 17:63974530-63974552 GTGGGTGATGGGGAGGAAGGTGG - Intergenic
1150387465 17:64773329-64773351 GTGGGGGAAGGGTGGGAGGGGGG + Intergenic
1150431124 17:65118291-65118313 CTGGGGGAAGGGTGGGAGGGGGG - Intergenic
1150640327 17:66945361-66945383 CTGTGTGGGGGGTGGGATGGGGG + Intergenic
1150889018 17:69123012-69123034 CTGGGGTAGGGGGAGGGGGGAGG + Intronic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151382298 17:73734316-73734338 CTGGGCTGGGGGAAGGAGGGGGG - Intergenic
1151446220 17:74166084-74166106 GTGGGAGTGGGGTTGGAGGGTGG - Intergenic
1151512997 17:74573092-74573114 CTGGATGTGAGGGAGGAGGGAGG + Intergenic
1151720827 17:75855086-75855108 CTGGGGGCGGGGTTGGAGGAAGG - Intronic
1151826933 17:76529045-76529067 GTGGGTGGGGGGTGGGGGGGGGG - Intronic
1151882928 17:76905675-76905697 CTGGGTGGAGGGAGGGAGGGAGG - Intronic
1151947022 17:77325399-77325421 CTGGGTGGCGGGGAGGAGTGGGG + Intronic
1152033563 17:77858280-77858302 TTGGATGAGGGGTGGGTGGGTGG - Intergenic
1152103114 17:78314271-78314293 CAGGGTGAGCGGGAGGAGGGAGG + Intergenic
1152248061 17:79196245-79196267 CTGGGTGTGTGGTAGAAGGTAGG - Intronic
1152266274 17:79296834-79296856 CAGGAGGAGGGGGAGGAGGGGGG - Intronic
1152277031 17:79363893-79363915 GTGGGTGAGGGGGACGAGGTGGG - Intronic
1152280121 17:79380188-79380210 CTGGGGGAGGGGTGGCAAGGGGG - Intronic
1152585206 17:81186220-81186242 CTGGGAGTGGGGTGGGAAGGGGG - Intergenic
1152598356 17:81249198-81249220 GAGGGGGAGGGGGAGGAGGGAGG + Intronic
1152636450 17:81432527-81432549 CCTGGTGATGGGTGGGAGGGTGG - Intronic
1152707736 17:81853752-81853774 GGGAGTGAGGGGCAGGAGGGCGG - Intronic
1152789750 17:82272910-82272932 CTGGGGGAGGGGCAGGGCGGGGG - Intronic
1152802840 17:82339908-82339930 CTGGGGGAGGGGTTGGGGGCAGG - Intergenic
1152911843 17:83009714-83009736 CTGGGTGCGAGGGAGGAAGGAGG + Intronic
1153000197 18:447957-447979 TTGGGTTAGGGGTGGGATGGAGG + Intronic
1153540225 18:6146080-6146102 CTGGGTGAGGGGAAGGGTGGCGG + Intronic
1153724688 18:7942801-7942823 CTGGGTGGGGAGGAGAAGGGAGG - Intronic
1153748944 18:8209821-8209843 CAGGGTGAGGGGTAAGGGGAGGG + Intronic
1153795893 18:8621762-8621784 GAGGGTGATGGGTAGGAGGAAGG - Intronic
1153914564 18:9734089-9734111 CAGGGTGGCGGGGAGGAGGGAGG + Intronic
1154475733 18:14755544-14755566 AGGGGTGAGGGGAAGGAAGGGGG - Intronic
1154980891 18:21501404-21501426 ATGGGTGAGGGGCAAGAGGAGGG - Intronic
1155053680 18:22168257-22168279 CTGGGCGGGGGGTAGGGGGTGGG + Intergenic
1155351105 18:24907070-24907092 GTGGGGTAGGGGGAGGAGGGAGG + Intergenic
1155498019 18:26461566-26461588 CAGCCTGAGGGGTAGGAGTGGGG + Intronic
1155842639 18:30665086-30665108 TTGGGTGTGGGGTAGCAGGAGGG + Intergenic
1156367449 18:36442141-36442163 CTGGGAGAAGGGGAGCAGGGAGG - Intronic
1156371531 18:36475480-36475502 TTGGGTGCGGGGTGGGAGGTGGG + Intronic
1156640349 18:39088000-39088022 CAGGGGGTGGGGTAGGAGTGGGG + Intergenic
1157215914 18:45783315-45783337 CTGAGTGAGGAGTAGGAGTGGGG - Intergenic
1157482271 18:48063068-48063090 TTGGGTGGTGGGAAGGAGGGAGG - Intronic
1157502821 18:48203009-48203031 CTGGGTGAGGGTGAGAAGAGGGG - Intronic
1157564214 18:48668749-48668771 TTGGGCGAGGGGCAGGAGGAAGG - Intronic
1157582550 18:48782039-48782061 CTGAGTGGTGGGCAGGAGGGTGG + Intronic
1157810083 18:50688731-50688753 CTGGGGAAAGGGTGGGAGGGGGG + Intronic
1157856604 18:51110394-51110416 CTGGGAGCAGGGCAGGAGGGAGG + Intergenic
1158126921 18:54110412-54110434 GAGGGTGAAGGGTGGGAGGGGGG - Intergenic
1158642177 18:59213259-59213281 CTGGGGGTGGGATAGGAGTGGGG + Intergenic
1158702169 18:59758012-59758034 CTGGGTGAGGAGAAGGTTGGAGG - Intergenic
1159564798 18:70036543-70036565 GTGGGTGAAGGGTAGCAGGAGGG + Intronic
1159573160 18:70143595-70143617 GAGGGTGGGGGGTAGGAGGCGGG + Intronic
1159720295 18:71881543-71881565 CTGGGGGAGGATGAGGAGGGAGG - Intergenic
1159758821 18:72399064-72399086 GTGGGATAGGGGTAGGGGGGAGG + Intergenic
1160188016 18:76690651-76690673 CTGGGTGAGGGGAGCCAGGGAGG - Intergenic
1160329425 18:77978142-77978164 CTGGGTGTGGGGAAGTAGGGAGG - Intergenic
1160409750 18:78667735-78667757 ATGGGAGAGGGGTGGGAGGGCGG - Intergenic
1160409839 18:78667950-78667972 CTAGGGGAGAGGTGGGAGGGTGG - Intergenic
1160440690 18:78889203-78889225 CTACTTGAGGGGAAGGAGGGAGG + Intergenic
1160702945 19:517375-517397 CTGGGTGGAGGCTGGGAGGGGGG + Intronic
1160702961 19:517406-517428 CTGGGTGGGGGCTGGGAGGGGGG + Intronic
1160702983 19:517457-517479 CTGGGTGGGGGCTGGGAGGATGG + Intronic
1160703027 19:517550-517572 CTGGGTGGGGGCTGGGAGGGGGG + Intronic
1160703055 19:517612-517634 CTGGGTGGGGGCTAGAAGGGGGG + Intronic
1160703083 19:517674-517696 CTGGGTGGGGGCTGGGAGGGGGG + Intronic
1160718176 19:585793-585815 TGGGGTGGGGGGTAAGAGGGAGG - Intergenic
1160762793 19:794070-794092 CTGGGTGAGGTGGAGGCGGTGGG + Intergenic
1160977714 19:1802079-1802101 GTGGGTGAGGGGTGGATGGGTGG - Intronic
1161026578 19:2039949-2039971 CAGGGTGGGGGCTGGGAGGGGGG - Intronic
1161139588 19:2639694-2639716 CAGGGAGTGGGGGAGGAGGGGGG + Intronic
1161166668 19:2791475-2791497 CTGGGCCAGGGGCTGGAGGGAGG + Intronic
1161262101 19:3343824-3343846 CTGGGACAGGGGTGGGTGGGTGG - Intergenic
1161293065 19:3506187-3506209 CGGTGTGTGGGGTAGGCGGGGGG + Intergenic
1161301516 19:3545074-3545096 TTGGGTGTGGGACAGGAGGGAGG - Intronic
1161335165 19:3709036-3709058 CAGGGTGAGGGGTTGGGGGGCGG - Intronic
1161393252 19:4032087-4032109 CTGGGTGGGGGTCAGGAAGGAGG + Intronic
1161490433 19:4558150-4558172 CTGAGTGAGGGGGTGGAGAGGGG + Intronic
1161504332 19:4635933-4635955 CTGGGAGAGGGGTAAGGGGGAGG + Intergenic
1161627676 19:5336771-5336793 CCTGGTGAGCGGTTGGAGGGTGG + Intronic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1161959593 19:7516290-7516312 CTGGGTGGGGGGCGGGCGGGCGG + Intronic
1162128201 19:8510765-8510787 CTGGGTGGGGCAGAGGAGGGGGG + Intronic
1162145166 19:8608899-8608921 ATGGGGTAGGGGGAGGAGGGGGG + Intronic
1162188724 19:8927779-8927801 ATGGGTGAGAGGTAGGGGAGGGG + Intronic
1162237727 19:9321769-9321791 GAGGGTGGGGGGGAGGAGGGCGG - Intergenic
1162741129 19:12774572-12774594 CTGGGTGATGGGCAGGAAGAGGG - Intronic
1162752844 19:12839062-12839084 GTGGGTGAGGGGACGGACGGAGG + Intronic
1162929938 19:13952725-13952747 CGGGGTGAGGGGTTGGGGGCGGG + Intronic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163167150 19:15506349-15506371 CTGGGTGGGGGGTAGAGGTGGGG - Intergenic
1163450388 19:17373580-17373602 GTGGGTGAGAGATGGGAGGGTGG - Intronic
1163633911 19:18429802-18429824 CTGGGGGAGGGGCTGGAGGCGGG - Intronic
1163655818 19:18544079-18544101 CTGTGTGGGGGATGGGAGGGAGG - Intergenic
1163772029 19:19197070-19197092 CAAGGAGAGGAGTAGGAGGGTGG + Intronic
1163844095 19:19628768-19628790 CAGGGTGAGGGGTACGGGGGCGG - Exonic
1164402343 19:27910822-27910844 CTGGGGCCGGGGGAGGAGGGTGG + Intergenic
1164566345 19:29328795-29328817 CTGGGTCCTGGGGAGGAGGGAGG - Intergenic
1164590712 19:29505331-29505353 CTGGGGGAGGGACAGGAGGAGGG + Intergenic
1164629884 19:29755041-29755063 CTGGATGTGGGGGATGAGGGTGG + Intergenic
1164746694 19:30621682-30621704 CTGGGTGAGGAGCAGCCGGGTGG + Intronic
1165108307 19:33487216-33487238 CTGGGTGAGTGGAAGGCAGGGGG + Intronic
1165175391 19:33925740-33925762 CTGGGTGAGGGATAGGAGGAAGG + Intergenic
1165323869 19:35102793-35102815 GTGAGTGAGGGGCAGGTGGGAGG - Intergenic
1165434420 19:35788364-35788386 CTGGGAGTGGGGTAAGGGGGTGG - Exonic
1165712779 19:38024007-38024029 CTTGGGGAGGGGGAGGGGGGTGG + Intronic
1165772807 19:38388617-38388639 TTGGGGGAGGGGTAAGAGCGAGG - Intronic
1165831926 19:38734781-38734803 CTGGGATAGGGGCAGGAGGAGGG - Intronic
1165879291 19:39031563-39031585 CTGTGGGAGGGGTGGGAGTGGGG - Intronic
1165889130 19:39100204-39100226 CTGGGGGAGGGGGCGGAAGGAGG - Intronic
1165922395 19:39307374-39307396 CGAGGGGAGGGGTAGGAGGGGGG + Exonic
1166047693 19:40238991-40239013 CAGGGTGGGAGGTGGGAGGGAGG + Intronic
1166198076 19:41219522-41219544 CTGGGGCAGGGGTAGGAGGTGGG + Intronic
1166273844 19:41737128-41737150 ATGGGGTGGGGGTAGGAGGGAGG + Intronic
1166303647 19:41925875-41925897 ATGGGTGAGGGCCAGGAGGCTGG + Intronic
1166332716 19:42088171-42088193 TTGGGAAGGGGGTAGGAGGGAGG - Intronic
1166567807 19:43775774-43775796 CTGGGTCTGGGGCAAGAGGGAGG + Intronic
1166589215 19:43981777-43981799 TTGGTTTAGGGGTAGGAAGGAGG + Intronic
1166701675 19:44885918-44885940 CAGGCTGTGGGGTAGGAGGTAGG - Exonic
1166772807 19:45294471-45294493 CAGGGTGAGGGGTGGGAAGTAGG + Intronic
1166850282 19:45756780-45756802 ATGGGTGAAGGGCAGGAGAGAGG - Intronic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1166965696 19:46528376-46528398 CTGGGTGATGGGGTGGAAGGTGG - Intronic
1167044068 19:47039703-47039725 CAGGGTGATGGGGAGAAGGGAGG + Intronic
1167147900 19:47693991-47694013 ATGGGTGTGGGCTAGGAAGGGGG + Intronic
1167334445 19:48875822-48875844 CTGGGTGAGGGCAGGGATGGGGG - Exonic
1167441704 19:49512910-49512932 CTGGGTCTGAGGGAGGAGGGAGG + Intronic
1167608191 19:50492867-50492889 AGGGGTGAGGAGGAGGAGGGAGG + Intergenic
1167612216 19:50513012-50513034 CTGGGAGAGGGGAAAGAGGGCGG + Intronic
1167631801 19:50630141-50630163 CTGGGTGAGGGGTCGGGGCAGGG + Exonic
1167756833 19:51417894-51417916 CTGGGGGTGGGGTAGTGGGGTGG + Intergenic
1167820322 19:51921916-51921938 CTCGGTGAGGGGGATGTGGGAGG - Intronic
1167909336 19:52689502-52689524 CAGGGTGAGGGAGAGGAGGAGGG - Intronic
1167991819 19:53366666-53366688 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1167999469 19:53432912-53432934 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168003841 19:53469673-53469695 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168371603 19:55839121-55839143 GTGGGTGAGGGGTGGGAAAGGGG - Intronic
1168498911 19:56876987-56877009 CTGTGTCATGGGTGGGAGGGAGG - Intergenic
1202659527 1_KI270708v1_random:55117-55139 GTTGGTGGGAGGTAGGAGGGAGG + Intergenic
925121500 2:1421990-1422012 CTGGGGCAAGGGCAGGAGGGAGG - Intronic
925169736 2:1743628-1743650 CTGGGGGAGGAGAAGGAAGGGGG + Intronic
925253673 2:2464149-2464171 CTGGATGAAGGGTAGGAAGATGG + Intergenic
925313822 2:2906842-2906864 CGGGGGGAGGGGGTGGAGGGAGG - Intergenic
925917231 2:8615410-8615432 CCGGGTCAGGGGATGGAGGGCGG + Intergenic
925961721 2:9023399-9023421 CAGGGAGAAGGGTGGGAGGGGGG + Intergenic
926071110 2:9892479-9892501 CTGGGTGAAGCTGAGGAGGGAGG - Intronic
926085389 2:10016580-10016602 CAGGGTGAGTAGGAGGAGGGAGG + Intergenic
926105112 2:10145067-10145089 CTGCGGGAGGGAAAGGAGGGAGG + Intronic
926221980 2:10942366-10942388 CTGGGTGAGGGATATGAGGGTGG - Intergenic
926393448 2:12417811-12417833 ATGGGGGAGGGGCAGGAGGGAGG - Intergenic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
927702115 2:25275412-25275434 GTGTGTGAGGGGGCGGAGGGTGG - Intronic
927703079 2:25280318-25280340 CGGGGTGGGGGGTGGGGGGGCGG - Intronic
927864596 2:26580452-26580474 CTGGGGCAGGGGTGGGACGGGGG + Intergenic
927913416 2:26917530-26917552 TTGGGTGTGGGGTTGGGGGGTGG + Intronic
927932334 2:27053050-27053072 ATGGGGAAGGGGTAGGAGGTGGG + Exonic
928230904 2:29498251-29498273 CTGGGTTTGGGGGAGGAGGTTGG + Intronic
928282192 2:29957685-29957707 CTGGGGGAGGGGGAGAAGTGGGG - Intergenic
928776107 2:34765582-34765604 GTGGGTGAGGGGAAAGAGGAGGG + Intergenic
928907237 2:36381107-36381129 CTGTGTGGGGGGTAGGGGCGGGG - Intronic
928940824 2:36725590-36725612 CTAGTTGAGGGGTGGGGGGGGGG + Intronic
929561588 2:42959690-42959712 CTGGGTTAGGGGTGGGCGTGGGG + Intergenic
929787407 2:45002443-45002465 CAGGGTGAGGGGGTGAAGGGTGG + Intergenic
929935997 2:46295221-46295243 GAGGGTGAGGGGTGGGAGGAGGG - Intronic
930027862 2:47040332-47040354 CTGGGAAAGGGGAAGGAGCGTGG - Intronic
930066556 2:47332303-47332325 GAGGGTGAGGAGTAGGAGGTGGG + Intergenic
930136369 2:47906557-47906579 CGGGGGGAGGGGTGGGTGGGCGG + Intergenic
930751295 2:54937034-54937056 CTGTGGGAGGCGGAGGAGGGTGG + Intronic
931215183 2:60235462-60235484 GTGGGATGGGGGTAGGAGGGAGG - Intergenic
931689072 2:64819943-64819965 GTGGGAGAGGGGTACGGGGGTGG - Intergenic
932158436 2:69438855-69438877 CTGGGTGGGGGGTTGGATGGGGG - Intergenic
932158448 2:69438885-69438907 GTGGGTGGGGGGTTGGATGGGGG - Intergenic
932270923 2:70408814-70408836 TTGGGGGAAGGGTAGGGGGGAGG + Intergenic
932290445 2:70572779-70572801 GTGGGGGAGGGGTAGGAAGAAGG + Intergenic
932343646 2:70982130-70982152 CTGGGGGAGGGGAAGGGGGTGGG - Intronic
932414898 2:71567742-71567764 CTTGGTGAGGGGTAGGGGGTGGG + Intronic
932457245 2:71857599-71857621 TTTGGTGAGGGGTAGGAGGGAGG - Intergenic
932539133 2:72633243-72633265 CTGGGATAGGGGTAGGAGGTTGG - Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932604996 2:73159285-73159307 CTGGGAGACGGGAAGAAGGGAGG + Intergenic
932804188 2:74768834-74768856 CTGGGGTCGGGGTATGAGGGTGG - Intergenic
932881206 2:75503767-75503789 GTGAGTGGAGGGTAGGAGGGAGG + Intronic
933709583 2:85315573-85315595 CTGGGTGAGGGGGTGGAGGGAGG + Intergenic
933726567 2:85430649-85430671 CTGGGTGAGGGCTAGGAGGTGGG + Intronic
934299558 2:91769019-91769041 CTGGGGGAGGGGCGGGGGGGAGG - Intergenic
934619150 2:95793556-95793578 CAGGGTGAGGGGTGGGAATGGGG + Intergenic
934641741 2:96031001-96031023 CAGGGTGAGGGGTGGGAATGGGG - Intronic
935589800 2:104835828-104835850 CAGGGTGTGGGGGAGGTGGGGGG + Intergenic
935746735 2:106195522-106195544 TTAGGGGAGGGGTAGGATGGAGG - Intergenic
935849008 2:107198494-107198516 CTTTGTGAGGCCTAGGAGGGTGG + Intergenic
935854958 2:107263759-107263781 GTGGATGTGGGGGAGGAGGGTGG + Intergenic
935883170 2:107587167-107587189 TGGGGTGGGGGGGAGGAGGGAGG + Intergenic
936495678 2:113018775-113018797 CTGGAAGAGGGGTTGGAGGCAGG + Intergenic
936667287 2:114610908-114610930 CTGGGTGCGTGGGAGAAGGGGGG - Intronic
937098512 2:119250986-119251008 CGGGGTGGGTGGTCGGAGGGAGG + Intronic
937100217 2:119262955-119262977 CTGGCGGAGGGGAAGGAGGGTGG - Intronic
937289317 2:120772540-120772562 CTGGCTGAGTGATAGGAAGGAGG + Intronic
937291838 2:120786457-120786479 TTGGGCGGGGGGTTGGAGGGTGG - Intronic
937308734 2:120888170-120888192 GTCGGGGAGGGGTAGAAGGGAGG + Intronic
937346746 2:121130672-121130694 CTGGCTGAGAGGTGGGAGGAGGG - Intergenic
937471258 2:122175831-122175853 GTAGGTGAGGGGAAGTAGGGAGG + Intergenic
937956847 2:127426531-127426553 ATGGGAGAGGGCTAGGAGGGAGG + Intronic
938131192 2:128716739-128716761 TTGGATGAGGGGTGGGAGGATGG + Intergenic
938143261 2:128813195-128813217 CTGGGGGTGAGGTGGGAGGGAGG - Intergenic
938218192 2:129541047-129541069 TAGGGTGGGGGGGAGGAGGGGGG + Intergenic
938285882 2:130116494-130116516 CAGGGTGAAGGGTGGGAGGAGGG - Intronic
938429723 2:131222408-131222430 CAGGGTGAAGGGTGGGAGGAGGG + Intronic
938557913 2:132442388-132442410 CTGGGCGTGGGGGTGGAGGGGGG + Intronic
938966351 2:136392074-136392096 CTGGGGCAGGGGAAGCAGGGAGG - Intergenic
939278660 2:140034863-140034885 GAGGGTGAGGGGTGGGAGGAAGG - Intergenic
939766407 2:146255641-146255663 CTTGGTGAGGGGTGGTGGGGAGG + Intergenic
939832258 2:147087225-147087247 CTTTGGGAGGGCTAGGAGGGAGG + Intergenic
939984238 2:148814317-148814339 CTGGGTGGGGTGGAGGTGGGAGG + Intergenic
940612138 2:156005984-156006006 GTGGGTGAAGGGAAGGAGAGAGG - Intergenic
941015340 2:160349824-160349846 CGGGGTGGGGGGGTGGAGGGGGG + Intronic
941096566 2:161244803-161244825 CAGGGTCAGGGGTGAGAGGGAGG - Intergenic
941612329 2:167677067-167677089 CTGGGTGAGGGGTAGGAAAAAGG + Intergenic
941758329 2:169212764-169212786 TTGGGGGAAGGGTGGGAGGGGGG + Intronic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942275934 2:174323663-174323685 CAGGGTGGGGGGTTGGGGGGAGG + Intergenic
942371864 2:175294108-175294130 CAAGGTCAGGGGGAGGAGGGTGG + Intergenic
942601910 2:177650098-177650120 ATGGGGGAGTGGGAGGAGGGAGG - Intronic
942844630 2:180408348-180408370 CTGGGGGCGGGGAATGAGGGTGG - Intergenic
943169952 2:184385811-184385833 CTGGGTTTGGGGTAGGGGTGAGG - Intergenic
943172135 2:184415493-184415515 CTTTGGGAGGTGTAGGAGGGCGG - Intergenic
943669335 2:190644744-190644766 GAGGGTGAGGGGTGGGAGGACGG + Intergenic
943716566 2:191159276-191159298 CTGGTTGAGGGGGATGAGTGAGG + Intergenic
944392223 2:199229185-199229207 CTGGGTGATGGGTATGCGGCAGG - Intergenic
944551807 2:200851044-200851066 CTTGGGGAAGGGTGGGAGGGAGG - Intergenic
944902542 2:204230438-204230460 CTAGGTGATGGGTAAGATGGTGG + Intergenic
945027916 2:205637060-205637082 GGGGGTGGGGGGGAGGAGGGAGG - Intergenic
945259380 2:207830015-207830037 CGGGGTGGGGGGTTGGAAGGGGG + Intronic
945782822 2:214198239-214198261 GTGGGGGAAGGGTAGGAGAGAGG - Intronic
945844120 2:214923216-214923238 GTGGGGGAGGGGGAGCAGGGGGG - Intergenic
945918121 2:215726151-215726173 CAGGGAGAGGGGAGGGAGGGAGG + Intergenic
946011056 2:216563828-216563850 CTGGGTGGGGGGTGGGTAGGCGG - Intronic
946365708 2:219247754-219247776 CTGGGTGAGGAGCATGTGGGTGG + Exonic
946513983 2:220391775-220391797 GTGGGTGCAGGGGAGGAGGGAGG + Intergenic
946807207 2:223482816-223482838 GTGGGGTAGGGGAAGGAGGGAGG + Intergenic
947283790 2:228486989-228487011 GTGGGGTAGGGGGAGGAGGGAGG - Intergenic
947620958 2:231590756-231590778 CTGGGAGAGGTGGAGGAGGGAGG + Intergenic
947626400 2:231621743-231621765 GTGGGTGCGGGGGATGAGGGGGG + Intergenic
947669235 2:231926110-231926132 CTGGGAGAGGCGTGGGAGGCTGG - Intronic
947739961 2:232480527-232480549 CTGGGTGGGGGGCAAGGGGGCGG - Intronic
947744858 2:232502253-232502275 ATGGGGGAGGGGTGGGAGGAGGG + Intergenic
948118405 2:235510984-235511006 CTGGGTGGGGGGGCGGGGGGCGG + Intronic
948577415 2:238963803-238963825 CTGGCTGTGGGGCTGGAGGGTGG - Intergenic
948765389 2:240216672-240216694 CAGGGTGAGGGGTGGGGGTGGGG + Intergenic
948765578 2:240217089-240217111 CAGGGTGAGGGGTGGGGGGGTGG + Intergenic
948789514 2:240370086-240370108 CTGTGTCTGGGGGAGGAGGGTGG + Intergenic
948815350 2:240507541-240507563 CCTGGTGAGGGGCAGGAGGCTGG - Exonic
948892556 2:240914600-240914622 CTGAGTGAGGGGTGGGATGGAGG - Intergenic
948911048 2:241002869-241002891 GAGGGTGAGGGAGAGGAGGGAGG - Intronic
949034428 2:241810095-241810117 CTGGGGCAGGGGCAGGTGGGTGG - Intronic
1168756494 20:322046-322068 CTGGGTGATGGAAAGAAGGGAGG - Intergenic
1168780046 20:481481-481503 TTGGGTGGGGGGTGGGGGGGAGG - Exonic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1169091588 20:2864284-2864306 CTGGGTGAGGGCAAGGCTGGGGG + Exonic
1169143013 20:3236724-3236746 CTGGTTGAGGGGCAGAGGGGAGG - Intronic
1169204584 20:3732632-3732654 CTGGGGGAGGGGGCGGCGGGCGG + Intergenic
1169273362 20:4217197-4217219 CTGGGTGTGAGCTATGAGGGAGG + Intergenic
1169278909 20:4250762-4250784 CTGGGCAATGGGGAGGAGGGAGG - Intergenic
1169831552 20:9831029-9831051 CTGGGCATGGGATAGGAGGGGGG - Intronic
1170109985 20:12794762-12794784 GTGGGTGAAGGGTAGGAAGTAGG - Intergenic
1170184049 20:13567268-13567290 GAGGGTGAAGGGTGGGAGGGGGG + Intronic
1170383871 20:15794957-15794979 TTGGGTGGGGGGTAGGAAAGAGG - Intronic
1170576742 20:17668805-17668827 CTGGGACAGGGGTAGGGGTGCGG - Intronic
1170927608 20:20740133-20740155 CAGGGTAAAGGGTGGGAGGGGGG + Intergenic
1171388012 20:24783159-24783181 CTGGGCAGGGGGAAGGAGGGAGG - Intergenic
1171480436 20:25451707-25451729 CTGGGGTAGGGGGAGGGGGGAGG - Intronic
1171775774 20:29366199-29366221 GTGGGGTAGGGGTAGGGGGGAGG - Intergenic
1171777953 20:29388230-29388252 CTGGGTGGGGGGTGGGGGAGTGG + Intergenic
1172015723 20:31871203-31871225 TTGGGAGAGGGGTTTGAGGGAGG + Intronic
1172182975 20:33014880-33014902 CTGGGGGGGAGGTGGGAGGGTGG - Intronic
1172240827 20:33411483-33411505 CTGGGGGAGGTGGAGGTGGGTGG - Intronic
1172275555 20:33677082-33677104 GTGGGTGATGGGTAGGTGGGTGG - Intronic
1172479924 20:35265096-35265118 TGGGGTGAGAGGAAGGAGGGAGG + Intronic
1172502334 20:35436375-35436397 GTGGGGGAGGGGTCAGAGGGTGG - Intronic
1172625256 20:36343008-36343030 CTGAGTGAGGGGGAGGGGAGAGG + Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1172930914 20:38585967-38585989 CTGGGTCAGGGGTAGGAGACAGG + Intronic
1173000253 20:39100528-39100550 TTGTGTGTGTGGTAGGAGGGGGG - Intergenic
1173022062 20:39274984-39275006 TGGGGTGAGGGGTAGGAGATAGG - Intergenic
1173177767 20:40777448-40777470 GTGGGGGTGGGGTGGGAGGGTGG - Intergenic
1173205650 20:40991194-40991216 CTGGTTGAGGAGTTGGTGGGGGG - Intergenic
1173222029 20:41138412-41138434 CTGGGGGAGAGGGAGGAAGGTGG + Intronic
1173222829 20:41143464-41143486 ATGGGTGTGGGATAGGAGGATGG + Intronic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1173570496 20:44072586-44072608 CGGGGTGGTGGTTAGGAGGGAGG + Intergenic
1173577753 20:44123999-44124021 CTGGGTGAGGGTCTGGAGGATGG + Intronic
1174082810 20:47983064-47983086 CTGGGTGAGGAACAGCAGGGGGG + Intergenic
1174133147 20:48359918-48359940 CTGGGTGAGGAACAGCAGGGAGG - Intergenic
1174263485 20:49314506-49314528 CTGGGTGGGGAGAAGGAAGGAGG - Intergenic
1174263924 20:49318213-49318235 CTCGGTGACAGGTAGGAGGTGGG + Intergenic
1174339852 20:49888896-49888918 CTGGGAGAGGGGAAAGAGGATGG - Exonic
1174396225 20:50248345-50248367 CTGGGTGAGGGGCAGATGGGTGG - Intergenic
1174410364 20:50331083-50331105 CAGGGTGAGGGGTAAGAAAGGGG + Intergenic
1174448908 20:50608234-50608256 CTGACTGAGGGGTGGGAGTGAGG + Intronic
1175084552 20:56447580-56447602 GGAGGTGAGGGGTAGGAGGTGGG - Intronic
1175199784 20:57268891-57268913 CAGGGTGAGGTGATGGAGGGTGG + Intergenic
1175230373 20:57469934-57469956 CTGGGGGTGGGGTGGGTGGGGGG + Intergenic
1175270758 20:57732270-57732292 GGGGGTGTGGGGAAGGAGGGAGG - Intergenic
1175356848 20:58375407-58375429 ATGGGGGAGGGGGAGGAGGAGGG - Intergenic
1175375847 20:58523453-58523475 CTGGGTGGGGGGTGGGGGTGGGG - Intergenic
1175599133 20:60258478-60258500 CTGAGTGTCGGTTAGGAGGGTGG + Intergenic
1175706358 20:61180658-61180680 CTGGGTGAGAGATAGGCAGGTGG - Intergenic
1175766072 20:61594010-61594032 GTGGGAGAGAGGGAGGAGGGAGG + Intronic
1175919671 20:62444791-62444813 CTGGGGCAGGAGAAGGAGGGTGG + Intergenic
1175994637 20:62806670-62806692 CTGGGGGAGTGCTAGAAGGGGGG - Intronic
1176034881 20:63031379-63031401 CTGGGGCTGGGGGAGGAGGGAGG + Intergenic
1176098866 20:63356113-63356135 CAGGGTGAGGGGTGTGGGGGAGG + Intronic
1176098898 20:63356189-63356211 CAGGGTGAGGGGTGTGAGGGAGG + Intronic
1176098920 20:63356243-63356265 CAGGGTGAGGGGTGTGAGGGAGG + Intronic
1176098951 20:63356313-63356335 CAGGGTGAGGGGTGTGGGGGAGG + Intronic
1176135935 20:63521976-63521998 CAGGGTGGGGGGTGGGAGGTGGG - Exonic
1176200113 20:63856232-63856254 CCGGGTGTGGGTGAGGAGGGGGG - Intergenic
1176209839 20:63913970-63913992 CTGCCTGAGGGGTGGGAGGATGG - Intronic
1176214737 20:63942655-63942677 CTTGGTCGGGGGCAGGAGGGAGG - Intronic
1176234769 20:64049140-64049162 CTGGGTGAGCGGCGGGAGGGCGG - Exonic
1176239153 20:64067911-64067933 CTGGGTGAGGGGCTGGGGGCGGG + Intronic
1176723786 21:10413784-10413806 CAGCCTGAGTGGTAGGAGGGTGG + Intergenic
1176796316 21:13373119-13373141 CGGCCTGAGCGGTAGGAGGGGGG - Intergenic
1177112136 21:17041431-17041453 CAGGGTAAAGTGTAGGAGGGGGG - Intergenic
1177196913 21:17912748-17912770 CTGGATCAGGGGTGGGAGGCAGG + Intronic
1177758269 21:25373602-25373624 GTGGGAGAGGGGGAGGAGGAGGG - Intergenic
1178533272 21:33392672-33392694 CTGGGTGTGTGTTGGGAGGGGGG + Intergenic
1179177912 21:39022080-39022102 CTGGGTGGGTGCTAGGAGAGAGG - Intergenic
1179452305 21:41474879-41474901 GTGGGTGAGGGGTGGGTGAGGGG + Intronic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1179644428 21:42766954-42766976 CTGGGGGTGGGGTGGGAGTGGGG - Intronic
1179787810 21:43739880-43739902 TGGGGTAAGGGGTAGGAGGAGGG - Intronic
1180190649 21:46161003-46161025 CCGGGGGAGGGGAAGGGGGGAGG + Intergenic
1180304931 22:11066525-11066547 CAGCCTGAGCGGTAGGAGGGTGG + Intergenic
1180326995 22:11438678-11438700 GTTGGTGGGAGGTAGGAGGGAGG + Intergenic
1180464376 22:15597884-15597906 CCTGGAGAGGGGTAGGAGGCAGG - Intergenic
1180926800 22:19560786-19560808 AAGGGTGAGGGGTGGGAGAGAGG + Intergenic
1180946726 22:19698477-19698499 CTGGGGTGGGGGTGGGAGGGTGG + Intergenic
1181002284 22:19993495-19993517 CTGGGGGAAGGCTAGGAAGGGGG + Intronic
1181084607 22:20433762-20433784 CTGGGTCAGGGCTGGGTGGGTGG - Intronic
1181127513 22:20710670-20710692 CTGGGTGAGGGCCAGGGTGGAGG - Intronic
1181185899 22:21103407-21103429 CTGGGTGGGGGGGAGGGGGGAGG + Intergenic
1181240845 22:21475973-21475995 CTGGGTGAGGGCCAGGGTGGAGG - Intergenic
1181335021 22:22123022-22123044 ATGGGAGAGGGGCAGGAGTGGGG - Intergenic
1181595247 22:23910244-23910266 TTGGGTGAAGAGTTGGAGGGTGG - Intergenic
1181595254 22:23910278-23910300 TTGGGTGAAGAGTTGGAGGGTGG - Intergenic
1181875240 22:25935509-25935531 TTGGGTGAGGGGGAGGTGAGAGG + Intronic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182089786 22:27586277-27586299 ATGGGTGAGGGATAGGTTGGTGG - Intergenic
1182243180 22:28933788-28933810 GAGGGGGAGGGGGAGGAGGGAGG - Intronic
1182786919 22:32915677-32915699 GTGGGTAAGGGGCAGGAGGGTGG + Intronic
1182892670 22:33832013-33832035 CTGGGTGAAAGGAAGAAGGGAGG - Intronic
1182896199 22:33861363-33861385 GTGGGTGAGGAGTGGGAGTGAGG - Intronic
1183188211 22:36304624-36304646 CTGGGAGTGGGGAGGGAGGGAGG + Intronic
1183398609 22:37587894-37587916 ATGGGTGAGGAGGTGGAGGGAGG + Intergenic
1183470943 22:38006427-38006449 CTGAGTGAGCGGCTGGAGGGTGG - Intronic
1183491024 22:38115682-38115704 CTAGGGGCGGGGAAGGAGGGCGG + Intronic
1183606144 22:38867669-38867691 CTTGGTGCGGGGGAGCAGGGAGG - Intronic
1183952279 22:41358484-41358506 CTGTGTGAGGTGTGGGAGGTGGG + Exonic
1183984760 22:41563279-41563301 CTGGGGGAGGGGGAGGAGCCAGG + Intronic
1184099944 22:42336704-42336726 CTGGGTGTGGGGCAGAAAGGAGG - Intronic
1184117943 22:42432824-42432846 TTTGGTGAGGGGTGGTAGGGAGG + Intergenic
1184150643 22:42636363-42636385 CTGGGGGAGGGGGAGGAGGGAGG + Intronic
1184151702 22:42643441-42643463 CAGGGTGGGGGGTGGGGGGGCGG - Intronic
1184301241 22:43562500-43562522 CTGGGTTGGGGGTGGGAGGGAGG + Intronic
1184301251 22:43562526-43562548 CCCGGTCAGGGGTGGGAGGGAGG + Intronic
1184301271 22:43562578-43562600 CCCGGTGGGGGGTTGGAGGGAGG + Intronic
1184301283 22:43562605-43562627 CCAGGTCAGGGGTGGGAGGGAGG + Intronic
1184301293 22:43562631-43562653 CCTGGTGCGGGGTGGGAGGGAGG + Intronic
1184301316 22:43562684-43562706 CCAGGTCAGGGGTGGGAGGGAGG + Intronic
1184301326 22:43562710-43562732 CCTGGTGCGGGGTGGGAGGGAGG + Intronic
1184301337 22:43562736-43562758 CCCGGTGGGGGGTTGGAGGGAGG + Intronic
1184301349 22:43562763-43562785 CCAGGTCAGGGGTGGGAGGGAGG + Intronic
1184301359 22:43562789-43562811 CCTGGTGCGGGGTGGGAGGGAGG + Intronic
1184467324 22:44676611-44676633 CGGGGTGAAGAGGAGGAGGGGGG + Intronic
1184533355 22:45070762-45070784 CAGGGTGAGGGGTAGGGCAGGGG - Intergenic
1184661349 22:45967028-45967050 CTGGGTGAGGGGCAGGGATGGGG + Intronic
1184685434 22:46094712-46094734 CTGGGTGAGTGGTGGCAGGCAGG + Intronic
1184694321 22:46131261-46131283 CTGGATGTGGGCTAGGAGGGGGG - Intergenic
1184717557 22:46290571-46290593 GAGGGTGAGTGTTAGGAGGGTGG + Intronic
1184717565 22:46290602-46290624 GAGGGTGAGTGTTAGGAGGGTGG + Intronic
1184717579 22:46290659-46290681 GAGGGTGAGTGTTAGGAGGGTGG + Intronic
1184742998 22:46439924-46439946 CTGTGTGAGGGGTGGGAGGGCGG - Intronic
1184785445 22:46669373-46669395 CTGGCGGCGGGGAAGGAGGGTGG + Intronic
1184799547 22:46751369-46751391 CTGGGAGAGGGGCAGGACAGTGG + Intergenic
1184892744 22:47389709-47389731 CTGGGTGGGGGAGGGGAGGGGGG - Intergenic
1185121418 22:48973879-48973901 CTGGAAGAGCAGTAGGAGGGAGG - Intergenic
1185333162 22:50260682-50260704 GTGGTGGAGGGGGAGGAGGGGGG - Intronic
1185340451 22:50288591-50288613 CTGGATGAGGGGTGGCTGGGTGG - Intronic
1185347040 22:50314982-50315004 CTGGGTGAACGGTGGGAGAGCGG - Intronic
949291589 3:2472885-2472907 GTGCATGAGGGGTAGGAGTGTGG + Intronic
949712321 3:6885577-6885599 CTGGGTGTGTGGTAGGAGGCAGG - Intronic
949970893 3:9403060-9403082 GTGGGGGAGGGGCAGGAGGTAGG + Intronic
950156272 3:10723765-10723787 CTGAGTGTTGGGAAGGAGGGTGG + Intergenic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950486831 3:13278817-13278839 CTTGGTGAGGGGCAGGGTGGGGG + Intergenic
950674509 3:14546418-14546440 GGGGGTGAGGGGTCTGAGGGAGG + Intergenic
950941667 3:16898908-16898930 CTGTGGCAGGGGTTGGAGGGTGG + Intronic
951126107 3:18985467-18985489 TTGGATGTGGGGCAGGAGGGAGG - Intergenic
951204273 3:19909548-19909570 CTGGGGGTGGGGTAGGTGGTGGG + Intronic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951451981 3:22850386-22850408 GTGGGGTAGGGGTAGGCGGGAGG + Intergenic
952107534 3:30087584-30087606 GAGGGGGAGGGGGAGGAGGGAGG - Intergenic
952252986 3:31672361-31672383 CGGGGGGGGGGGCAGGAGGGAGG + Intronic
952447876 3:33400671-33400693 ATGGGTGAGGGATAAGAGAGAGG + Intronic
952535687 3:34306620-34306642 GAGGGTGAAGGGTAGGAGGTGGG - Intergenic
952873024 3:37919102-37919124 CTTGGTGGGGGGTAGGGGGAAGG - Intronic
952927149 3:38328671-38328693 CTGGGTGAGGGGCCAGAGTGTGG - Intergenic
952942233 3:38453943-38453965 CGGGGGGAGGGGTGGGGGGGAGG - Exonic
952949917 3:38514755-38514777 CAGGGGGAGGGGGGGGAGGGTGG - Intronic
953277302 3:41514774-41514796 AAGGGTGAGGGGTGGGAGGAAGG + Intronic
954126995 3:48537142-48537164 CTGGGTGTGGGGGTGCAGGGTGG + Intronic
954334768 3:49909772-49909794 CTGGGGGAGGGGGTGGAGGAGGG + Intronic
954392235 3:50273825-50273847 CCAGGTGAGGGGCAGGAGGTAGG + Exonic
954409408 3:50363933-50363955 CAGGGCGAGGGGTTGGTGGGAGG - Intronic
954611083 3:51944907-51944929 CTGGGTGAGGGGTGAGAGGCAGG + Exonic
954625413 3:52019636-52019658 CTGTGTGAGGGGCAGAGGGGTGG + Intergenic
954749756 3:52806790-52806812 CTGGCTGAGGGGCAGCAGAGCGG - Intronic
954796918 3:53166163-53166185 CTGGGTTGGGGGCAGAAGGGAGG + Intronic
955201415 3:56855158-56855180 AGAGGTGAGGGGCAGGAGGGAGG + Intronic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
955600667 3:60641983-60642005 GTGGGTTAGGGGTAGGGGGTGGG + Intronic
955633452 3:61000109-61000131 CTGAGTGAGGGTGAGAAGGGAGG + Intronic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
956409016 3:68959517-68959539 CAGGGGGAAGGGCAGGAGGGGGG - Intergenic
956728880 3:72178370-72178392 CTGGGGAAGGGGTAGGGTGGGGG + Intergenic
956823292 3:72973207-72973229 CTGGGGGAGGGGCACCAGGGAGG + Intronic
957078777 3:75620309-75620331 GTGGGTGGGGGGAGGGAGGGAGG - Intergenic
957373645 3:79328794-79328816 CTGGGTGAAAGATGGGAGGGGGG - Intronic
958119416 3:89264454-89264476 CTGAGCAAGGGGTACGAGGGAGG - Intronic
958206407 3:90402052-90402074 TTGGGTTGGGGGTAGGGGGGAGG - Intergenic
959191591 3:103119319-103119341 CTGGGGGAGGGAGAGGAGAGTGG + Intergenic
959892426 3:111571052-111571074 CAGGCTGTGGGGTAGGAGGTAGG + Intronic
960225136 3:115159271-115159293 CAGGGAGAGGGGTGGGAGGATGG - Intergenic
960388453 3:117049821-117049843 TGGGGGGAAGGGTAGGAGGGGGG + Intronic
960664080 3:120093884-120093906 AAGGGGGATGGGTAGGAGGGAGG + Intronic
960689092 3:120324693-120324715 CTGGGGGAGGGGGAAGAAGGTGG + Exonic
960743606 3:120861878-120861900 GTGGGTTAGGGGTAGGGGGAGGG - Intergenic
960788500 3:121400214-121400236 CTGGGTGAGAGGTAGGTGGGAGG - Intronic
961055653 3:123786520-123786542 GTGGGGGTGGGGGAGGAGGGGGG + Intronic
961396797 3:126599235-126599257 CAGGGAGAGGGGAAGGAAGGAGG - Intronic
962276185 3:134015430-134015452 CTGGGGGTGGGGTGGGAGGGGGG + Intronic
962317577 3:134368374-134368396 CTGGGTGAGTGGGGGGTGGGGGG - Intronic
962342628 3:134598041-134598063 CTGGGTGAGGGTATGCAGGGTGG - Intronic
962730837 3:138282051-138282073 CTGGCTGAGAAGTAGGAGCGGGG - Intronic
962845984 3:139274281-139274303 CTGGGTGATGGGGTGCAGGGTGG - Intronic
963584323 3:147165042-147165064 GAGGGTGGGGGGTAGGAGGATGG + Intergenic
964796297 3:160501321-160501343 TTGGGTGGGGGGAAGGAGGTGGG + Exonic
964985266 3:162731168-162731190 CTCGGGGAAGGGTGGGAGGGGGG - Intergenic
965521011 3:169668224-169668246 CTGGGGGAGCGAGAGGAGGGTGG + Intergenic
965643482 3:170855884-170855906 CTGGGTGAGGAGTGAGAGGTGGG + Intronic
966156843 3:176925770-176925792 GTGGGGTGGGGGTAGGAGGGAGG + Intergenic
966469689 3:180275042-180275064 CTGGGTGAGGGCAGGCAGGGAGG + Intergenic
967122753 3:186397983-186398005 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
967287595 3:187888642-187888664 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
968045912 3:195623886-195623908 GTGGGGGTGGGGTTGGAGGGTGG + Intergenic
968251097 3:197214678-197214700 TGGGGGGAGGGGTAGGAGGAGGG + Intronic
968308742 3:197666201-197666223 GTGGGGGTGGGGTTGGAGGGTGG - Intergenic
968348007 3:198027507-198027529 CTGGGGGAGGAGGAAGAGGGAGG - Intronic
968434491 4:577374-577396 CTGAGTGAGGGGGACGAGGGCGG + Intergenic
968534418 4:1113988-1114010 CGGGGAGCGGGATAGGAGGGAGG + Intergenic
968605228 4:1532242-1532264 CAGGGTGTGGGCTATGAGGGAGG + Intergenic
968612802 4:1564701-1564723 CAGAGTGAGGGGCAGGATGGGGG + Intergenic
968615851 4:1577419-1577441 CAGGGTGCGGGGTGGTAGGGGGG + Intergenic
968646902 4:1745741-1745763 CTGGGTGTGGGTGTGGAGGGAGG + Intergenic
968662873 4:1806028-1806050 CTGGGGAAGGGGTGGGAGGCAGG - Intronic
968870422 4:3239235-3239257 CTGGGTGAGGGGAGCGAGGGTGG + Intronic
969136293 4:5031809-5031831 CTGGGTGAGGGATCTGAGGAGGG - Intergenic
969440276 4:7212862-7212884 CAGGGTGAGGAGTTGGAGGAGGG + Intronic
969471466 4:7391818-7391840 CTGGGTGAGGGGCTGGAAGGAGG - Intronic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
969518536 4:7662218-7662240 GTGGGGGAGGGGGGGGAGGGTGG - Intronic
969599892 4:8170104-8170126 CTGGGTTCAGGGTAGGAGGGTGG + Intergenic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
969870845 4:10103790-10103812 TTGGGAGAGTGGGAGGAGGGAGG - Intronic
969871860 4:10109703-10109725 CTGGGTGGGGAGTAGGAGAGGGG - Intronic
970256146 4:14172154-14172176 CTGGCTGAGGGGTAGTGGAGGGG + Intergenic
970305555 4:14728188-14728210 GTGGGGGAGGGGGAGGGGGGAGG + Intergenic
970394260 4:15650059-15650081 CTGGGGGATGGGTAGTGGGGTGG - Intronic
970550066 4:17171450-17171472 CTGTGAGAGGGGTAGAAGGTGGG - Intergenic
970791477 4:19862944-19862966 CTGGGGCAGGGGGAGGGGGGAGG - Intergenic
971276430 4:25202021-25202043 ATAGGTGAGGGGTTGGAGGGAGG + Intronic
971380321 4:26091290-26091312 CCGGGTGAAGGGTGGGAGCGGGG - Intergenic
972166182 4:36287124-36287146 CTGGGGAAAGGGTGGGAGGGAGG - Intronic
972778673 4:42266286-42266308 ATGGGTGGGGGGAAGGAAGGTGG - Intergenic
972793549 4:42395339-42395361 CTGGGCGAGGGGTTGGGGGGAGG - Intergenic
973088197 4:46095966-46095988 CTGGGTGGGGAGTGGGAAGGAGG - Intronic
973336130 4:48958605-48958627 CTAGGTGAGGGAGTGGAGGGGGG + Intergenic
973535372 4:51876418-51876440 GTGGGGTGGGGGTAGGAGGGAGG + Intronic
973607139 4:52599249-52599271 CAGGGGGAGGGGTAGGGGTGGGG + Intronic
974454207 4:62105262-62105284 CAGGGTGAAGGGTGGGAGGAGGG - Intergenic
974759085 4:66251583-66251605 GGGGGTGGGGGGTAGGGGGGAGG + Intergenic
975427310 4:74245619-74245641 GTGGGGTAGGGGGAGGAGGGAGG - Intronic
975648506 4:76568787-76568809 CTCCCTGAGGGGTAGGAGGTGGG - Intronic
975779155 4:77820293-77820315 TGGGGTGAGGGGAAGGAGGCGGG + Intergenic
975821086 4:78271456-78271478 GTGGGTTGGGGGTAGGGGGGAGG - Intronic
976096411 4:81513069-81513091 AAGGGGGAGGGGGAGGAGGGGGG - Intronic
976393579 4:84531767-84531789 CTAGGTGAGTGGCAGGAGAGGGG + Intergenic
976515022 4:85955219-85955241 CGGGGTGGGGGGTAGGCGGGGGG - Intronic
976775115 4:88698746-88698768 GCGGGGGAGGGGCAGGAGGGAGG - Intronic
976970241 4:91094516-91094538 CTTGGGGACAGGTAGGAGGGGGG + Intronic
977170316 4:93753485-93753507 ATGGGGTAGGGGGAGGAGGGAGG - Intronic
977621521 4:99142830-99142852 CAGGGTTGGGGGTAGGAGAGAGG + Intronic
977666400 4:99650681-99650703 CTGGGTGAGGTGGAAGAGCGGGG - Exonic
977850143 4:101817527-101817549 GAGGGTGAGGGGTGGGAGGAGGG + Intronic
977958831 4:103061508-103061530 GTGGGGTGGGGGTAGGAGGGAGG + Intronic
978285559 4:107073376-107073398 AGGGGTGAGGGGGAGGGGGGAGG - Intronic
978413798 4:108454615-108454637 TTGGATGAGGGGCAGGAGGGCGG + Intergenic
978702328 4:111662625-111662647 GAGGGGGAGGGGGAGGAGGGAGG + Intergenic
978715865 4:111841568-111841590 CTGGATGAGGGGTAAAAGTGAGG + Intergenic
978807790 4:112818600-112818622 CAGGGAGAGGGGCAAGAGGGTGG + Intronic
979057330 4:116013929-116013951 TTGGGTGGGGGGGAGGGGGGAGG - Intergenic
979497906 4:121405451-121405473 TTGGGAGAAGGGTGGGAGGGGGG - Intergenic
979528788 4:121745815-121745837 GTGGGTCAGGGGAAGGGGGGAGG - Intergenic
979584379 4:122398139-122398161 CCGGGGGAAGGGTAGCAGGGGGG - Intronic
979879118 4:125931727-125931749 GAGGGTGAAGGGTAGGAGGAAGG - Intergenic
980507491 4:133741436-133741458 CAGGGTGAAGGTTAGGAGGAGGG - Intergenic
980929965 4:139176401-139176423 CTGGGTGGCGGGCAGGCGGGGGG - Intronic
981845611 4:149164693-149164715 CTGGCTGGGGTGTAGAAGGGTGG - Intergenic
982173637 4:152684721-152684743 TTGGGTTAGGGGGAGGAGGAAGG - Intergenic
982277791 4:153654585-153654607 GTGGGTAAGGGGGAGGCGGGGGG - Intergenic
982770191 4:159390257-159390279 CGGGGTGGGGGGTGGGGGGGCGG - Intergenic
982961948 4:161850503-161850525 CTGGGTGAGGGCAAAGAGGGTGG + Intronic
983027422 4:162755549-162755571 CTGGGTGAGGGAAGGCAGGGTGG - Intergenic
983156725 4:164356964-164356986 GTGGGTGGAGGGTAGGAGGCAGG + Intronic
983580649 4:169306400-169306422 TTGGAAGAGGGGAAGGAGGGAGG + Intergenic
983828211 4:172291722-172291744 CTGGGGCAGGGGGAGGGGGGTGG - Intronic
983846877 4:172531684-172531706 CTGGCTGAGGGGAGAGAGGGTGG + Intronic
984359452 4:178710053-178710075 GTGGGTTGGGGGGAGGAGGGAGG + Intergenic
984854777 4:184185468-184185490 CTCTGTGTGGGGTAGCAGGGAGG + Intronic
985149115 4:186928357-186928379 CTGAGTGAAGGGTTGGAGGTAGG + Intergenic
985485513 5:146272-146294 CAGGGTGTGGGAAAGGAGGGAGG - Intronic
985792195 5:1935331-1935353 CTGGGTCTGGTGTAGGAGGATGG - Intergenic
986263680 5:6173812-6173834 GTGGGGTAGGGGGAGGAGGGAGG - Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
986762560 5:10893513-10893535 CTGGGTGTGGGATAGGACGAGGG + Intergenic
986896653 5:12379157-12379179 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
987130807 5:14858256-14858278 CTGGGGGAAGGGTGGGAGGCGGG - Intronic
987132958 5:14875711-14875733 CTTGGTGAGGGGTCGGTGGGGGG - Intergenic
987260946 5:16202424-16202446 GAGGGTGAGGGGTTGGAGGAGGG + Intergenic
987333627 5:16878826-16878848 CAGGGAGAAGGGTGGGAGGGTGG + Intronic
988010570 5:25476514-25476536 GTGGGGTAGGGGGAGGAGGGAGG + Intergenic
988338037 5:29931524-29931546 CTGGGGGAGGGGGCGGAGAGTGG + Intergenic
988889163 5:35596029-35596051 GTGGGGTGGGGGTAGGAGGGAGG - Intergenic
989143454 5:38224764-38224786 TGGGGTGGGGGGGAGGAGGGAGG + Intergenic
989213759 5:38882640-38882662 CGGGGTGGGGGGAAGGGGGGTGG + Intronic
990181931 5:53170789-53170811 CTAGGTGAGGGGGAGGAGAAGGG - Intergenic
990449100 5:55918794-55918816 CTGGGTGGGTGGTGGGGGGGTGG - Intronic
990645224 5:57836344-57836366 TTGGGTGGGGGGTTGGGGGGCGG + Intergenic
990798607 5:59573429-59573451 GTGGGTGAGGGGTATTGGGGAGG - Intronic
990957656 5:61359605-61359627 CTGGGTGAGGGAAAGGATGATGG + Intronic
991601368 5:68354564-68354586 CTGGATGAGAGGAAGGAGGTAGG - Intergenic
992135113 5:73736836-73736858 GTTGGTGAGGGGAGGGAGGGAGG + Intronic
992417362 5:76564828-76564850 CTGGGAGAGGAGCAGGAAGGAGG + Intronic
992605047 5:78447808-78447830 GAGGGAGAGGGGGAGGAGGGAGG - Intronic
992698451 5:79314634-79314656 GTGGGGGAGGGGGAGGAGGTGGG - Exonic
994229771 5:97299784-97299806 GTGGGGTAGGGGGAGGAGGGAGG - Intergenic
994777670 5:104055506-104055528 CAGGGAGAAGGGTGGGAGGGAGG - Intergenic
995041912 5:107598176-107598198 CTGAGAGAGGGGTAGTGGGGAGG - Intronic
995188764 5:109298600-109298622 ATGGGTCAGGGGGTGGAGGGAGG - Intergenic
996045224 5:118864380-118864402 TGGGGTGGGGGGAAGGAGGGAGG + Intronic
996681422 5:126231470-126231492 AGGGGTGGGGGGTAGGAGGAGGG + Intergenic
997309291 5:132866502-132866524 CTGGGTGACCCGTAGGTGGGAGG - Intronic
997690323 5:135823694-135823716 CTGAATGAGGGGTATGAGGGTGG + Intergenic
997790910 5:136761196-136761218 GAGGGTGGAGGGTAGGAGGGGGG + Intergenic
997848658 5:137311300-137311322 CTTGTTGAGGGGTGGGAAGGAGG + Intronic
998143467 5:139712323-139712345 CTGGCTCAGGGATAGCAGGGAGG + Intergenic
998148615 5:139744680-139744702 CTGGGTCTGGGGCAGGAGCGGGG - Intergenic
998157653 5:139795760-139795782 CTGGAGGAGGAGGAGGAGGGAGG - Intergenic
998161092 5:139813470-139813492 CTGGATGAGGGGTGTGAGGGGGG - Exonic
998170714 5:139870714-139870736 CTAGGAGAGGAGTGGGAGGGGGG - Intronic
998298256 5:140992748-140992770 CTGTGTTGGGGATAGGAGGGTGG + Intronic
998443004 5:142177689-142177711 CTGGGTGAGGTTGGGGAGGGAGG + Intergenic
998899145 5:146833746-146833768 CTGGGGGTGGGGGAGGAGGATGG - Intronic
999079783 5:148832295-148832317 GTGGGTGGGAGGTTGGAGGGGGG - Intergenic
999140501 5:149358225-149358247 CTAGGTGGGGTATAGGAGGGCGG + Intronic
999236915 5:150104014-150104036 CTGACTTAGGGGTGGGAGGGGGG + Intronic
999437988 5:151579074-151579096 CAGGGCTTGGGGTAGGAGGGAGG + Intergenic
999475358 5:151893179-151893201 ATGGGTGTGGGGTGGGAGAGGGG - Intronic
999567383 5:152879829-152879851 GAGGGTGGAGGGTAGGAGGGGGG + Intergenic
999652091 5:153777677-153777699 GTGTGTGAGGGGGATGAGGGTGG - Intronic
999728514 5:154457308-154457330 GAGGGTATGGGGTAGGAGGGTGG + Exonic
999781751 5:154856063-154856085 CTGGGTGAGGGGTGGTAGTGAGG + Intronic
1000317951 5:160111074-160111096 CTGTGGGAGGGCAAGGAGGGAGG + Intronic
1000510903 5:162181490-162181512 GTGGGGTAGGGGTAGGGGGGAGG + Intergenic
1001134370 5:169090226-169090248 GAGGGTGAAGGGGAGGAGGGAGG + Intronic
1001287478 5:170434611-170434633 CTGGGGGACGGGTCGGTGGGTGG + Intronic
1001317319 5:170653042-170653064 CTGGGTCGGGGGAAGGAGCGAGG + Intronic
1001562473 5:172678481-172678503 CTGGCTGAGGAGCAGGAGGTGGG - Intronic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1001681253 5:173558542-173558564 CTGAGTCAGGGGTGGGAGGAAGG + Intergenic
1001686386 5:173597680-173597702 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001686461 5:173597880-173597902 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001686493 5:173597964-173597986 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1002169185 5:177366013-177366035 CTGAGTGGGAGGGAGGAGGGAGG + Intronic
1002211974 5:177604617-177604639 CTGGGGCAGGGGCAGGAGGGCGG + Intronic
1002280859 5:178129452-178129474 AAGGGTGAGGGTTAGGAAGGAGG - Intergenic
1002291861 5:178205420-178205442 CCGGGAGAGGCGGAGGAGGGAGG - Intronic
1002381371 5:178832072-178832094 CTGGGGGAGGGGGGGGAGGTGGG - Intergenic
1002408401 5:179054170-179054192 CTTGGGGACAGGTAGGAGGGGGG + Intergenic
1002424955 5:179169484-179169506 CTGGGTGAGGAGGTGGATGGAGG + Intronic
1002461468 5:179375938-179375960 CTGGGGGAGGGGGAAGAGGGAGG + Intergenic
1002461526 5:179376080-179376102 CTGGGGGAGGGGAAAGGGGGAGG + Intergenic
1002699535 5:181112868-181112890 CTGGGTGGCGGGTCGGGGGGTGG + Intergenic
1002723727 5:181281641-181281663 CGGCCTGAGCGGTAGGAGGGGGG + Intergenic
1002723789 5:181281837-181281859 CGGCCTGAGCGGTAGGAGGGGGG + Intergenic
1002888778 6:1317004-1317026 CGGGGGGAGGGGTAGGCTGGAGG - Intergenic
1002888866 6:1317170-1317192 TGGGGGGAGGGGTAGGCGGGAGG - Intergenic
1002888898 6:1317230-1317252 CGGGGGGAGGGGTAGGCTGGGGG - Intergenic
1002888922 6:1317273-1317295 CGGGGGGAGGGGTAGGCTGGAGG - Intergenic
1003011143 6:2428578-2428600 CTGGAGGTGGGGTAGGAGTGGGG + Intergenic
1003287657 6:4748574-4748596 CGGGGGTAGGGGTAGGAGCGTGG + Intronic
1003320625 6:5047895-5047917 CTGGGTGGGGGTTATGAGGAAGG + Intergenic
1003507481 6:6751700-6751722 CTGGGGGAGGGGGAGGGGGAGGG - Intergenic
1003575793 6:7293341-7293363 CTCGGGGAAGGGTAGGAGGGGGG - Intronic
1003658294 6:8035188-8035210 CAGGGGGAAGGATAGGAGGGAGG + Intronic
1004044257 6:12011279-12011301 ATGGGGGAGGGGGAGGCGGGGGG - Intronic
1004160807 6:13211265-13211287 CAGGGGGAGGGGTGGGAGGCTGG - Intronic
1005034381 6:21542337-21542359 GTGGGGCAGGGGTGGGAGGGAGG + Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005740327 6:28785393-28785415 CTGGGGGAGGGGGTGGAGGGCGG - Intergenic
1005752147 6:28893597-28893619 TTGGGTGAGGCTGAGGAGGGAGG - Intergenic
1005777110 6:29146238-29146260 CTGGGGCAGGGGAAGGAAGGGGG - Intergenic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1006364880 6:33609560-33609582 CTGGATGAGGGTCAGAAGGGAGG + Intergenic
1006384195 6:33720122-33720144 ATGGGTGAGGGGAGGGCGGGTGG - Intergenic
1006407600 6:33854386-33854408 CTGGGTCGGGGGAAGGAAGGAGG - Intergenic
1006949524 6:37809852-37809874 CTGGGGTGGGGGGAGGAGGGAGG + Intergenic
1007224565 6:40303553-40303575 CTGGGAGAAGGGGAAGAGGGAGG + Intergenic
1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG + Intergenic
1007378398 6:41471317-41471339 GTGGGGGAGGGGCAGGAGGCAGG - Intergenic
1007486090 6:42181724-42181746 CTGGGTGTGGGGGAGGTGTGGGG + Intergenic
1007488036 6:42195842-42195864 TTGTGTGAAGGGTTGGAGGGAGG - Intergenic
1007593860 6:43039499-43039521 GTGGGTGACGGGGAGGATGGAGG - Intronic
1007864710 6:44955721-44955743 CAGGGGAAAGGGTAGGAGGGGGG + Intronic
1007902175 6:45422527-45422549 CCGGGGGAGGGGGAGGAGGGTGG - Intronic
1008137191 6:47790500-47790522 ATGGGGGAGGTGAAGGAGGGAGG - Intronic
1008465766 6:51829154-51829176 CTGGGTGGGGGAAAGGAGGTGGG - Intronic
1008660728 6:53664913-53664935 CGGGGTGGGGTGTAGGGGGGTGG + Intronic
1008794926 6:55291501-55291523 ATGGGGTGGGGGTAGGAGGGAGG + Intergenic
1009314689 6:62203547-62203569 GTGGGTGGGGGAAAGGAGGGAGG + Intronic
1009460630 6:63908692-63908714 CTGTGGGAGGCGTAGGAGGGCGG - Intronic
1009511016 6:64549878-64549900 GTGGGGTAGGGGGAGGAGGGAGG - Intronic
1009798964 6:68508670-68508692 CAGGGGGAAGGGTAGGAAGGGGG - Intergenic
1010476372 6:76293680-76293702 GTGGGGTAGGGGTAGGGGGGAGG - Intergenic
1010604215 6:77868068-77868090 TGGGGTGAGGGGTGGGAGGAGGG + Intronic
1011410236 6:87059745-87059767 GTGGGGGAGGGGGAGGCGGGGGG + Intergenic
1011616637 6:89203335-89203357 CTTGGTGAGGGGTCGGGGAGGGG + Intronic
1011625740 6:89282188-89282210 GTGGGTGTGGTGGAGGAGGGGGG - Intronic
1012546364 6:100424062-100424084 CTGGGCGGGGGGTGGGAGGGGGG - Intronic
1012943154 6:105438517-105438539 AAGGGTGAGAGGGAGGAGGGAGG - Intergenic
1013072376 6:106740919-106740941 GCTGGTGAGGGGTAGGAGAGGGG - Intergenic
1013231974 6:108167914-108167936 CTTGGAGGGGGGTAGGAGGGCGG - Intronic
1013364278 6:109424083-109424105 CAAGGTAAGGAGTAGGAGGGTGG + Intronic
1013465569 6:110414537-110414559 GTGGGTGAGGGGTGGGACAGAGG - Intronic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1014358232 6:120438557-120438579 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1014386039 6:120803616-120803638 AAGGGTGAGGGGGGGGAGGGCGG + Intergenic
1014453506 6:121610402-121610424 CGGGGTCAGGGGTAGGGGTGTGG - Intergenic
1014556417 6:122846211-122846233 TTGGGGTAGGGGTAGGAGGTGGG - Intergenic
1014664291 6:124217219-124217241 CTGGGAGAGGGGGAAGAGTGAGG + Intronic
1015262980 6:131259881-131259903 CTGGGTGATGGGTTGATGGGTGG - Intronic
1015463097 6:133516235-133516257 GAGGGTGAAGGGTAGGAGGAGGG + Intronic
1015592368 6:134834073-134834095 GTGGGTTAGGGGAGGGAGGGAGG + Intergenic
1015812734 6:137177474-137177496 GTGGATGAAGGGTGGGAGGGAGG - Intergenic
1015835953 6:137420159-137420181 CTGGCTGAGGGATATGAGGTTGG - Intergenic
1015902381 6:138081388-138081410 CGGGGTCAGGGGAAGGGGGGAGG + Intergenic
1015976571 6:138796606-138796628 CTGGGTTGGGGGAATGAGGGAGG + Intronic
1016045461 6:139476350-139476372 CTGGGGTGGGGGCAGGAGGGTGG + Intergenic
1016923417 6:149317759-149317781 CTGGCTGAGGGGGAGGGGAGGGG - Intronic
1017027424 6:150193607-150193629 CTGGGAGAAGGGGAGGAGGGAGG + Intronic
1017078084 6:150638422-150638444 CTGGCTGAGTGGTAGGGGGAGGG - Intronic
1017692897 6:156984576-156984598 CTGGGTGTGGGGTAGTGGGTGGG + Intronic
1018847463 6:167565576-167565598 CAGGATGAGGGGCAGGCGGGTGG - Intergenic
1018935929 6:168274077-168274099 CTGGGTGCGGGGGGGGGGGGGGG + Intergenic
1019057609 6:169234711-169234733 GTGAGTGAGGGGTAGAAGCGGGG - Intronic
1019117594 6:169777768-169777790 GTGGGTGGGGGGAAGGGGGGCGG - Intronic
1019346521 7:533427-533449 GTGGGTGGAGGGAAGGAGGGAGG + Intergenic
1019413201 7:915576-915598 CTCGGGCAGGGGTTGGAGGGAGG - Intronic
1019597052 7:1863085-1863107 CTGGTTGGGGGGTTGGATGGAGG - Intronic
1019703615 7:2487280-2487302 ATGGGTGGGGGGAGGGAGGGAGG + Intergenic
1019722874 7:2583868-2583890 CTGGGTGGCGGGGCGGAGGGCGG + Intronic
1019722916 7:2583978-2584000 CTGGGTGGCGGGGCGGAGGGCGG + Intronic
1020359503 7:7313212-7313234 GTGGGTTGGGGGGAGGAGGGAGG - Intergenic
1020607199 7:10354413-10354435 ATGGGGGAGTGGTAGGAAGGTGG - Intergenic
1020760403 7:12261780-12261802 TTGGGTGGGGGGGGGGAGGGGGG + Intergenic
1021166200 7:17345071-17345093 CTTGGGGAGGGCGAGGAGGGTGG + Exonic
1021464767 7:20929785-20929807 CTGGGGGTGGGGGAGGAGGAGGG - Intergenic
1022091985 7:27113873-27113895 GTGGGGGAGGGGTGGGTGGGTGG - Intronic
1022093020 7:27120069-27120091 ATTGGTGAGGGGTATGAGGCAGG - Intronic
1022723737 7:32962872-32962894 AGGAGTGAGGGGTGGGAGGGTGG + Intronic
1022808917 7:33849840-33849862 CTGGGTGAGGGCTGGAAGAGGGG + Intergenic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1023109519 7:36795156-36795178 CTGGGTATGGGACAGGAGGGTGG + Intergenic
1023158500 7:37275275-37275297 CTGGGTGCTGGGTGGGAGGAGGG + Intronic
1023896547 7:44438570-44438592 CTGGGTGTGGGGTGGGGTGGGGG - Intronic
1024024036 7:45396316-45396338 CTGGGTGAGGAGCAAGAGAGAGG - Intergenic
1024178013 7:46860992-46861014 GAGGGTGAGGTGGAGGAGGGAGG - Intergenic
1024442934 7:49442769-49442791 CTGGGTGGGGGGTGGGAGAGGGG - Intergenic
1024665080 7:51538089-51538111 CAGGGGGAAGGGTGGGAGGGAGG - Intergenic
1024692200 7:51815390-51815412 GTGGGGTAGGGGGAGGAGGGAGG - Intergenic
1025024605 7:55506105-55506127 CTGGGTGAGAGATGGGAGGTGGG - Intronic
1026523354 7:71134457-71134479 CTGGGGGAGGGATGGGATGGAGG + Intronic
1026617789 7:71921835-71921857 CTGGGAAGGGGGTAGGATGGCGG - Intronic
1026633997 7:72065373-72065395 CTGGGGCAGGGGCAGGGGGGCGG - Intronic
1026656798 7:72263657-72263679 CTGTGGGAGGCGGAGGAGGGAGG - Intronic
1026806152 7:73430502-73430524 CAGGGGGAGGGGGAGGGGGGAGG - Intergenic
1026912022 7:74096565-74096587 CCAGGTGAGGTGGAGGAGGGCGG + Intronic
1027224247 7:76234068-76234090 CAGGGAGTGGGGTGGGAGGGAGG - Intronic
1027245330 7:76363202-76363224 CTGGGTGATGGGTAAGGGGCTGG + Intergenic
1027247861 7:76379576-76379598 TTGGGCGAGGGGTTGGGGGGGGG + Intergenic
1027534410 7:79379102-79379124 TGGGGTGGGGGGGAGGAGGGAGG - Intronic
1028837988 7:95396142-95396164 CTGGGTGAGATGGAGGAGTGAGG + Intronic
1029127285 7:98303370-98303392 GTGGGTGAAGGGGAGGAGGCTGG - Intronic
1029503928 7:100950600-100950622 CGAGGTGAGGGGTAGCAGGTCGG + Intronic
1029606600 7:101602851-101602873 CAGGGTGAGGGGTGGGATGGGGG - Intergenic
1029611164 7:101627345-101627367 CAGGGGCAGGGGTGGGAGGGAGG + Intronic
1029755784 7:102572746-102572768 CGGGGTGCGGGGTGGGGGGGTGG - Intronic
1029900777 7:104036788-104036810 CTGAATGAAGGTTAGGAGGGAGG + Intergenic
1030103482 7:105967095-105967117 TGGGGTGAGGGGAAGGAGGAGGG - Intronic
1030109405 7:106013671-106013693 CTGGGTGAGGGGAAGGGTAGCGG - Intronic
1030266655 7:107628868-107628890 CTGGGGGAGGAGTTGGAGGCTGG - Intronic
1031003328 7:116443164-116443186 CTGAGAGAGGTGAAGGAGGGAGG + Intronic
1031327545 7:120420604-120420626 CGGGGTGAGGAGTAGGGGGAAGG + Intronic
1031605614 7:123763828-123763850 TTGAGTGAGGGGTTGGAGGTGGG - Intergenic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1032054367 7:128672642-128672664 CTGGGGGAGGGGGGGGCGGGGGG + Intronic
1032086433 7:128886379-128886401 CTGGCTGAGGGGAGGGAGGTGGG + Intronic
1032285459 7:130535721-130535743 CTGGGGGAGGGGTTGGGGTGGGG + Intronic
1032391261 7:131556682-131556704 CTGGGGGAGGGGGAGGGGCGGGG - Intronic
1032501075 7:132400378-132400400 CTGGGTGACAGGTAGGAGACAGG - Intronic
1032517623 7:132518833-132518855 CTGGGGGAGGGAAAGGAAGGAGG - Intronic
1032655946 7:133929714-133929736 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1032869587 7:135969087-135969109 GTGGGGGGGGGGGAGGAGGGAGG + Intronic
1033014893 7:137661753-137661775 CTTGGAGATGGGTAGGAAGGAGG + Intronic
1033275215 7:139966858-139966880 GTGGGGGAGGGGTAGAAGGAGGG - Intronic
1033537292 7:142323860-142323882 CCTGGGGAGGGGTAGGAGGGTGG + Intergenic
1033885597 7:145941159-145941181 CAGGGTGGAGGGTAGGAGGAAGG - Intergenic
1033961083 7:146913900-146913922 CAGGGGAAAGGGTAGGAGGGTGG - Intronic
1033977540 7:147120774-147120796 GTGGGTTGGGGGTAGGGGGGAGG - Intronic
1034219109 7:149430946-149430968 CTGGCTGAGGAGTAGGGTGGCGG - Intergenic
1034221086 7:149446792-149446814 GTGGGTGAGGAGCAGGTGGGAGG - Intronic
1034276933 7:149828000-149828022 ATGGGTGAGTGGTAGCAGAGGGG - Intergenic
1034299005 7:149998890-149998912 CTGAGGGAGTGGTGGGAGGGAGG - Intergenic
1034574785 7:151987613-151987635 CTGGGGGTGGGGTGGGCGGGAGG + Intronic
1034780906 7:153881701-153881723 CTGGGTGATGGAAATGAGGGTGG - Intergenic
1034807011 7:154097883-154097905 CTGAGGGAGTGGTGGGAGGGAGG + Intronic
1034843058 7:154417553-154417575 CTGGGAGCGGGGTGGGAGGTGGG - Intronic
1034994839 7:155571041-155571063 CTGGGTGGGGGTGGGGAGGGAGG - Intergenic
1035021606 7:155804021-155804043 CTGGGGGTGGGGTTGGAGGAAGG - Intronic
1035264894 7:157685178-157685200 CGGGATGAGGGGTGGGAGGGCGG - Intronic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035520770 8:273802-273824 AGGGGTGAGGGGTGGGAGGTGGG + Intergenic
1035520815 8:273922-273944 CTGGGTGAGGGGTGAGAAGTGGG + Intergenic
1035676197 8:1457744-1457766 CTGGGGGAGGCGTGGGACGGGGG - Intergenic
1036627419 8:10483407-10483429 ATGGGGCAGGGATAGGAGGGAGG + Intergenic
1036663049 8:10720862-10720884 CGGGGAGGGGGGAAGGAGGGAGG - Intergenic
1036753386 8:11456925-11456947 CTGGATTAGGGGTATGAGCGGGG + Intronic
1036753422 8:11457017-11457039 CTGGGTTAGGGGTATGGGCGGGG + Intronic
1037088502 8:14882874-14882896 CTGGGTGAGGGGGAAGAAGGAGG - Intronic
1037128838 8:15383671-15383693 ATGCATGAGGGGGAGGAGGGAGG - Intergenic
1037579676 8:20236965-20236987 CTGGGTGTGGGGTTGGAGTAAGG + Intergenic
1037685948 8:21139486-21139508 CAAGGTGAAGGGCAGGAGGGAGG + Intergenic
1037703508 8:21296043-21296065 CTGGGTGAGATGAGGGAGGGAGG - Intergenic
1037739644 8:21597992-21598014 ATGGGAGAGAGGCAGGAGGGAGG + Intergenic
1037798867 8:22020205-22020227 CTGTGGGAGGCCTAGGAGGGAGG + Intergenic
1037805664 8:22056868-22056890 CAGGGTGGGGGCAAGGAGGGTGG + Intronic
1037829068 8:22177544-22177566 CTGGGAGAGAGGGAGGAGGCGGG - Intronic
1037902730 8:22697044-22697066 CTGGGTGTGGAGCAGGAGTGGGG + Intergenic
1037908208 8:22727864-22727886 CTGAGTGGAGGGGAGGAGGGAGG - Intronic
1037926908 8:22850814-22850836 CTCAGGGAGGGGTAGGAGGAAGG + Intronic
1037949078 8:23007143-23007165 CTGAGTGAGGGGGAGCTGGGGGG + Exonic
1038008773 8:23457515-23457537 GTGGGTGAGGGGAGGGCGGGCGG - Intronic
1038096932 8:24323585-24323607 TTGGGTGGGGGGTGGTAGGGAGG - Intronic
1038324321 8:26561058-26561080 CAGGGGGAGGGATGGGAGGGGGG + Intronic
1038526512 8:28278769-28278791 CTGGGTGAGGGGTAGACGGAGGG + Intergenic
1039479211 8:37859265-37859287 CTGGGAGAAGGGTGGGAGGGAGG + Exonic
1039712601 8:40071606-40071628 GTTGGTGAGGGATTGGAGGGTGG - Intergenic
1039896925 8:41723469-41723491 CTGGGTGAGGCTTGTGAGGGGGG + Intronic
1040567948 8:48583097-48583119 CGGGGTGGGGGGTAGGGGGAAGG + Intergenic
1040671958 8:49702750-49702772 GTGGGTGAAGGGTGGGAGGAGGG + Intergenic
1040777447 8:51063010-51063032 GTGGGGGAGGGGGAGGGGGGAGG + Intergenic
1040918033 8:52584057-52584079 CTTTGGGAGGGGGAGGAGGGAGG - Intergenic
1041242599 8:55861046-55861068 CTGGGGGTGGGGTGGGATGGGGG + Intergenic
1041340986 8:56845119-56845141 ATGGGAGAGGGGCAGGAGGCAGG + Intergenic
1041617737 8:59928007-59928029 TTGTGTGAGGGGTAGGTGAGTGG + Intergenic
1041972082 8:63755230-63755252 GAGGGTGAGGGGTGGGAGGAGGG - Intergenic
1042344127 8:67710404-67710426 CGGGGTGGGGGGTTGGGGGGGGG - Intronic
1042834040 8:73061743-73061765 GTGGGGTAGGGGGAGGAGGGAGG + Intergenic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1043087787 8:75856867-75856889 ATGGGGGAAGGGTAGGAGGGAGG + Intergenic
1043189177 8:77195405-77195427 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1044430495 8:92102197-92102219 CTGGGTGAGCGGGCGGACGGCGG - Intronic
1044573758 8:93747074-93747096 GTGGGGGAGGGGTTGGGGGGTGG + Intergenic
1044721775 8:95157612-95157634 CTGGTTGAGGGGTTGGGGGTGGG + Intergenic
1044728491 8:95212136-95212158 GTGGTTTAGGGGGAGGAGGGGGG + Intergenic
1045040452 8:98219042-98219064 CAGGATCAGGGGTAGGAGTGAGG + Intronic
1045227752 8:100266754-100266776 CTTGGGGAGGGTGAGGAGGGAGG - Intronic
1045720657 8:105106676-105106698 CTGGGTGATGGGTAGCATAGAGG + Intronic
1046015732 8:108602960-108602982 TTGTGTGGGGAGTAGGAGGGAGG + Intergenic
1046366573 8:113239650-113239672 ATGGGTAATGAGTAGGAGGGTGG + Intronic
1047441680 8:124884333-124884355 GTGGGTGGGGGGCAGGCGGGGGG + Intergenic
1047703212 8:127471393-127471415 GTGGGGGTGGGGTAGGAGGCTGG - Intergenic
1047730332 8:127722779-127722801 CAGGGCGAGGGGGAGGTGGGAGG - Intergenic
1047749423 8:127868646-127868668 CTGTGGGAGGTGTAGGAGGGTGG - Intergenic
1048281178 8:133106568-133106590 CTGGGTGAGGGGGAGCAGCGAGG - Intronic
1048632911 8:136263651-136263673 CTGGGTGAAGGGTACGAGACAGG + Intergenic
1048994220 8:139781728-139781750 CTGTGTGTGCGGTGGGAGGGAGG + Intronic
1049194412 8:141307811-141307833 CGGGGTGGGGGGAATGAGGGAGG + Intronic
1049223151 8:141436960-141436982 CTGGGTGGGGGGGTGGGGGGTGG + Intergenic
1049244946 8:141557429-141557451 CGGGGTGATGGCAAGGAGGGAGG - Intergenic
1049391304 8:142373017-142373039 CAGGCTGAGGGGTAGGATGGAGG - Intronic
1049403689 8:142442375-142442397 CTGGGAGAGGAGGAGGAGGCAGG - Intergenic
1049582275 8:143418196-143418218 GTGGGTAGGGGGTTGGAGGGTGG - Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049658732 8:143810297-143810319 CTGGGTGAAGGGTGCCAGGGTGG - Intronic
1049706948 8:144047418-144047440 CTGGGTGAGGGGCGGGGAGGGGG + Intergenic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1049762355 8:144337105-144337127 CTGGGGGAGGGGGAGGGAGGTGG + Intergenic
1049807107 8:144546070-144546092 CTGGCTGAGGGTGAGGCGGGAGG + Intronic
1049880198 8:145056819-145056841 CAGGGTGAGGAGAAGCAGGGGGG - Intergenic
1049986951 9:960662-960684 CTGGCTGAGGGGTACGAGCTGGG + Intronic
1050037694 9:1454575-1454597 ATCAGTGAGGGGTAGGAGAGGGG + Intergenic
1050135089 9:2454463-2454485 TGGGGTGAAGGGTGGGAGGGGGG - Intergenic
1051070887 9:13165548-13165570 CTGGGGGAGGTGTAGATGGGAGG - Intronic
1051254839 9:15202709-15202731 GTGGGGGAGGGGTGGCAGGGTGG - Intronic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1052023296 9:23548668-23548690 GTGGGGTAGGGGGAGGAGGGAGG + Intergenic
1052728500 9:32258852-32258874 CTGGGTATGGGGTAGGTGGGTGG - Intergenic
1052743150 9:32413682-32413704 CTGGGTAAGGGGTGGTAGAGTGG + Intronic
1052947457 9:34179408-34179430 CTGGGAGAAGGGTCGGAGTGAGG + Intronic
1053006345 9:34607430-34607452 CTGGGGGAGGGGTAGGTGATGGG - Intergenic
1053100533 9:35368202-35368224 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1053423335 9:37995132-37995154 CTGGGGGAAGGGCAGGCGGGCGG + Intronic
1053440581 9:38112927-38112949 GTGGGTGAGGGGGAAGAGGTGGG + Intergenic
1053729442 9:41037971-41037993 CTGTATGAGGGGTAGGAAGAAGG - Intergenic
1054460304 9:65458844-65458866 GTGGGAGAGGGGTGGGAGGCGGG - Intergenic
1054699067 9:68394095-68394117 CTGTATGAGGGGTAGGAAGAAGG + Intronic
1054825806 9:69572412-69572434 CTGGGGAAGGAGTAGGAGTGAGG - Intronic
1054938523 9:70714638-70714660 TGGGGTGGGGGGGAGGAGGGAGG + Intronic
1054940214 9:70732631-70732653 TGGGGTGGGGGGGAGGAGGGAGG + Intronic
1054947346 9:70810125-70810147 CAGGGTGATGGAAAGGAGGGTGG - Intronic
1054947364 9:70810192-70810214 CAGGGTGATGGAGAGGAGGGTGG - Intronic
1054947398 9:70810326-70810348 CAGGGTGATGGAGAGGAGGGTGG - Intronic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1055295104 9:74826049-74826071 ATGGTTGTGGGGTAGGAGGAGGG - Intronic
1055505068 9:76939774-76939796 CATGGGGTGGGGTAGGAGGGAGG - Intergenic
1055796169 9:79977077-79977099 CAGGGGTAGGTGTAGGAGGGTGG - Intergenic
1055872650 9:80902085-80902107 GTGGGTCAGGGGAAGGAGGGAGG + Intergenic
1055939539 9:81636578-81636600 CAGGGAGAGGGGTGAGAGGGTGG - Intronic
1056027148 9:82510764-82510786 CAGGGGGAAGGGTGGGAGGGAGG + Intergenic
1056133676 9:83609486-83609508 CTGGGGAAAGGGTGGGAGGGGGG + Intergenic
1056425745 9:86474877-86474899 GTGGGGTAGGGGTAGGGGGGAGG - Intergenic
1056774007 9:89498265-89498287 TTGGGGGAGGGAAAGGAGGGAGG - Intergenic
1057191371 9:93089754-93089776 CTGGGGGCAGGGAAGGAGGGAGG - Intergenic
1057978175 9:99629060-99629082 ATGGGTGGGGGGGAGGGGGGAGG + Intergenic
1058093555 9:100833033-100833055 GTGGGTGGGGGGAAGGAGGAGGG + Intergenic
1058098371 9:100889291-100889313 CTGGGTGGGGGGATGGAGGGAGG - Intergenic
1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG + Intergenic
1059251747 9:112892210-112892232 CTAGGTGAGGGGGAGGAAGAAGG - Intergenic
1059392409 9:114007518-114007540 CTGGGTAAGAGGGAGGAGGGAGG - Intronic
1059473557 9:114525601-114525623 CTGGTTAATGGGTAGGATGGAGG - Intergenic
1059663151 9:116421343-116421365 CTGGGTGCAGAGTAGGAGAGTGG - Intergenic
1059754692 9:117281751-117281773 CTGGGAGAAGGGAAGGAGAGGGG - Intronic
1060150861 9:121287239-121287261 CAGGGGGAGGAGTGGGAGGGAGG + Intronic
1060216986 9:121744260-121744282 CTGGGTGGGGTGGAGGCGGGTGG + Intronic
1060368377 9:123043634-123043656 GGGGGTGAGGGGAAGGAGGGTGG + Intronic
1060664962 9:125427379-125427401 GTGGGAGAGGGGTAGCAAGGGGG + Intergenic
1060813502 9:126623148-126623170 CTGGGTGAGGAACAGAAGGGTGG - Intronic
1060825953 9:126688314-126688336 CTGGGGAAGGGGCAGCAGGGCGG - Intronic
1060863506 9:126975874-126975896 CTGGCTGAGAGGTGGGAGAGAGG - Intronic
1060944024 9:127559458-127559480 GTGGGTGCGGGCTAGGAGGCAGG - Intronic
1061168157 9:128936516-128936538 GGGGGTGAGGGCCAGGAGGGTGG + Intronic
1061208114 9:129176059-129176081 CTGGGTAAGGGGTGGGGGGCGGG - Exonic
1061371791 9:130201541-130201563 CTGGGCCTGGGGGAGGAGGGCGG + Intronic
1061500154 9:130997379-130997401 CAGGGAGAGGGGTTGGAGGTTGG + Intergenic
1061506255 9:131033498-131033520 CTGGGTGGAGGGCAGGCGGGTGG + Intronic
1061923019 9:133792680-133792702 CTGGGTGGGGGGTGGGGGGGGGG - Intronic
1061932017 9:133838203-133838225 TTGGGTGAATGGTGGGAGGGTGG - Intronic
1062146391 9:134992110-134992132 CTGGGGAAGGGCTGGGAGGGAGG + Intergenic
1062248272 9:135581222-135581244 CTGAGTGAGGAGTAGGAGTGTGG + Intergenic
1062362319 9:136193777-136193799 CTGGGGGAGGGGCCGGAGGCCGG + Intergenic
1062379606 9:136280854-136280876 CAGGGTTAGGGGTTGGATGGGGG + Intergenic
1062388759 9:136325880-136325902 CTGGGTTAGTGGTGGGAGGCTGG - Intergenic
1062520955 9:136957621-136957643 TTGGATGATGGGTAGGTGGGTGG + Intronic
1062529633 9:136994232-136994254 CTGGGTGCGGCCTGGGAGGGTGG - Intergenic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1062712436 9:137983894-137983916 TGGGGTGGGGGGTGGGAGGGAGG + Intronic
1185463147 X:341515-341537 CAGGAGGAGGGGCAGGAGGGGGG - Intronic
1185521777 X:745657-745679 CTGGATGAGGATGAGGAGGGTGG - Intergenic
1185887280 X:3794047-3794069 CAGGGGGAAGGGTGGGAGGGGGG - Intergenic
1186293220 X:8121841-8121863 ATGGGGGAGGGGGAGGGGGGAGG - Intergenic
1186341966 X:8655059-8655081 CTGGGTGAGGAGGAGGAGAATGG + Intronic
1186848149 X:13552224-13552246 CAGGGTGAGGGGTAGGGGTGGGG + Intergenic
1186979118 X:14939936-14939958 CAGTGGGAGGGGGAGGAGGGAGG - Intergenic
1187051952 X:15703826-15703848 CTTGGTGGGGGGGGGGAGGGGGG + Intronic
1187141285 X:16596333-16596355 GTGGGTTAGGGGGAGGGGGGAGG - Intronic
1187483136 X:19676350-19676372 CTGGGTGGGGGCTGGGTGGGAGG + Intronic
1187900823 X:24025511-24025533 CTGGGAGAGAGGGCGGAGGGTGG + Intronic
1188061088 X:25603139-25603161 CGGGGTGAGGCGGGGGAGGGGGG - Intergenic
1188277299 X:28216029-28216051 CGGGGGGGGGGGAAGGAGGGAGG - Intergenic
1188881088 X:35492898-35492920 GTGGGTGGGGGGTGGGAGGTGGG - Intergenic
1189207831 X:39257025-39257047 CTGGGGGAGGGGTGGGGGGGAGG - Intergenic
1189643998 X:43106568-43106590 CAGGGTGTAGGGTAGGAGGGTGG - Intergenic
1189715898 X:43865905-43865927 CTAGGTCAGGGGTGGGAGGGAGG + Intronic
1189939816 X:46109845-46109867 TGGGGTGGGGGGAAGGAGGGGGG + Intergenic
1190030085 X:46963674-46963696 CTGGGGCAGTGGTAGGAGGTAGG + Intronic
1191036252 X:56028947-56028969 CTTGGGGACAGGTAGGAGGGGGG + Intergenic
1191085491 X:56563552-56563574 CTGGGGGAGGGGAAGGGGCGGGG + Intergenic
1192369566 X:70502049-70502071 AGGGGTGAGGGGGTGGAGGGGGG + Intronic
1192378215 X:70586818-70586840 CTGGGTGACAGGTAAGAGGTTGG + Intronic
1193580790 X:83260244-83260266 ATTGGTGAGGGGAAGGAGAGTGG - Intergenic
1193669227 X:84363864-84363886 GTGGCTGAGGTGAAGGAGGGAGG + Intronic
1194995956 X:100591657-100591679 CTTGGTAGGGGGTAGGAGTGGGG - Intronic
1195108461 X:101623032-101623054 GTGGGGGAGGGAAAGGAGGGGGG + Exonic
1195124155 X:101788405-101788427 CTGGGGGAAGGGTAGTTGGGAGG - Intergenic
1195401504 X:104465984-104466006 TTGGGGGAAGGGTGGGAGGGGGG - Intergenic
1195440171 X:104889941-104889963 TTGGGTTGGGGGTAGGGGGGAGG - Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196021420 X:110995137-110995159 AGGGGAGAGGGGTAGGAGGAGGG - Intronic
1196402433 X:115330491-115330513 CGGGGGGAGGGGGAGGTGGGCGG + Intergenic
1196417754 X:115490588-115490610 CAGGGGGAGGGGTTGGAGTGGGG - Intergenic
1196424351 X:115555182-115555204 CTGGGGTTGGGGGAGGAGGGAGG - Intergenic
1196668194 X:118338400-118338422 TGGGGTGAGGGGGAGGGGGGAGG - Intergenic
1196947394 X:120841335-120841357 GTGGGAGGGGGGTGGGAGGGAGG + Intergenic
1197153988 X:123250122-123250144 CTGGGGCAGGGGTAGCAGGGAGG + Intronic
1197427358 X:126313743-126313765 CGATGTGAGGGGTGGGAGGGAGG + Intergenic
1197543521 X:127794741-127794763 CTGGGTTTGGGGGAGGGGGGAGG + Intergenic
1197749156 X:129953126-129953148 CTGGCTGCCGGGGAGGAGGGAGG - Intergenic
1198437405 X:136630560-136630582 CTGAGTGAGGGGCAGAAGGTGGG + Intergenic
1198772375 X:140144711-140144733 CTGGGTGGGGGGTGGGCGGGGGG - Intergenic
1198794150 X:140377946-140377968 GTGGGTGGAGGGTAGGAGGAGGG + Intergenic
1198934985 X:141895717-141895739 CTGGGGGAGGGGTGGAGGGGAGG + Intronic
1198936208 X:141904290-141904312 CTGGGTGAGGGGTGTAGGGGAGG + Intronic
1198960145 X:142174783-142174805 CTGGGTGAGGGGTGGAGGGGAGG - Intergenic
1199293264 X:146129149-146129171 CAGGGGGAAGGGTGGGAGGGGGG - Intergenic
1199381914 X:147181372-147181394 CTGGGTAAGGTGGAAGAGGGAGG + Intergenic
1199451343 X:147981712-147981734 CTGGGGGAGGGGGAGGGGGAGGG + Intronic
1199683393 X:150242979-150243001 CTGGGAGACAGGCAGGAGGGAGG + Intergenic
1200149394 X:153943865-153943887 CTGGGAGATGGGCAGGAAGGGGG + Intronic
1200780084 Y:7206863-7206885 CTTTGGGAGGGCTAGGAGGGAGG + Intergenic
1201601268 Y:15730801-15730823 CTGGGTGGGGGGTAGGTGGCAGG + Intergenic
1201672862 Y:16543828-16543850 CAGAGTGAGGGGTAGGAGGAAGG - Intergenic
1201680725 Y:16641560-16641582 CTTGGGGACAGGTAGGAGGGGGG + Intergenic
1201710941 Y:16990914-16990936 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1202089062 Y:21170292-21170314 GTGGGGTAGGGGTAGGGGGGAGG - Intergenic
1202300723 Y:23410963-23410985 CAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1202570088 Y:26259635-26259657 CAGGGTGGAGGGTAGGAGGAGGG - Intergenic