ID: 1103027821

View in Genome Browser
Species Human (GRCh38)
Location 12:117587975-117587997
Sequence TAGAGCTGTAGCATTGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103027821_1103027830 23 Left 1103027821 12:117587975-117587997 CCAGGTCCAATGCTACAGCTCTA 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1103027830 12:117588021-117588043 CAAGGTCATTCTCCCAGCACAGG 0: 1
1: 0
2: 0
3: 21
4: 225
1103027821_1103027825 5 Left 1103027821 12:117587975-117587997 CCAGGTCCAATGCTACAGCTCTA 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1103027825 12:117588003-117588025 GACAAGACCATTCCTTCCCAAGG 0: 1
1: 0
2: 0
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103027821 Original CRISPR TAGAGCTGTAGCATTGGACC TGG (reversed) Intronic
904336484 1:29801542-29801564 TAGAGGTCTGGCATTGGTCCTGG - Intergenic
906237473 1:44220656-44220678 TAGAGCTGCTGAGTTGGACCAGG + Exonic
906822930 1:48948230-48948252 AAGAGCTGGAGCACTGGACCCGG - Intronic
912041094 1:105391744-105391766 TAGCCCTGTAGTATTGGAACAGG + Intergenic
912886559 1:113480498-113480520 TAGCTCTGTAGGAGTGGACCTGG + Intronic
913326537 1:117633077-117633099 AAGAGCTGGAGCTTTGGAGCTGG + Intergenic
915599545 1:156913702-156913724 TATAGCTGTAGCTTCGGTCCAGG - Exonic
916548904 1:165830980-165831002 TAGACCTGCAGCACTGCACCTGG - Intronic
919830023 1:201534085-201534107 TAGAGCTCTGGCTTTGGAGCAGG - Intergenic
920919719 1:210288551-210288573 TAGAGCTATAGCAGGGGAGCAGG + Intergenic
1063183124 10:3624477-3624499 AAGAGCTGTAGAATGGGAACAGG + Intergenic
1064460375 10:15529312-15529334 TAAAGCTCTAGCATTGTACCTGG - Intronic
1066391248 10:34978927-34978949 TAGAGATGTGGCATTGGGCTGGG - Intergenic
1072398115 10:95066687-95066709 CAGAGCTGTAGGCATGGACCTGG + Intronic
1073186530 10:101618547-101618569 TGGAGGTGTAACATGGGACCAGG + Intronic
1076253469 10:129001022-129001044 TAAAAATGTAGAATTGGACCGGG + Intergenic
1080964575 11:37199402-37199424 TTGAGCTGTAGGCTTGGAACTGG + Intergenic
1088394166 11:109348504-109348526 TAGTGCTGTAGCAATGGAGGTGG + Intergenic
1090942639 11:131401272-131401294 GAGAGCTGTAGCATTTGAGAAGG + Intronic
1092319130 12:7452953-7452975 TAGAGCTGTAGGATCTGGCCTGG - Intronic
1092663339 12:10764498-10764520 TGGATCTGTAGCAGTGGTCCTGG + Intergenic
1093480300 12:19597635-19597657 TAGAGGTGTTGCCTTGGGCCGGG - Intronic
1098694555 12:73536922-73536944 AGGAGCTGTAGCACTGGACAAGG + Intergenic
1099258576 12:80347056-80347078 TAAAGCTTTGTCATTGGACCAGG - Intronic
1100682175 12:96937313-96937335 TAGAACTGTGGCAATGGACGTGG - Exonic
1100935639 12:99661937-99661959 TGGAGCTGGAGCATTTGTCCTGG + Intronic
1101613751 12:106316138-106316160 TAGGGCTGTAGCAGTAGAGCTGG - Intronic
1102768129 12:115451064-115451086 GAGCTCTGTAGCTTTGGACCAGG - Intergenic
1103027821 12:117587975-117587997 TAGAGCTGTAGCATTGGACCTGG - Intronic
1103536555 12:121637589-121637611 TGGATCAGTAGCAGTGGACCTGG + Intronic
1106364399 13:29064153-29064175 TAGAGTGGTAGCATGGGAACTGG + Intronic
1115124045 14:29971536-29971558 TAGAGCCCTAGCCTGGGACCCGG + Intronic
1124207912 15:27738965-27738987 TAGAGCAGAGGCATTGGACAAGG - Intergenic
1124945876 15:34265301-34265323 TAGAGATATAGCAGTGGACATGG + Intronic
1130887049 15:88102150-88102172 TAATGCTGTTGCATAGGACCAGG - Intronic
1140528624 16:75645485-75645507 TAGAGATCTAGCATTGTGCCTGG + Intronic
1149451630 17:56754309-56754331 TAGATCTGTAGGATGGGACCTGG - Intergenic
1152105417 17:78325792-78325814 TAGAGCTTTGGCGTTGGAACAGG + Intergenic
1155826943 18:30457027-30457049 AAGAGCTCTAACATCGGACCGGG - Intergenic
1156986929 18:43360029-43360051 TAGAGCAGTAGCAAGGGAACTGG + Intergenic
1158840178 18:61377386-61377408 TAGAACTGAAACATTAGACCTGG + Intronic
1164332430 19:24272333-24272355 TGGAGCTGAGGCATTAGACCAGG + Intergenic
926069410 2:9873806-9873828 TGGAGCGGTAGCATTGCAGCTGG - Intronic
927449209 2:23192226-23192248 TAGAGCTGTGGCTTTGAAACAGG + Intergenic
928074523 2:28251005-28251027 CAGAGCTGTAGGATTGGGGCTGG + Intronic
934976129 2:98803839-98803861 CAGGGCTGTGGCAGTGGACCTGG - Intronic
940647304 2:156405118-156405140 TAGAGCTGTGGCCTTGGTTCAGG - Intergenic
943968898 2:194377234-194377256 TAAAGCTTTAACATTGTACCAGG - Intergenic
944477242 2:200119428-200119450 AAGAGCTGTAGCAATGGTTCTGG - Intergenic
946216610 2:218188629-218188651 TAGATGTGTGGCATTGGAACAGG - Intergenic
948502005 2:238402276-238402298 TAAAGCTGTAGAACTTGACCGGG + Intergenic
949357330 3:3195684-3195706 TAAAACTGTAGCATTTGACAGGG + Intergenic
951455442 3:22886916-22886938 AAGAGCAGTAGCTTTGGAGCAGG - Intergenic
959525546 3:107372520-107372542 CAGAGCTGTTGCACTGGACCAGG - Intergenic
961818594 3:129563951-129563973 CAGACCTGGAGAATTGGACCAGG - Intronic
963341150 3:144035322-144035344 TAGAGCTGAAGAAATGCACCAGG - Intronic
966108815 3:176371517-176371539 TAGAGCTGTATTACTGGTCCTGG + Intergenic
969448332 4:7257976-7257998 GAGAGCTGTAGCCATGGGCCAGG - Intronic
969493986 4:7515459-7515481 CAGAGCTGTAGCCTTGGCCCTGG + Intronic
971299607 4:25430900-25430922 TAGAGCAGTAGCCTTAGAGCGGG - Intergenic
973211509 4:47620394-47620416 TAGAGCTGCATCAGTTGACCTGG + Intronic
990671811 5:58139797-58139819 TAGAGCTGTATGATTGGAGATGG + Intergenic
996682005 5:126237987-126238009 TAGAGCAGTAAGAATGGACCAGG + Intergenic
997027202 5:130078879-130078901 TAGACATGTAGCAATGGATCCGG - Intronic
999187544 5:149723531-149723553 TGGACCTGTAGCATGGTACCTGG + Intergenic
999236830 5:150103657-150103679 CAGAGCAGTGGCATTGGAGCTGG + Intronic
1000125179 5:158236994-158237016 TAGGGCTGTAGCAATGGGCATGG - Intergenic
1002454581 5:179338877-179338899 GAGAGCTCTAGAATTGGAGCTGG + Intronic
1002989538 6:2225493-2225515 GAGAGCTGTGGCATAGGAGCAGG - Intronic
1003833533 6:10041542-10041564 TAGAACTGTAGAATTGGAAGTGG - Intronic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1016526211 6:145004372-145004394 GAGAGCTGGAGCAGTGGATCTGG + Intergenic
1020021503 7:4872174-4872196 GAGAGCTGCAGTATTGGACCTGG - Intronic
1023327427 7:39075247-39075269 TTGGGCTGTGACATTGGACCGGG - Intronic
1029566283 7:101340401-101340423 GAGAGCTGTAGTATTGGAGGGGG + Intergenic
1030789834 7:113710197-113710219 TAGAATTGTAGCATTGGAAAAGG + Intergenic
1031375038 7:121014255-121014277 TAAAGATGTAGAATTGGGCCGGG + Intronic
1033340933 7:140491729-140491751 TAGAGCTTTCTCAATGGACCTGG + Intergenic
1033446799 7:141430383-141430405 TATAGCTCTAGCATTGCGCCAGG + Intronic
1034211973 7:149371883-149371905 TAGAGATGTAGACTTGGGCCAGG + Intergenic
1039117769 8:34111839-34111861 CAGAGCTGTCTCATTGCACCTGG + Intergenic
1041410606 8:57550120-57550142 TAGAGCTGCGGCCTTGTACCTGG + Intergenic
1042784667 8:72535209-72535231 CAGAGCTGGAGCTTGGGACCAGG + Intergenic
1046544921 8:115637940-115637962 TATACCTGTAGCATTTTACCAGG + Intronic
1047292537 8:123541980-123542002 TTGTACTGTAGCATTGGCCCTGG - Intergenic
1048148500 8:131869114-131869136 CAGTGCTGTACCATTGGCCCTGG + Intergenic
1049571085 8:143370630-143370652 TCCAGCTGTAGCACTGGCCCTGG - Intronic
1053523366 9:38804666-38804688 GAGAGCTGTAGCAGTTGGCCTGG + Intergenic
1057910464 9:99016130-99016152 TAGAGCTGTAAGATTTGACTTGG + Intronic
1187371777 X:18715075-18715097 TAGAGAAGTAGCATCGGGCCAGG + Intronic
1189466592 X:41282128-41282150 TAGAGGTGCAGGATTGGACCGGG - Intergenic
1192222080 X:69204100-69204122 TGGAGCAGTAGCTCTGGACCAGG + Intergenic
1192905179 X:75543891-75543913 TACTACTGTAGCACTGGACCAGG - Intergenic
1198752940 X:139953478-139953500 TACACCTGGAGCAATGGACCAGG + Intergenic