ID: 1103024387

View in Genome Browser
Species Human (GRCh38)
Location 12:117561936-117561958
Sequence CTGGAGATTCACAATGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103024379_1103024387 23 Left 1103024379 12:117561890-117561912 CCTTTCATTCATTCAACACTGAG 0: 1
1: 1
2: 22
3: 404
4: 2770
Right 1103024387 12:117561936-117561958 CTGGAGATTCACAATGAACAAGG 0: 1
1: 0
2: 3
3: 15
4: 158
1103024383_1103024387 -5 Left 1103024383 12:117561918-117561940 CCTGGAGTGCCCCAGATACTGGA 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1103024387 12:117561936-117561958 CTGGAGATTCACAATGAACAAGG 0: 1
1: 0
2: 3
3: 15
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103024387 Original CRISPR CTGGAGATTCACAATGAACA AGG Intronic
902943046 1:19814347-19814369 CCGGACTTCCACAATGAACAGGG - Exonic
903688305 1:25149149-25149171 CTGGGGATTCAGGATGGACAAGG - Intergenic
904949913 1:34228608-34228630 CTGGAGAGCAACAAGGAACAAGG - Intergenic
905240657 1:36578897-36578919 CTGGACTCTCACAATGAACTCGG - Intergenic
908428894 1:64036539-64036561 GGGGAGATTCAATATGAACATGG - Intronic
908873845 1:68647075-68647097 TTGCAGATTCACCAAGAACAGGG + Intergenic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
910754885 1:90678636-90678658 ATGGAAAATCACAAGGAACAAGG + Intergenic
910861008 1:91742309-91742331 CAAGGGATTCAGAATGAACAAGG - Intronic
913356963 1:117932550-117932572 CTGGAAATACACTATTAACAAGG - Intronic
914351145 1:146841505-146841527 CTGGAGTTTCAAAATTAACAAGG + Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
918386423 1:184012929-184012951 CTGGAGATTCAAAAAGAAGAGGG + Intronic
918389541 1:184043982-184044004 CTTGAGAGATACAATGAACAGGG + Intergenic
918464682 1:184808990-184809012 CTGGAGGTTTAAAATAAACAGGG + Intronic
922940926 1:229464972-229464994 CTGGAAAATTACATTGAACAGGG + Intronic
1063493161 10:6483614-6483636 CTGGTGGTTAAAAATGAACATGG + Intronic
1066140115 10:32496572-32496594 CTGAAAATTCTCAATGAACTAGG - Intronic
1066682257 10:37945578-37945600 CAGGAGAATCACATTGAACCCGG - Intergenic
1067801452 10:49361984-49362006 CTGGAAAGTCACAATGATCCCGG + Intergenic
1071867585 10:89753417-89753439 TTGGAATTTCACAATGAAAAGGG - Intronic
1072382634 10:94891059-94891081 CTGTAGATTCTCACTGAAGAGGG - Intergenic
1073932942 10:108597794-108597816 CTGGAGATTCAGAAGGTACAGGG - Intergenic
1075651965 10:124133150-124133172 CTGGATATTAAAAATTAACATGG + Intergenic
1075879796 10:125840991-125841013 TTGGAGCTTCAAAATGAAAAAGG + Exonic
1075941194 10:126391545-126391567 CTGGGCATTCACAACGAACAGGG + Intergenic
1079531753 11:21462669-21462691 CTGGAGCTGCAGGATGAACAAGG - Intronic
1081017635 11:37903050-37903072 ATGGAGATTCACAATGGACAAGG + Intergenic
1082212482 11:49521965-49521987 CTGGAGCTTAATAATGGACATGG + Intergenic
1085315591 11:75543000-75543022 ATGGAGAGTCAAAATGAACGTGG - Intergenic
1087850520 11:103023064-103023086 ATGGAAATTCAAAATGAATAAGG - Intergenic
1088745011 11:112797836-112797858 GTTGAAATTCACAATCAACATGG - Intergenic
1088888889 11:114029519-114029541 CTGGAGCTTCAGAATCAACTGGG - Intergenic
1090927564 11:131262026-131262048 CTGGGGATACAGAATGAATAAGG + Intergenic
1090929384 11:131281765-131281787 CTGCTCATTCAAAATGAACAGGG - Intergenic
1091108970 11:132947657-132947679 GCTGAGGTTCACAATGAACAAGG + Intronic
1099174461 12:79404439-79404461 CTGTAGTTTCTCAAAGAACATGG - Intronic
1102111000 12:110365862-110365884 CTGGAGGTTCATTATGCACAGGG + Intergenic
1102135029 12:110567126-110567148 TTGGAGGCTCACAATGTACAGGG - Intronic
1103024387 12:117561936-117561958 CTGGAGATTCACAATGAACAAGG + Intronic
1103790572 12:123467783-123467805 CTGGAAATTCACAAAGGAAAGGG - Intronic
1106838431 13:33661060-33661082 CTGGAAATTCACATTTAATAGGG + Intergenic
1107365917 13:39675297-39675319 TTGGAGACTCACAATGTATAAGG - Intronic
1107779270 13:43880157-43880179 GCGGAAATTCACAATGAACAGGG + Intronic
1109706746 13:66104065-66104087 TTGGATATGCAGAATGAACAAGG - Intergenic
1110220493 13:73067746-73067768 CTGGAGATTGACAATGGAAAAGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1122049761 14:99048301-99048323 CTGGAAATCAACAATGAACAAGG + Intergenic
1124895675 15:33775127-33775149 CTGCAGATACACAATCAACCTGG - Intronic
1128561115 15:68668370-68668392 CAGGAGACAAACAATGAACAAGG + Intronic
1131692197 15:94839563-94839585 CTGGAAATTCCTAATTAACATGG + Intergenic
1134322934 16:13180108-13180130 CTGGACATTTACAATGTACGTGG + Intronic
1138622561 16:58223589-58223611 CTTGAGATCCACAATTAACTCGG + Intergenic
1138706802 16:58923399-58923421 CTGGAGATTCTTAATCACCAGGG + Intergenic
1139982891 16:70874041-70874063 CTGGAGTTTCAAAATTAACAAGG - Intronic
1140361569 16:74348883-74348905 CTGGAGATTCAGAATCTACAGGG - Intergenic
1140498847 16:75414996-75415018 CTTAAAAGTCACAATGAACAGGG - Intronic
1140835274 16:78788408-78788430 CTGAAGACTCACAATCAAAAAGG - Intronic
1141850253 16:86640255-86640277 CAGGACAGTCACAATGGACACGG + Intergenic
1141881765 16:86864944-86864966 CTGGAGATTAGAAAGGAACAAGG + Intergenic
1142109230 16:88322439-88322461 GTGGAGCTTCAGGATGAACACGG - Intergenic
1142320542 16:89379741-89379763 CTTGTGATTCACAAAGAACTTGG + Intronic
1142805055 17:2367159-2367181 CTGCAGATTCACGATGACCCCGG + Intronic
1146185001 17:30719049-30719071 CTGGTGTTTCACATTGTACAGGG + Intergenic
1150980168 17:70132524-70132546 CTGGAGGATCACCATGAGCACGG - Exonic
1153502230 18:5761100-5761122 CAGGAGATTACCAAGGAACAGGG + Intergenic
1157400226 18:47381155-47381177 CTGGATATGCTGAATGAACATGG + Intergenic
1157897267 18:51481018-51481040 CTGGAGAGTAACAATGATCCAGG + Intergenic
1159315824 18:66772070-66772092 ATGGAGGTTCACAATAATCAGGG + Intergenic
1159594948 18:70373933-70373955 CTGGAGATAAACAATCAAGACGG + Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1162973773 19:14196640-14196662 CTGGTGTTTCACATTGTACAGGG - Intronic
1163129996 19:15266378-15266400 CTTGAGATGCACAGGGAACATGG - Intronic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
929288274 2:40160927-40160949 CTGGAGTTTCAAAATCAACAAGG - Intronic
930028764 2:47045694-47045716 CTGGAGATACACAAAGAAGGCGG - Intronic
931465495 2:62483234-62483256 CTGGAGCTTCTCAATAAAGATGG + Intergenic
935752128 2:106245015-106245037 CTGGAGACTCACAATCAGAAAGG - Intergenic
935912540 2:107912562-107912584 CTGGAGACTCACAATCAGAAAGG - Intergenic
936614137 2:114031728-114031750 CCGGACATTTAAAATGAACACGG - Intergenic
942019810 2:171855871-171855893 CTGGAAAGCCACTATGAACATGG + Exonic
945127689 2:206530907-206530929 GTGGAGATTCACTACGAAAATGG + Exonic
948286525 2:236790178-236790200 CTGGAAATCCAAAATGAAGATGG - Intergenic
1169940004 20:10926675-10926697 CTGGGGAGTCACAAAGCACAGGG - Intergenic
1170130385 20:13012743-13012765 CTGAAGAATCACAATCAGCATGG + Intronic
1171153151 20:22845766-22845788 CTAGAGAGGTACAATGAACACGG + Intergenic
1171349531 20:24492123-24492145 CTGGAGTTTCACTGTGGACACGG - Intronic
1172921657 20:38488460-38488482 TTGGTGATTCAGAATGATCAAGG + Exonic
1173809802 20:45948856-45948878 CTGGAGATCCTAAATGAAGAGGG + Exonic
1174089033 20:48031906-48031928 CTGGAGCTTCATATTAAACAGGG + Intergenic
1176514983 21:7777390-7777412 CTGGGTATTCACAATTCACAAGG - Intergenic
1177075813 21:16571829-16571851 CTGTAGTTGCACAATGAACATGG + Intergenic
1178003053 21:28185406-28185428 CTGGAGATTGAACATGAAAATGG + Intergenic
1178649038 21:34407449-34407471 CTGGGTATTCACAATTCACAAGG - Intronic
1181031158 22:20149403-20149425 CTGGAGATTCTCAGGTAACACGG - Exonic
1182233704 22:28859164-28859186 CTGGAGATTGACAGTGATGATGG - Intergenic
1182634061 22:31710280-31710302 TTAGAGACACACAATGAACAAGG + Intronic
1183119645 22:35720545-35720567 CTGGAGATGGACAAGGATCAGGG - Intronic
1185302827 22:50091418-50091440 CTGGAGAATCTCAACAAACACGG - Intronic
950698995 3:14727128-14727150 CTGGACATTCAGACTGAAGATGG - Intronic
953994694 3:47510833-47510855 CTCGAGATACACAAAGACCAAGG + Intronic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955803894 3:62713798-62713820 CTGGAGAGTGACACTGACCAGGG - Intronic
958070896 3:88609752-88609774 CTGAAGATTAACAATGACCATGG - Intergenic
960150494 3:114244402-114244424 CTGGGGATTACTAATGAACATGG - Intergenic
962880572 3:139572773-139572795 TTGTAGAATCACAATGCACATGG + Intronic
964638554 3:158884389-158884411 ATAAAAATTCACAATGAACAGGG + Intergenic
965008416 3:163055889-163055911 CAGGAAATGCCCAATGAACATGG - Intergenic
967155796 3:186691123-186691145 CAGGAAAGTCACTATGAACATGG + Intergenic
969141275 4:5076004-5076026 CTGGAGATGCTGAATTAACATGG + Intronic
969478294 4:7433518-7433540 CTTGAGACTCTCAATGAGCACGG + Exonic
970517053 4:16843156-16843178 CTGGATATAGACATTGAACAAGG - Intronic
973692382 4:53450758-53450780 CAGGAAATTCACCATGATCATGG - Intronic
974728522 4:65829615-65829637 CTGAACATACACAATGAACCAGG - Intergenic
984278518 4:177638950-177638972 CTGGAGAATCACAGTGAATTTGG - Intergenic
986300997 5:6478258-6478280 CTAGAGTTTCACAATGCAGAAGG - Intronic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986752891 5:10805689-10805711 CTGCAGATTTACAATGCACCTGG + Intergenic
991471425 5:66973005-66973027 CTGGTGAATCAAGATGAACATGG - Intronic
991482038 5:67090789-67090811 CAGAAAATCCACAATGAACATGG - Intronic
993640493 5:90398883-90398905 CTGGTGCTACACAATGAAAAAGG - Intronic
1000397901 5:160795491-160795513 CAGGATAGTCACAATGAATAGGG + Intronic
1000474413 5:161687285-161687307 CTGGAGCTTCACAAAGAAAGGGG - Intronic
1000991051 5:167912451-167912473 CTGGAGAACAACAATGAACTGGG - Intronic
1001193121 5:169648733-169648755 CTGCAGATTCACGATGAAATGGG + Intronic
1003387326 6:5681028-5681050 TTGGAGATTTACACTCAACACGG - Intronic
1005812587 6:29528815-29528837 CTGGAGGCTCAAAATGAGCAGGG - Intergenic
1005866204 6:29939308-29939330 CTGGGAATTCACAAGAAACATGG - Intergenic
1006285473 6:33090556-33090578 CAGGAGATTCAGAACGAAAAGGG + Intergenic
1007489920 6:42212196-42212218 CTTCAAATTCACAATGAAAAAGG + Intronic
1011043546 6:83057380-83057402 CTGGGGATACAGAGTGAACAAGG - Intronic
1011265049 6:85508268-85508290 TTGGAGATTCACAATGCACAAGG + Intronic
1012007808 6:93736662-93736684 ATGGATATTCACCATAAACATGG - Intergenic
1012543547 6:100391347-100391369 ATTGTCATTCACAATGAACAAGG - Intronic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1020921027 7:14264526-14264548 CTAGAGATTATTAATGAACAGGG + Intronic
1021662499 7:22934362-22934384 CTGGAGAAACAAAAAGAACAGGG - Intergenic
1022944949 7:35273364-35273386 CTGGAGTGTCAAAATGATCAGGG + Intergenic
1023279133 7:38552091-38552113 TTGGAGATTCAAAATGTACTTGG - Intronic
1025026267 7:55518743-55518765 CATGAGATTCACAATAAAGAAGG + Intronic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1028437822 7:90825172-90825194 CTTGAGTTTCACAATGAAGCTGG + Intronic
1029691410 7:102184466-102184488 GGGGAGATTCAGAATGAATATGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031912814 7:127535171-127535193 CTGGAGTTTGACGATGAAAAGGG + Intergenic
1033454805 7:141493053-141493075 ATGGAGATTCACAATTACCTTGG - Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037602741 8:20411768-20411790 CTGTAAACTCATAATGAACACGG - Intergenic
1038578129 8:28722848-28722870 CTTGATATTCAAATTGAACAGGG + Intronic
1038779410 8:30557445-30557467 CTGGGGATTCTCAATGACCTTGG - Intronic
1040305477 8:46209627-46209649 CTGGGGCTTCACAACGCACAAGG - Intergenic
1042498840 8:69486833-69486855 CTAGGGCATCACAATGAACATGG + Intronic
1042724197 8:71854686-71854708 CTAGAGAAACACAATGAATAAGG - Intronic
1043367284 8:79548182-79548204 GTTGAGATTCACAATGAGCTGGG - Intergenic
1045199276 8:99962600-99962622 CTGGCCATTCAGAATGTACAGGG - Intronic
1045703808 8:104897149-104897171 CTGCAGATGCACAAGAAACAAGG + Intronic
1045781412 8:105867878-105867900 CTTGGGATTCACAATTAACATGG + Intergenic
1045855989 8:106766252-106766274 CTGGAGTTTTACTATGAAAATGG - Intronic
1046769567 8:118104898-118104920 CTGCATATTCAGAATGAACCAGG - Intronic
1048579178 8:135716789-135716811 CTGCAGACACACAGTGAACAAGG - Intergenic
1052464516 9:28813599-28813621 CAGGAGACACACATTGAACAAGG + Intergenic
1055021984 9:71679888-71679910 CTGGATGTTGACAATCAACATGG + Intergenic
1056494478 9:87142239-87142261 CAGGAGATGCTCAATGAACATGG - Intergenic
1058011351 9:99981013-99981035 ATGGAAATTCACATTCAACAAGG - Exonic
1058113487 9:101057501-101057523 GTGGAAATGCACAATAAACAAGG + Intronic
1058239305 9:102536498-102536520 CTGGAAATCAACAATGAATAAGG - Intergenic
1059993812 9:119890460-119890482 CTGGAGAATAAAAATGACCAAGG + Intergenic
1060520909 9:124293593-124293615 CTGGAGATTCAAAACCAACTGGG - Intronic
1061175626 9:128994720-128994742 CAGGACATTCACATTCAACAGGG + Intronic
1061244086 9:129392371-129392393 TTTGAAATTCACAATGGACAGGG - Intergenic
1187508162 X:19894113-19894135 CAGGAGATTAACAAAAAACATGG + Intergenic
1188281055 X:28269794-28269816 CTGTAGTTTCACCATGAGCAGGG + Intergenic
1188603281 X:31995840-31995862 CTTGAGATTCACCATGAATGTGG - Intronic
1190707283 X:53040650-53040672 CTGGGTATTTCCAATGAACAAGG - Intergenic
1191145006 X:57156501-57156523 CAGAAGATTCAGTATGAACAAGG - Intergenic
1195707241 X:107746482-107746504 CTGGAGAGTCAGGATGACCAAGG - Intronic
1199694058 X:150331029-150331051 TTGGAGAATCCCAATGCACATGG + Intergenic