ID: 1103024526

View in Genome Browser
Species Human (GRCh38)
Location 12:117562844-117562866
Sequence TGGGGTTTTCTGCATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103024526_1103024536 22 Left 1103024526 12:117562844-117562866 CCTTGCTCATGCAGAAAACCCCA 0: 1
1: 0
2: 1
3: 21
4: 203
Right 1103024536 12:117562889-117562911 GGCACTTAAACCTTGCACTTAGG 0: 1
1: 0
2: 0
3: 8
4: 153
1103024526_1103024532 1 Left 1103024526 12:117562844-117562866 CCTTGCTCATGCAGAAAACCCCA 0: 1
1: 0
2: 1
3: 21
4: 203
Right 1103024532 12:117562868-117562890 GGGAAATATCTCCAATGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103024526 Original CRISPR TGGGGTTTTCTGCATGAGCA AGG (reversed) Intronic
902834504 1:19037936-19037958 TGGGGTTTGCTTCATTATCAAGG + Intergenic
904463099 1:30692209-30692231 TGGGGTGTCCTGCAGGAGAATGG + Intergenic
904834646 1:33327419-33327441 GAGGGTATTCTGCATGAGGAAGG + Intronic
906604605 1:47158334-47158356 TGGGGTTTTCTAAATGTACAAGG - Intergenic
907079445 1:51607933-51607955 TGGGGTTTTATACATTGGCATGG + Intronic
907109224 1:51911353-51911375 TGGGATTTTCTGAATGACCCAGG + Exonic
907384377 1:54116572-54116594 TGGGATTTGCTGCAGGAGAACGG + Intergenic
910442484 1:87266864-87266886 TGGAGCTTTCTACAGGAGCAGGG + Intergenic
910500020 1:87879721-87879743 TGGGGTTTTAGCCATAAGCAAGG - Intergenic
911746332 1:101445550-101445572 TGGGGTTTTATACATTGGCATGG - Intergenic
911753316 1:101523739-101523761 TGGTGTTTTCTGCTGGAGAAAGG + Intergenic
913379125 1:118188927-118188949 TGGGGTTTGCTACAGCAGCAAGG + Intergenic
915218701 1:154356809-154356831 TGGGGTGTGCTGCAGAAGCAAGG - Intergenic
915592640 1:156879314-156879336 TGGTGATTTTGGCATGAGCAGGG + Exonic
917054750 1:170968452-170968474 TGGGGTTTTGTGTGTGAGCAAGG - Intronic
918369829 1:183848506-183848528 TGGGGTTTCCTGCATAAGGAAGG + Intronic
923443479 1:234044212-234044234 AGGGCTTTCCTGCTTGAGCAGGG - Intronic
1063369989 10:5514926-5514948 AGGGATTTTCTGCAGGAGCATGG - Intergenic
1065035918 10:21638549-21638571 TTGTGTTTTCTGGCTGAGCACGG + Intronic
1065715256 10:28560590-28560612 TGAGGTTATCTGCATGTACATGG + Intronic
1066433813 10:35378569-35378591 AGGGTTTTTCTGTTTGAGCACGG + Intronic
1066656769 10:37704283-37704305 TCGGGTTTCCTGCAGGATCAGGG + Intergenic
1067974470 10:51008441-51008463 TAGGGTTTTCAGAAAGAGCATGG - Intronic
1068243937 10:54340719-54340741 GGGGGTTTTCTACATTGGCATGG + Intronic
1080921483 11:36713712-36713734 TGGGTATTTCTGCATGACAATGG + Intergenic
1081146957 11:39573327-39573349 TGAGTGTTTCTGCATGTGCATGG + Intergenic
1083436549 11:62647219-62647241 TGGGGTTTTCTCCGGGAGCATGG - Exonic
1083668443 11:64287640-64287662 TGGGGTTTCCTGCAGGAGGTGGG + Intronic
1084160759 11:67348574-67348596 TGGTGTTTACTGATTGAGCAAGG + Intronic
1085519942 11:77131822-77131844 TGGGGCTTTCTTCAGGACCAAGG - Intronic
1087229742 11:95646968-95646990 CGGGGTTTTTTGAAAGAGCAGGG - Intergenic
1088531670 11:110817416-110817438 TGGGTTTCTCTGCATTAGCCAGG + Intergenic
1091722191 12:2821461-2821483 AGGGGTGTTCTGCAGCAGCAGGG - Intronic
1092397116 12:8136637-8136659 TGGGGATCTCTGGCTGAGCAGGG - Intronic
1096886080 12:54720707-54720729 TGGGGTTTTATACATTGGCATGG + Intergenic
1097109166 12:56645535-56645557 TGGGGTCTTGTGCATGCGGATGG - Intronic
1098450964 12:70617659-70617681 TGGAGTTTTCTGCATTTGCAGGG + Intronic
1098749887 12:74279896-74279918 TGGGGATTTCTCTATGATCATGG + Intergenic
1099208654 12:79758362-79758384 TGGGCTATTCTGCATGAGGTTGG + Intergenic
1100143839 12:91653092-91653114 TGAGGTTTTTTGTAAGAGCAAGG - Intergenic
1100277152 12:93081748-93081770 TGGGGTTTTCTCCATTGGCGTGG - Intergenic
1100615968 12:96231978-96232000 TGGGGTCTTCTGGGAGAGCAGGG + Intronic
1101531510 12:105577355-105577377 TGGGTTTTTGTGAATTAGCAAGG - Intergenic
1102856615 12:116299814-116299836 TGTGGTTTTCTGCAACAGCTGGG + Intergenic
1103024526 12:117562844-117562866 TGGGGTTTTCTGCATGAGCAAGG - Intronic
1103985297 12:124763122-124763144 TGGTGTTTTTTGCATGAGCGGGG - Intergenic
1104266515 12:127238179-127238201 TGGGGTTTTCCCCATTAGAAAGG - Intergenic
1104710731 12:130983993-130984015 TGGAGGTTCCTGAATGAGCAGGG + Intronic
1108031334 13:46232599-46232621 TGGTGTTTTCTGCCTAATCAAGG + Intronic
1113535880 13:111065983-111066005 TTGGGTTTTATACATGGGCATGG - Intergenic
1115022064 14:28694005-28694027 TGGGGTTTCTTGCTTGAGCCTGG - Intergenic
1116859996 14:49987157-49987179 TGAGGTTTTGTGCATAAGAAAGG + Intronic
1120497304 14:85253238-85253260 TGGGGTATACTGCAGGAGGAAGG - Intergenic
1123406710 15:20023876-20023898 TGGGGTTTTATACATTGGCATGG + Intergenic
1123516040 15:21030524-21030546 TGGGGTTTTATACATTGGCATGG + Intergenic
1126562167 15:50055841-50055863 TTGGGTTCTTTGCATGAACATGG - Intronic
1127761392 15:62143045-62143067 TGGGGTTTTCTGACTGAATAGGG - Intergenic
1128495216 15:68194313-68194335 TCGGGCTTTCTGCAGGGGCAGGG + Intronic
1132249897 15:100327927-100327949 TAGGGTTTTATGTCTGAGCAGGG - Intronic
1137247275 16:46716090-46716112 TGCGGTTTCCTGCATTATCATGG + Intronic
1146246577 17:31289300-31289322 TATGGTTTACTGCATGATCAGGG - Intronic
1148457903 17:47820831-47820853 GGGAGTTTTCTGCAAGATCATGG - Intronic
1148479901 17:47953255-47953277 TGGGGCTTTCTGCTGGAGCAGGG + Exonic
1149758870 17:59210903-59210925 TGGGCTTGTCTGGATGAGCTGGG - Exonic
1151864202 17:76789257-76789279 TGGGGTTTTATACATTGGCATGG + Intergenic
1152148247 17:78582298-78582320 AGGGGGTTTCTGGATGAGCCTGG + Intergenic
1152500786 17:80707659-80707681 TGGGATTTTCGGCATGAGCCAGG + Intronic
1153381760 18:4448196-4448218 TGGGCTTTTCTGTAGGAGTAGGG - Intronic
1156743415 18:40360544-40360566 TGTAGTTTTCTGCATTATCAGGG - Intergenic
1156956424 18:42970515-42970537 TGAGGTTTTCTGCATTTCCAAGG - Intronic
1157967761 18:52227602-52227624 TTGGGTTTCCTGCAGGAGCTGGG - Intergenic
1158183555 18:54745271-54745293 TGGGAAGTTCTGCATAAGCATGG + Intronic
1158625264 18:59065815-59065837 TTGGCTTATCTGCGTGAGCATGG + Intergenic
1158925653 18:62255939-62255961 TGGCTTTTTCTGCAAAAGCATGG - Intronic
1160018905 18:75165347-75165369 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018914 18:75165403-75165425 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018922 18:75165459-75165481 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018944 18:75165608-75165630 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018955 18:75165683-75165705 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018962 18:75165720-75165742 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018966 18:75165739-75165761 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018973 18:75165776-75165798 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018983 18:75165851-75165873 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018990 18:75165889-75165911 TGGGGTATCCTGTATGAGCTAGG + Intergenic
1160917444 19:1503972-1503994 TGGGGTCATCTGCAAGATCAGGG + Intergenic
1164089588 19:21936327-21936349 TCTGGTTTTCTATATGAGCATGG - Intronic
1164837611 19:31367357-31367379 TGGGGTTTGCCGCATGTGCCTGG + Intergenic
925083597 2:1090625-1090647 TGGGGTTTTCTCCATTGACATGG + Intronic
926214996 2:10900688-10900710 TGGATTCTGCTGCATGAGCACGG + Intergenic
929002892 2:37365701-37365723 TAGGATTTTGTGCATAAGCAGGG + Intronic
930245973 2:48983797-48983819 TGAGGTGATCTGAATGAGCAGGG + Intronic
930934787 2:56935537-56935559 TGTTGTGTTCTGCATAAGCAGGG - Intergenic
932117112 2:69061926-69061948 TGGGCTTTTCTGGTTGACCATGG - Intronic
933765614 2:85706680-85706702 CAGGGTTTTCGGCCTGAGCAAGG - Intergenic
935385212 2:102492343-102492365 TGAAGTTTTCTGCAGGGGCAGGG - Intronic
936656547 2:114494757-114494779 CAGGGTTTTCTGCAAGAGTAAGG + Intronic
937532557 2:122846564-122846586 TGGGGTTTTGAGCACCAGCAAGG + Intergenic
938402486 2:131004984-131005006 TGGGGCTTTCTGTGAGAGCAGGG + Intronic
940135934 2:150435955-150435977 TGAAGTTTGCTGCAGGAGCAGGG + Intergenic
940782962 2:157952755-157952777 TGGGGTTTTCTACATTGGCACGG - Intronic
941998374 2:171622915-171622937 TGGGGTTTTATACATTGGCATGG + Intergenic
944633737 2:201654264-201654286 TGGTGTTTTCTGGCTGGGCACGG - Intronic
945392026 2:209276140-209276162 TGGGGTTTTATACATTGGCATGG - Intergenic
946111467 2:217421722-217421744 TGGTGATTTGTGCATGGGCATGG - Intronic
946780293 2:223187892-223187914 TGGGGTTTTATGCAGTGGCATGG + Intronic
946982761 2:225235985-225236007 TGGGGTCTTCAGAATGAGAATGG - Intergenic
947051197 2:226045380-226045402 TGGGGTTTTATACATTGGCATGG - Intergenic
947969243 2:234308146-234308168 TGGGGTTCTCCACATCAGCAAGG - Intergenic
948306889 2:236954921-236954943 TGGGGAGTTAGGCATGAGCAGGG + Intergenic
1171198080 20:23217025-23217047 TGGGGTTTACTACATTATCATGG + Intergenic
1171416308 20:24982888-24982910 TGGATTTTTCTGCCTGAGCCAGG - Intronic
1174061439 20:47835698-47835720 GGGGGTTTTCAACCTGAGCAAGG - Intergenic
1174423760 20:50417616-50417638 TGGGGTCTTATGGAAGAGCAGGG - Intergenic
1175030260 20:55946519-55946541 TGGAGTTGACTGCAGGAGCATGG - Intergenic
1176139755 20:63539808-63539830 TGGAGTCTTCTGCCTGTGCAGGG - Intergenic
1177323818 21:19557156-19557178 TGTGGTTTTCAGCATGTGCCCGG - Intergenic
1178085684 21:29109670-29109692 TAGGGTTCTCTGCATGATCTCGG + Intronic
1179724735 21:43335784-43335806 TGGGGCTACCTGCATGATCAGGG - Intergenic
1180180765 21:46117811-46117833 TGGGGTTCTCCCCATGAGCCAGG - Intronic
1183740284 22:39665094-39665116 TGGGGTATGCTGGAAGAGCAGGG + Intronic
1185272560 22:49935762-49935784 TGGGGGGTTCAGGATGAGCAGGG + Intergenic
1185344911 22:50306927-50306949 AGGGGCTTCCTGCAGGAGCAGGG + Intronic
950780363 3:15386521-15386543 TGAGGTTTTATACATGGGCATGG + Intronic
952430000 3:33214025-33214047 TCGGCTTTCCTGCAAGAGCAGGG - Exonic
953450213 3:42999350-42999372 TGGGGTTTGCTGCATGTGGAAGG - Intronic
953668277 3:44941633-44941655 TAGGTTCTTCTGCATGAGGAGGG - Intronic
954537448 3:51371835-51371857 TGGGGTTTTCTTTATGAGCCAGG + Intronic
954537543 3:51372558-51372580 TGGGGTTTTCTTTATGAGCCAGG + Intronic
956232467 3:67032001-67032023 TGGGGTTGTCTCCAAAAGCAGGG - Intergenic
956748783 3:72330092-72330114 TGGGGTTTCCTGCAGCAGGATGG - Intergenic
957428931 3:80076575-80076597 TGGGGTTTCATGCATTGGCATGG - Intergenic
957617850 3:82554456-82554478 GTGGCTTTCCTGCATGAGCATGG - Intergenic
958116339 3:89223477-89223499 TGGAGTTTACAGCATGAGCCTGG - Intronic
958655130 3:96991650-96991672 TGGGATTTTGTGCATGACGAAGG - Intronic
959292609 3:104493633-104493655 AGGGTTTTCCTGCATGAGCTGGG - Intergenic
960008779 3:112810694-112810716 TGGTATTTTCTGGATGATCAAGG - Intronic
962891303 3:139675545-139675567 AGGGGTGTTCTGCATGATAAAGG - Intronic
963318910 3:143791342-143791364 TGGGTTTATTTGCATGAACAAGG - Intronic
965071952 3:163925506-163925528 TGGGGTTTTATACATTGGCATGG + Intergenic
965984357 3:174734017-174734039 TGGGGTTTTCTGGATAAATATGG - Intronic
967450040 3:189613466-189613488 AGAAGTTTGCTGCATGAGCAGGG + Intergenic
969153962 4:5193628-5193650 TGGGCTGTTCTGCAAGAGCAGGG - Intronic
970453401 4:16195378-16195400 TGGGGTTTTCATCATTTGCAAGG - Intronic
970906840 4:21225931-21225953 TGAAGCTTTTTGCATGAGCAGGG - Intronic
971431550 4:26573369-26573391 TGTGTTTTTCTGCAGCAGCATGG + Intergenic
972716044 4:41647127-41647149 TGGAGTCGTCTCCATGAGCAAGG + Intronic
975916413 4:79330999-79331021 TGGGGTTTTATACATTGGCATGG - Intergenic
976361589 4:84185098-84185120 TGGGGTTGTCTGGAAGAGCTGGG + Intergenic
977720850 4:100238689-100238711 TGGGGCTTTTTGCATGCCCAGGG - Intergenic
977837446 4:101662041-101662063 TGGAGTTTTCTGAATGGCCATGG + Intronic
978151399 4:105440069-105440091 ATGGGATTTCTGCATTAGCAAGG - Intronic
978458600 4:108924795-108924817 TGCAGTTTTCTGCATAAGCCAGG + Intronic
978514217 4:109554131-109554153 TGGAGTTTTCTGCCTGAGCAAGG - Intergenic
979741611 4:124158247-124158269 TGTGGTTTGGAGCATGAGCATGG + Intergenic
980107091 4:128598535-128598557 TGGGATTTTCTGCAGGAGACTGG + Intergenic
981223733 4:142267545-142267567 TTGATTTTTGTGCATGAGCATGG - Intronic
981580382 4:146244017-146244039 TGGGTTTTTCTCAATGAGCACGG + Intergenic
982353537 4:154442890-154442912 AGGAGTTTTTTGCATGAGGAGGG - Intronic
984594193 4:181648863-181648885 TGGAGTTTTGTGCATGAACATGG + Intergenic
984706179 4:182848712-182848734 TGGGGAATTCTGAATGAGCATGG - Intergenic
985632356 5:1020708-1020730 TGGGGTTTATTTCATGGGCAGGG + Intronic
986052629 5:4104459-4104481 TGGGTTTTTATGCCTGGGCAGGG + Intergenic
987878640 5:23712196-23712218 TGGGGGCTGCTGCAGGAGCAGGG + Intergenic
990779088 5:59337811-59337833 TGGGGTATTCTGAATGGGCATGG + Intronic
992019609 5:72608949-72608971 TGGTGTTTTCTGCAACAACATGG + Intergenic
995924674 5:117356853-117356875 TGGGGTTTTCTGACTCAGAATGG + Intergenic
997211083 5:132077156-132077178 ACGGTCTTTCTGCATGAGCATGG - Intergenic
998985172 5:147748840-147748862 AGGGGTTTTATGGATGAGCTTGG - Intronic
999055197 5:148567481-148567503 TGGGATATTCTGCATGAGCTGGG - Intronic
999518436 5:152324442-152324464 TGGGGTTTTATACATTGGCATGG + Intergenic
999716427 5:154364501-154364523 TGGGGTGTTTTGCATGGGGAGGG + Intronic
1000026283 5:157361870-157361892 TGAGGTTTACTGCAGGAGAAAGG + Intronic
1002671855 5:180873838-180873860 TGGGGTGTTTTGCATGAGACTGG + Intergenic
1003351246 6:5319515-5319537 TGGGGTTTTATACATTGGCATGG - Intronic
1003868442 6:10383468-10383490 TGGGGTTTGCTTCGTCAGCAGGG - Intergenic
1003950565 6:11111744-11111766 TGGGGTTTTATACATCGGCATGG + Intronic
1004601785 6:17157346-17157368 GGGGGTTTTCTGCATATGAATGG - Intergenic
1005621361 6:27623561-27623583 TGGGGTTTTATACATTGGCATGG + Intergenic
1006937845 6:37730746-37730768 CGGGGTGTTCAGCATGAGCATGG + Intergenic
1011198209 6:84804575-84804597 TGGGGTTTTCAGGGAGAGCATGG - Intergenic
1011966587 6:93165706-93165728 TGGGGTTTTCTTCTTGTGTATGG - Intergenic
1012493670 6:99811014-99811036 TGGGGTTTTGTACATTGGCATGG + Intergenic
1012716067 6:102672104-102672126 TGGGGTTTTATACATTGGCATGG + Intergenic
1013145593 6:107388054-107388076 TAGGGTTTTCCCCATTAGCATGG - Intronic
1013197964 6:107862559-107862581 TGTGGCTTTCTGCCTGGGCAAGG - Intergenic
1013479253 6:110538976-110538998 TCAGGCTTTCTGCATGAGCTTGG - Intergenic
1017422811 6:154290372-154290394 TGGGGTTTTATACATCAGCATGG - Intronic
1017901351 6:158720928-158720950 TGTGGCGTTCTGCATGAGGATGG + Intronic
1019264730 7:108100-108122 TTGGGTTGACTGCATGGGCATGG - Intergenic
1020488982 7:8755854-8755876 TAGGATTTGCTCCATGAGCAAGG + Intergenic
1021163463 7:17304522-17304544 TGTGGTTTTCTGGAAGAGAAGGG + Intronic
1021326311 7:19273480-19273502 AGAAGTTTTCTGCAGGAGCAGGG - Intergenic
1021598587 7:22342055-22342077 AGAGGTTTGCTGCAGGAGCAGGG - Intronic
1022335971 7:29422427-29422449 TGATGTTTCCTGCATGATCAAGG + Intronic
1022992960 7:35726497-35726519 GGGGGTTTTATGCACAAGCAGGG - Intergenic
1023139702 7:37089727-37089749 TATGGTTTTCTGCATCAGTAAGG + Intronic
1024682422 7:51706734-51706756 TGTGGTTTTCTGGGAGAGCAGGG + Intergenic
1025247374 7:57327537-57327559 TGGGGTCTTATGGAAGAGCAGGG + Intergenic
1029222388 7:99000726-99000748 TGGGGTGTCCTGAAGGAGCAGGG + Intronic
1029499358 7:100918444-100918466 TGGGGTTTTATACATTGGCATGG - Intergenic
1032018314 7:128393331-128393353 TGGAGTTTGCTCCATGAGGATGG - Intronic
1032427443 7:131833102-131833124 TGGGGTATTCTGCATATGAATGG - Intergenic
1035160715 7:156948719-156948741 TGGGGTTCTCGGCCTGACCAGGG - Intergenic
1041142940 8:54842473-54842495 TGGGGTTTCCACCAGGAGCACGG + Intergenic
1044180978 8:89194163-89194185 TGGAGTTTTGTACATGAGAAAGG - Intergenic
1045363625 8:101455249-101455271 TGGAATTTTGTGCATGAACAGGG - Intergenic
1045535124 8:103020755-103020777 TGGGGTTTTCTTCGTCAGCTGGG - Intergenic
1046372203 8:113324586-113324608 AGAAGTTTTCTGCATGGGCAGGG + Intronic
1048460540 8:134617747-134617769 AGGGCTTTTGTGCATGTGCAAGG - Intronic
1048599603 8:135905924-135905946 TGGATTTTTATGCATGAACAAGG + Intergenic
1051179096 9:14391749-14391771 TGGGGTTTTATACATTGGCATGG - Intronic
1052999916 9:34572184-34572206 TGGGGCTTTCTGGATCTGCAGGG - Intronic
1053185282 9:36011081-36011103 AGGGGCTTTCTGCATTAGAAAGG + Intergenic
1056247772 9:84714253-84714275 CGGGGTTTGCTACATCAGCAGGG + Intronic
1056893053 9:90514038-90514060 TTGGGTTTTCTGCATCAGGAGGG - Intergenic
1059236152 9:112762271-112762293 TGGGGGTTCCTGCTTGAGAAGGG + Intronic
1059399696 9:114061181-114061203 TGAGGTGTTCTAGATGAGCAGGG - Intronic
1061248864 9:129414966-129414988 TGGGGCTTTCTGCATTGGAAAGG + Intergenic
1061792708 9:133066905-133066927 TGGGTTTTTCTGGATGACCCAGG - Exonic
1061866627 9:133494703-133494725 TGGGGTTTGCTTCTTGCGCATGG + Intergenic
1061965028 9:134008626-134008648 GGGTGTATTCTGCATGTGCAAGG - Intergenic
1062517999 9:136945673-136945695 TGCCGTTTCCTGCAGGAGCAGGG + Exonic
1188091896 X:25974961-25974983 TGGGGTTTTATACATTGGCATGG - Intergenic
1199638727 X:149838863-149838885 TGGGATTTTCTGCATAGACAGGG + Intergenic
1201220210 Y:11761570-11761592 TGTGTTTTTCTGCCTGAGCTAGG + Intergenic
1201946497 Y:19515820-19515842 TGGGGTTTTCCTCATCTGCATGG - Intergenic