ID: 1103028474

View in Genome Browser
Species Human (GRCh38)
Location 12:117593144-117593166
Sequence AGACAGTCCTGTATCTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103028474_1103028481 26 Left 1103028474 12:117593144-117593166 CCCACATAGATACAGGACTGTCT 0: 1
1: 0
2: 1
3: 12
4: 120
Right 1103028481 12:117593193-117593215 CAAAGCTGGCTTCCCCTGCCTGG 0: 1
1: 0
2: 0
3: 23
4: 234
1103028474_1103028476 -9 Left 1103028474 12:117593144-117593166 CCCACATAGATACAGGACTGTCT 0: 1
1: 0
2: 1
3: 12
4: 120
Right 1103028476 12:117593158-117593180 GGACTGTCTCCTTGACCCAAAGG 0: 1
1: 0
2: 1
3: 12
4: 125
1103028474_1103028480 12 Left 1103028474 12:117593144-117593166 CCCACATAGATACAGGACTGTCT 0: 1
1: 0
2: 1
3: 12
4: 120
Right 1103028480 12:117593179-117593201 GGAAAATGCTAATTCAAAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103028474 Original CRISPR AGACAGTCCTGTATCTATGT GGG (reversed) Intronic
904816314 1:33203093-33203115 ATACAGTGTTGTAGCTATGTAGG - Intergenic
909980871 1:82099143-82099165 AAACATTCCTGTATGTATTTAGG + Intergenic
911614783 1:99997861-99997883 AGACCTTCCAGTATCTAGGTTGG - Intronic
912313441 1:108645826-108645848 AGAAAGGCCTGTATCCAGGTTGG + Intergenic
915098155 1:153478652-153478674 AGAAAGTGCTATATCAATGTAGG + Intergenic
919514063 1:198499779-198499801 AGACATTCCTGTGGCTATGTAGG - Intergenic
922755625 1:228095262-228095284 AGACAGGCCTGTCTCTTGGTGGG + Intronic
924073623 1:240309401-240309423 AGAGTGTACAGTATCTATGTAGG + Intronic
924496703 1:244597128-244597150 AGAAAGACCTGTATATTTGTAGG - Intronic
924822342 1:247505304-247505326 AGACAGCCCTGTATCCAGGTGGG + Intergenic
1063095634 10:2906254-2906276 AAAAAGTCCTGTATCTAGGTGGG + Intergenic
1066587533 10:36952880-36952902 AGATAATCATGTATTTATGTAGG - Intergenic
1068446345 10:57129113-57129135 AGACAGTATTGAATATATGTGGG + Intergenic
1069744995 10:70709361-70709383 CGAGAGTCCTGTATCTCTGCAGG - Intronic
1074436372 10:113437762-113437784 AGAAAGTGCTGTATAAATGTTGG + Intergenic
1075084485 10:119405337-119405359 AGGCAGCCCTGCATCTATGGAGG - Intronic
1076602309 10:131666451-131666473 TGAGAGTTCTTTATCTATGTTGG - Intergenic
1078804311 11:14681622-14681644 AGACAGTCCTCAACCTATGATGG - Intronic
1079983749 11:27178683-27178705 ACACAATCCTGTATGTATATGGG + Intergenic
1082727032 11:56748433-56748455 ACTCAGTCTTGTATCTATGCTGG - Intergenic
1082829719 11:57606870-57606892 AGCAAGTCCTGTGTGTATGTGGG + Intronic
1084756044 11:71239412-71239434 AGAGTGACCTGTATCTTTGTAGG - Intronic
1084779748 11:71400340-71400362 AGCCAGTCCTGATTCCATGTAGG - Intergenic
1085900573 11:80695081-80695103 AGATAATCATGTATTTATGTAGG + Intergenic
1086508730 11:87532240-87532262 AGAAAGTCTTATACCTATGTGGG - Intergenic
1088142448 11:106633710-106633732 AGACAGGTCTCTTTCTATGTTGG - Intergenic
1089187189 11:116627073-116627095 AAACAGACCTGTGTATATGTAGG + Intergenic
1089624993 11:119745603-119745625 AGACAGTCTGGTTTCTGTGTTGG + Intergenic
1101975266 12:109352451-109352473 ATACATTCATGTATGTATGTGGG - Intronic
1103028474 12:117593144-117593166 AGACAGTCCTGTATCTATGTGGG - Intronic
1104324490 12:127783573-127783595 AGACAATCTTCTATGTATGTAGG + Intergenic
1106363294 13:29052027-29052049 TGACAGTGCTGTGTCTATTTGGG - Intronic
1106521685 13:30503956-30503978 ATACATTTCTGTATGTATGTAGG - Intronic
1106855927 13:33852860-33852882 ACACAGTCCTTTAGCTGTGTTGG + Intronic
1107360955 13:39617422-39617444 TAATAGTCCTGTATCAATGTTGG + Intergenic
1115872150 14:37816620-37816642 AAAGAGTCCTGAATCTATGAAGG - Intronic
1118502548 14:66375866-66375888 AGACAGTCCTGTATTCAGTTGGG - Intergenic
1119806342 14:77484811-77484833 TGACAGTCCAGCATCCATGTTGG + Exonic
1127923162 15:63510444-63510466 ACACAAACCTGTATGTATGTAGG - Intronic
1128896186 15:71376218-71376240 AGCCAATCCTGAATGTATGTAGG + Intronic
1129467223 15:75730964-75730986 AGACAGGCCTGGCTCCATGTTGG + Intergenic
1129720003 15:77872755-77872777 AGACAGGCCTGGCTCCATGTTGG - Intergenic
1138879527 16:60994172-60994194 AGACGTTCTTGTATCAATGTGGG + Intergenic
1144033505 17:11342809-11342831 AGACAGTCCTGTTGTGATGTTGG + Intronic
1147534035 17:41306776-41306798 AGACAGTGATCTGTCTATGTGGG - Intergenic
1148445960 17:47737286-47737308 AGAGAGGCCTGTGTCTCTGTGGG + Intronic
1149570073 17:57665947-57665969 AGGCAGTCCTGTATCTCTTGGGG + Intronic
1152111115 17:78358303-78358325 AGAGAGTCCTGTAGCTCTGGGGG - Exonic
1155894322 18:31304624-31304646 TGACAGGCCTGCATCTATGCTGG - Intergenic
1158027862 18:52923698-52923720 ATGCAGTCCTGGATCTATGAGGG - Exonic
1159812534 18:73033459-73033481 AGACAGTTGAGTATTTATGTGGG - Intergenic
1159912844 18:74162697-74162719 AGACAGTCGTATATCCATGTGGG + Intergenic
1164398757 19:27888467-27888489 ACACACTCCTAAATCTATGTGGG + Intergenic
1164876015 19:31689825-31689847 AGAGAGTCCTGCATCAATGTAGG - Intergenic
1166497035 19:43310941-43310963 AGACAGGCCTGTATCCTTTTGGG + Intergenic
1167376817 19:49116749-49116771 AAACCTTCCTGTATCTATGCTGG - Intronic
931082688 2:58792953-58792975 AGACAGAACTGTATCTATATGGG - Intergenic
931329590 2:61266866-61266888 AGAGAGTTTTGTATCAATGTAGG - Intronic
932248697 2:70220733-70220755 AAACAGAGATGTATCTATGTTGG + Intronic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
939684265 2:145178391-145178413 AGACAGTCCCATATGTATGATGG - Intergenic
943618928 2:190125627-190125649 AAACAGTCCGGGATCTTTGTTGG + Intronic
944381332 2:199114120-199114142 AGAGATTACTGTATATATGTGGG + Intergenic
945895337 2:215474754-215474776 AGATAGAGGTGTATCTATGTTGG - Intergenic
948615406 2:239195335-239195357 AGACAATGCTGCATTTATGTTGG + Intronic
1169578332 20:6991097-6991119 TGACAGACCTGGATATATGTGGG + Intergenic
1169876852 20:10307716-10307738 AGATATACCTGAATCTATGTAGG - Intergenic
1170475518 20:16710402-16710424 AGAAATTCCTGTATTTTTGTTGG - Intergenic
1171098015 20:22350861-22350883 AGAAAGTCCTGTATCCAAGTCGG + Intergenic
1179555651 21:42173973-42173995 AGCCAGTTCTGTTTCTATTTTGG + Intergenic
1180761540 22:18213034-18213056 ACAAAATCCTGTATCTATTTAGG + Intergenic
1180774127 22:18411576-18411598 ACAAAATCCTGTATCTATTTAGG - Intergenic
1181070237 22:20330580-20330602 ACAAAATCCTGTATCTATTTAGG - Intergenic
1181193230 22:21158526-21158548 ACAAAATCCTGTATCTATTTAGG - Intergenic
1181216215 22:21334075-21334097 ACAAAATCCTGTATCTATTTAGG + Intergenic
955864372 3:63367283-63367305 AGAATGTACTGTATTTATGTAGG - Intronic
960497851 3:118396761-118396783 AGAGAGTCCTTTATCTATTTGGG - Intergenic
960687717 3:120311103-120311125 AGTCAGATATGTATCTATGTCGG + Intergenic
966742532 3:183247597-183247619 AGTCAGTCCTCCATCTCTGTAGG + Intronic
967645806 3:191922369-191922391 GGAGAGTCCTGTATCTATTATGG + Intergenic
970803278 4:20002042-20002064 AGACAGCCCTGTAACTAGGGTGG + Intergenic
971645891 4:29202320-29202342 AGATAATCCTGTATGTATTTGGG + Intergenic
972840957 4:42929547-42929569 AGAAACTCCTGTATTTATTTGGG + Intronic
973206649 4:47568661-47568683 AGAGAGTTCTGTGTGTATGTGGG - Intronic
973325998 4:48862777-48862799 AAATAGTCCTTTTTCTATGTTGG + Intergenic
975243994 4:72096889-72096911 AGACAGTCCTCAATTTATGATGG - Intronic
975721524 4:77253175-77253197 AGGCACTCCTGTAACTATGGAGG + Intronic
976274547 4:83262978-83263000 AGACAGTCATTTGTATATGTGGG - Intronic
977286014 4:95107928-95107950 AGAAAGTCCTGGATTTATATAGG - Intronic
977296454 4:95215011-95215033 AGACAGGCTAGTATTTATGTAGG + Intronic
978064135 4:104375194-104375216 AGAAAGTCATGTAGCTATTTGGG + Intergenic
983344643 4:166511385-166511407 AAACATTCTTGTATATATGTAGG + Intergenic
989922841 5:49830305-49830327 AGATATTACTGTATCTATGAAGG - Intergenic
989936246 5:50029095-50029117 AGATATTACTGTATCTATGAAGG - Intergenic
992027404 5:72684083-72684105 ACACAGTACTGTATGTATGTAGG + Intergenic
996523984 5:124457876-124457898 AGACACTCGTGTATATTTGTTGG + Intergenic
997156816 5:131570202-131570224 AGACATTCCTGTATCTTCTTTGG - Intronic
997728622 5:136145416-136145438 AGACAGTCCTGGAGCAGTGTCGG + Intronic
999706452 5:154276924-154276946 AAACAGTTCTGTTTCTATTTTGG + Intronic
1000010389 5:157225779-157225801 AGACAGTCTTGAACCTATTTCGG - Intronic
1000365107 5:160483330-160483352 AGACAGACCTGAATCCATTTAGG - Intergenic
1001777697 5:174341248-174341270 AGACACTCCTGCCTCTGTGTTGG - Intergenic
1002469012 5:179423608-179423630 TCACTGTCCTGTATCCATGTGGG - Intergenic
1003082670 6:3034365-3034387 AGACAATCCTGAATCTAGGGTGG + Intergenic
1003659083 6:8043680-8043702 TGACAGTAATGTATCAATGTTGG + Intronic
1004398245 6:15265454-15265476 TGACAGTCCTATACCTATTTGGG - Intronic
1006710494 6:36065038-36065060 AGACAGTCATGTAGGTATGTGGG - Intronic
1012218408 6:96617253-96617275 AGACAGTTATATATCTATGTGGG - Intergenic
1018173171 6:161157823-161157845 AGACAGTCCTGTTTCTAACCAGG + Intronic
1019190796 6:170249475-170249497 AATCCATCCTGTATCTATGTGGG - Intergenic
1020274689 7:6616942-6616964 AGGCAGTCCTGCCTCTATGCAGG + Intronic
1020916782 7:14204403-14204425 ACACATTTCTGTGTCTATGTGGG + Intronic
1022783487 7:33610985-33611007 AGTCAGTCTTGTATCTCAGTTGG + Intergenic
1026955444 7:74373690-74373712 GGAATGTCCTGTCTCTATGTAGG + Intronic
1028243498 7:88449078-88449100 AGACACTTAGGTATCTATGTAGG + Intergenic
1035935857 8:3837656-3837678 AGACATCCCTGTGCCTATGTAGG - Intronic
1037518785 8:19660165-19660187 AGAATGCCCTGTATCGATGTGGG - Intronic
1037675290 8:21045767-21045789 GGACAGTCCTGAATCTAAGTTGG + Intergenic
1040488968 8:47901722-47901744 TGCCAGACCTGTGTCTATGTTGG - Intronic
1040641059 8:49334712-49334734 GGAAAGTGCTGTATTTATGTAGG - Intergenic
1042498878 8:69487473-69487495 AGCGAGTACTGTATGTATGTTGG + Intronic
1043007687 8:74840710-74840732 GGTCAGTCCTGTCTCCATGTGGG + Intronic
1043481477 8:80657088-80657110 CAACAGTCCTGCATCTGTGTGGG + Intronic
1045785076 8:105911605-105911627 AGACAATACTGTTTCTATGGAGG - Intergenic
1058189425 9:101894567-101894589 AGACAGTCCTCAACTTATGTGGG + Intergenic
1060866940 9:127008007-127008029 AGACATTCCTGCATCTATGTGGG - Intronic
1062138109 9:134940322-134940344 AGAGAGTCCTATTTCAATGTGGG - Intergenic
1187209723 X:17217516-17217538 AGGCAGCCCTGGATCTATGGTGG - Intergenic
1187585143 X:20652195-20652217 AATCAGTTTTGTATCTATGTTGG - Intergenic
1191951356 X:66597329-66597351 AGACAGCCCTCAATCCATGTAGG - Exonic
1193581031 X:83262749-83262771 AGCCAGTCCTGTCTCTCAGTCGG + Intergenic
1193730525 X:85097153-85097175 AGTCAGTCCTCTGTATATGTGGG - Intronic
1195929701 X:110062549-110062571 AGACTGTCTTCTATCAATGTGGG + Intronic
1199685781 X:150263951-150263973 AGACAGGCCCCTTTCTATGTTGG - Intergenic