ID: 1103024680

View in Genome Browser
Species Human (GRCh38)
Location 12:117563905-117563927
Sequence ATCCCAGGCCACACCAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103024680_1103024688 28 Left 1103024680 12:117563905-117563927 CCTCTATTGGTGTGGCCTGGGAT 0: 1
1: 0
2: 1
3: 33
4: 121
Right 1103024688 12:117563956-117563978 CATCCTTGTCTCTGGGTCTGTGG 0: 1
1: 0
2: 1
3: 46
4: 327
1103024680_1103024685 21 Left 1103024680 12:117563905-117563927 CCTCTATTGGTGTGGCCTGGGAT 0: 1
1: 0
2: 1
3: 33
4: 121
Right 1103024685 12:117563949-117563971 GCCCTCACATCCTTGTCTCTGGG 0: 1
1: 0
2: 1
3: 31
4: 280
1103024680_1103024684 20 Left 1103024680 12:117563905-117563927 CCTCTATTGGTGTGGCCTGGGAT 0: 1
1: 0
2: 1
3: 33
4: 121
Right 1103024684 12:117563948-117563970 TGCCCTCACATCCTTGTCTCTGG 0: 1
1: 1
2: 24
3: 99
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103024680 Original CRISPR ATCCCAGGCCACACCAATAG AGG (reversed) Intronic
900197955 1:1386909-1386931 ATGCCAGGCCACGCCAACAAGGG + Exonic
901492798 1:9605185-9605207 ATCCCAGCCCACATCAGGAGTGG - Intronic
905382770 1:37575133-37575155 ATCCCAGGACACAAAAATAATGG + Intronic
906772258 1:48495632-48495654 ATCCCAGGAAACACCAATTAGGG + Intergenic
907372217 1:54010942-54010964 AACTCAGGCCACATCACTAGAGG + Intronic
909905807 1:81193185-81193207 ATTCCAGGCCAGAAAAATAGAGG + Intergenic
912954535 1:114145375-114145397 TTCCCAGGTCACACAACTAGTGG + Intronic
912982296 1:114386608-114386630 ATCTCAGGACATACCACTAGAGG - Intergenic
916378651 1:164184168-164184190 ATACCAGGAAACACCAATAATGG + Intergenic
916820628 1:168394778-168394800 ATCCAAGGTCACACAACTAGTGG - Intergenic
923036838 1:230290401-230290423 ATCCAAGGGCACAGGAATAGCGG - Intergenic
923037116 1:230292098-230292120 ATCCAAGGGCACAGGAATAGGGG - Intergenic
1067405456 10:46019203-46019225 AACCCTGGACACACCAACAGTGG + Intronic
1067721084 10:48728204-48728226 ATCCCAGAAAACACCAGTAGGGG - Intronic
1070817580 10:79335155-79335177 ATCTCAGGCCACATCAATAAAGG - Intergenic
1073428759 10:103472269-103472291 TTCCCAGGCCCCACCAATTCTGG - Intergenic
1076040512 10:127243699-127243721 AGCCAAGGCCACACCAACAGGGG + Intronic
1077592725 11:3505177-3505199 ATTCCAGGGAACACCAATAGGGG + Intergenic
1078928391 11:15894482-15894504 ATACCAGGCCACACAGATAGAGG - Intergenic
1084248555 11:67877897-67877919 ATTCCAGGGAACACCAATAGGGG + Intergenic
1084515394 11:69635441-69635463 GTCCAAGGCCACACAACTAGTGG + Intergenic
1084824269 11:71717579-71717601 ATTCCAGGGAACACCAATAGGGG - Intergenic
1089333354 11:117705543-117705565 ATTCCAGGCCACTCCCACAGTGG - Intronic
1092418837 12:8313298-8313320 ATTCCAGGGAACACCAATAGAGG + Intergenic
1093453277 12:19339375-19339397 CTCACAGGCCATACCAAAAGAGG + Intronic
1103024680 12:117563905-117563927 ATCCCAGGCCACACCAATAGAGG - Intronic
1103059689 12:117848493-117848515 TTCCCTGGCCACAAAAATAGAGG - Intronic
1104917974 12:132275909-132275931 ATCCCAGGCCACCCGCACAGTGG + Intronic
1105255341 13:18740779-18740801 ATCCCAGGAAACACCAGTAGAGG + Intergenic
1105635657 13:22212936-22212958 ATCCCAGGCCACACGGACTGTGG - Intergenic
1106866555 13:33970613-33970635 ATTCCAGGAAACACCAGTAGGGG + Intergenic
1120813196 14:88825688-88825710 CTCCAAGGCAACACCACTAGAGG - Intronic
1121413825 14:93765074-93765096 ATCCCAGAAAACACCAAAAGGGG - Intronic
1121467145 14:94123267-94123289 ATCCCAGGAAACACCAACAGGGG + Intergenic
1121647236 14:95526795-95526817 AACCCAGGACACACAATTAGAGG - Intergenic
1122574325 14:102732158-102732180 ATCCCAGGCAACAGAAGTAGGGG - Intergenic
1123920646 15:25067489-25067511 ATGCCAGGCCACACCAAATCAGG - Intergenic
1129782883 15:78285699-78285721 ATCCCAGGCCTGACCAACACTGG + Intronic
1130939764 15:88497779-88497801 CTCCCTGGCCACCCCAATGGGGG + Intergenic
1135863639 16:26080494-26080516 ATCCCAGGAAACACAAATAGAGG + Intronic
1135967479 16:27048011-27048033 ATCCCAGGAAACACCAATATGGG - Intergenic
1136711078 16:32237797-32237819 CTCCCAGGCCACAGCAGAAGCGG + Intergenic
1136756829 16:32691613-32691635 CTCCCAGGCCACAGCAGAAGCGG - Intergenic
1136811280 16:33178762-33178784 CTCCCAGGCCACAGCAGAAGCGG + Intergenic
1136817756 16:33288842-33288864 CTCCCAGGCCACAGCAGAAGCGG + Intronic
1136824320 16:33345371-33345393 CTCCCAGGCCACAGCAGAAGCGG + Intergenic
1136829386 16:33444142-33444164 CTCCCAGGCCACAGCAGAAGCGG + Intergenic
1137031604 16:35529106-35529128 CTCCCAGGCCACAGCAAAAGGGG - Intergenic
1137246822 16:46712518-46712540 ACCCCAGGAAACCCCAATAGAGG - Intronic
1137827950 16:51515943-51515965 ATCTCAGGAGACACCAGTAGAGG - Intergenic
1141868209 16:86765689-86765711 ATCCCAGGAAACACCAACAGGGG + Intergenic
1202989858 16_KI270728v1_random:1731-1753 CTCCCAGGCCACAGCAGAAGCGG + Intergenic
1203058979 16_KI270728v1_random:951965-951987 CTCCCAGGCCACAGCAGAAGCGG - Intergenic
1144654277 17:17025378-17025400 GTCCCAGGAAACACCAATAGAGG + Intergenic
1146478204 17:33180309-33180331 ATCCCAGGCCTCACAATGAGGGG + Intronic
1148447273 17:47745175-47745197 ATCTCAGTCCACACCAAGGGGGG - Exonic
1148449923 17:47770347-47770369 ATCCCAGGCCTGGCAAATAGGGG + Intergenic
1154435676 18:14339823-14339845 ATCCCAGGAAACACCAGTAGAGG - Intergenic
1158559618 18:58503038-58503060 ATCCCAGGAAACGCCAGTAGAGG - Intronic
1158750055 18:60248212-60248234 AACCCAGGGCACTCCCATAGGGG - Intergenic
1158767771 18:60475649-60475671 ATCCCAGGCAACATCAAGAAAGG + Intergenic
1166682312 19:44776694-44776716 CTCCCATGCCACACCATTAGGGG + Intergenic
1167988706 19:53339792-53339814 ATGCCAGGGGACACAAATAGAGG + Intronic
925637060 2:5950854-5950876 AATCCAGGCCACACCCATACAGG - Intergenic
929174830 2:38966085-38966107 ATCCCAGGCAAGACCAGAAGGGG + Exonic
929584996 2:43107991-43108013 AACACAGGCCACACCAATGTGGG + Intergenic
931651091 2:64469451-64469473 ATCCCAGGCAACAGTAGTAGGGG - Intergenic
933701437 2:85257976-85257998 ATCCAAGGCCACACAGCTAGGGG - Intronic
933997203 2:87678878-87678900 GTCCAAGGCCACACCACTGGTGG - Intergenic
934490358 2:94758321-94758343 ATCCCAGGAAACACCAGTAGAGG + Intergenic
934680263 2:96278533-96278555 ATGCCGGGCCTCACCAATGGTGG + Exonic
936296648 2:111272032-111272054 GTCCAAGGCCACACCACTGGTGG + Intergenic
936886823 2:117320449-117320471 ATTCCTGGTCAGACCAATAGAGG - Intergenic
938278285 2:130047526-130047548 ATTGCAGGCAACACCAGTAGAGG + Intergenic
938329257 2:130438331-130438353 ATTGCAGGCAACACCAGTAGAGG + Intergenic
938360689 2:130683162-130683184 ATTGCAGGCAACACCAGTAGAGG - Intergenic
938437091 2:131289860-131289882 ATTGCAGGCAACACCAGTAGAGG - Intronic
939008628 2:136819360-136819382 AACCCAGTACACACTAATAGAGG - Intronic
947545522 2:231007816-231007838 ATCCCAGCAAACACCAATAGGGG + Intronic
1170556872 20:17521923-17521945 ATCCCAGTCCACAGCAACTGAGG + Intronic
1170766965 20:19298544-19298566 ATCCCAGGAAACAACAGTAGAGG + Intronic
1171880154 20:30612732-30612754 ATCCCAGGAAACACCAGAAGAGG + Intergenic
1172846515 20:37932686-37932708 ATCCCAGGAAACACAAGTAGGGG - Intronic
1173338930 20:42136788-42136810 ATCCCAGGAAACACCAGCAGGGG + Intronic
1174664076 20:52240851-52240873 ATCCCAGGAAACACCCATAAAGG + Intergenic
1174783694 20:53413045-53413067 ATCCCAGGAACCCCCAATAGGGG + Intronic
1175322585 20:58099857-58099879 ATCCCAGGCAACTCCAGCAGGGG - Intergenic
1175516744 20:59575035-59575057 AACCCAGGCCACACCTAAGGAGG + Intergenic
1176841357 21:13845809-13845831 ATCCCAGGAAACACCAGTAGAGG + Intergenic
1181839024 22:25638618-25638640 ATCACAGGCCATAGTAATAGTGG + Intronic
1184876525 22:47279369-47279391 AGCCCAGGCTACACCATTGGCGG - Intergenic
1185137609 22:49081536-49081558 ATCTCAGGCCACACAAAGAAGGG + Intergenic
950668195 3:14509832-14509854 ATCTCAGGCCTCACCAAGCGTGG - Exonic
950756624 3:15178591-15178613 ATCCCAGGCGTCTCCAATTGAGG - Intergenic
953550063 3:43894959-43894981 GTCCCCAGCCACACCCATAGGGG + Intergenic
955905799 3:63806326-63806348 ATCCCAGGAAACACCCAGAGTGG - Intergenic
956704746 3:71989643-71989665 ATCACAGGCCACAAGAATAAGGG - Intergenic
957062805 3:75495851-75495873 ATTCCAGGGAACACCAATAGGGG + Intergenic
959019248 3:101170318-101170340 CTCCCAGGCCACACCAACCAGGG + Intergenic
961290593 3:125843565-125843587 ATTCCAGGGAACACCAATAGGGG - Intergenic
961896519 3:130172520-130172542 ATTCCAGGGAACACCAATAGGGG + Intergenic
964712506 3:159686052-159686074 ATCCCAAGGCCCACCAAAAGTGG + Intronic
968518813 4:1026520-1026542 ACCCCAGCCCACAGCAGTAGGGG - Exonic
969006704 4:4025985-4026007 ATTCCAGGGAACACCAATAGGGG + Intergenic
969806278 4:9611434-9611456 ATTCCAGGGAACACCAATAGGGG - Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
979924359 4:126542015-126542037 ATCCCAGGAGACAGCAACAGAGG + Intergenic
981652605 4:147076619-147076641 ATCCCATGCCACAAAAATATAGG - Intergenic
985548396 5:521187-521209 ACCCCAGTGCACACAAATAGGGG + Intronic
985786122 5:1895970-1895992 GTCCCTGGCCACACCACAAGGGG - Intergenic
986667240 5:10114364-10114386 CTCCCAGGAGACACCAAGAGGGG - Intergenic
986903133 5:12461678-12461700 ATCCCAGGCTATACGCATAGTGG + Intergenic
988019922 5:25609103-25609125 ATCTCAGGTCACCCCAAAAGTGG - Intergenic
989216668 5:38911376-38911398 ATCCCTGGACAGACCAATAGTGG + Intronic
993170052 5:84407477-84407499 AGCCCAGGCAAAACCAAAAGAGG + Intergenic
1003407854 6:5838310-5838332 AGCTCAGGCCACACCAAGAAAGG - Intergenic
1004184534 6:13410751-13410773 ATCCCAGGACAGACCAATATAGG + Intronic
1005463196 6:26088063-26088085 ACCCCAGGTCTCACCAAAAGTGG - Intronic
1006376501 6:33674317-33674339 AACCCAGACCAGACCAAGAGGGG - Intronic
1006709984 6:36060016-36060038 ATCCCAGGCTAAAACAACAGAGG - Intronic
1007210673 6:40191475-40191497 ATCCCAGGCAACCCCACTACTGG - Intergenic
1007918071 6:45579597-45579619 ATTCCAGTCCACAACATTAGAGG - Intronic
1013156977 6:107501660-107501682 ATCCCTAGGCACACAAATAGAGG - Intronic
1020327207 7:6984130-6984152 ATTCCAGGGAACACCAATAGGGG + Intergenic
1021249446 7:18306042-18306064 ATCCCAGGAAACTCCAATAGGGG + Intronic
1023267277 7:38420422-38420444 ATCCCATGCCACACCTATTTTGG + Intronic
1031177871 7:118375379-118375401 ATCCAAGGCCTCAGTAATAGTGG + Intergenic
1034405000 7:150897188-150897210 ATCCCTGGCCACACCCCTTGGGG + Intergenic
1034584397 7:152076387-152076409 ATCCCAGGACACACCAGTAGGGG + Intronic
1036369410 8:8149926-8149948 ATTCCAGGGGACACCAATAGGGG - Intergenic
1036881479 8:12515714-12515736 ATTCCAGGGGACACCAATAGGGG + Intergenic
1037312026 8:17566132-17566154 CTCCCAGACCACACAACTAGTGG + Exonic
1039829468 8:41201425-41201447 ATCCCAGGCAACAGCAATGTGGG - Intergenic
1047174938 8:122531433-122531455 ATCCCAGGAAACACCACGAGTGG + Intergenic
1048425293 8:134317930-134317952 CTCCCAGGCCCCATCATTAGGGG + Intergenic
1049223735 8:141439910-141439932 ATCCCAGGGCTCACCCAGAGAGG - Intergenic
1049291380 8:141804404-141804426 ATCCCAGAATACACAAATAGGGG + Intergenic
1049360810 8:142211797-142211819 GTCCCAGCCCCCACCAAGAGGGG - Intergenic
1052018716 9:23499970-23499992 TTCTCAGGCCACAGCATTAGGGG - Intergenic
1053069622 9:35093407-35093429 ATCCCAGGCCTCACCTCTGGTGG + Exonic
1058326089 9:103699720-103699742 TTCCCAGGCCACACCAAAAAGGG + Intergenic
1058544907 9:106050916-106050938 ATCCCAGGAAATTCCAATAGGGG - Intergenic
1059127522 9:111706420-111706442 ACCCCAGGTCACACAGATAGTGG + Intronic
1059465314 9:114465703-114465725 GTCCCAGGCCACACAACTGGTGG - Intronic
1062110325 9:134778701-134778723 GTCCCAGGCCTCTCCACTAGTGG + Intronic
1062577562 9:137215673-137215695 CTCCCAGGCCGCACCCAGAGGGG - Exonic
1186416457 X:9386998-9387020 ATCCCAGGAGACACCCATAAGGG - Intergenic
1186654763 X:11600778-11600800 TTCCCAGGAAACACCAGTAGGGG + Intronic
1187275583 X:17814082-17814104 ATCCCAGACAACACCAGTAGAGG + Intronic
1189263445 X:39694650-39694672 ATCCCAGGAAACACTGATAGGGG - Intergenic
1189322128 X:40093323-40093345 TTCCCAGGCCAGACCAATATGGG + Intronic
1190106676 X:47566225-47566247 ATAGCAGGCCACACAGATAGTGG - Intronic
1190932577 X:54961950-54961972 ATCTCAGGCCTCAGCTATAGTGG - Intronic
1192923355 X:75730917-75730939 ATCCCTGATCAGACCAATAGTGG - Intergenic
1198820964 X:140648310-140648332 ATCCAAGGTCACACAATTAGTGG - Intergenic
1199654218 X:149978832-149978854 AACCAAGGCCACATCAATGGAGG - Intergenic