ID: 1103031628 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:117619056-117619078 |
| Sequence | TTGAAGGTGGGAGTTATCTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 199 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 17, 4: 180} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1103031628_1103031631 | -10 | Left | 1103031628 | 12:117619056-117619078 | CCAAAGATAACTCCCACCTTCAA | 0: 1 1: 0 2: 1 3: 17 4: 180 |
||
| Right | 1103031631 | 12:117619069-117619091 | CCACCTTCAAGAAACCTTCTAGG | 0: 1 1: 0 2: 3 3: 31 4: 204 |
||||
| 1103031628_1103031636 | 29 | Left | 1103031628 | 12:117619056-117619078 | CCAAAGATAACTCCCACCTTCAA | 0: 1 1: 0 2: 1 3: 17 4: 180 |
||
| Right | 1103031636 | 12:117619108-117619130 | TACAATGCTGTCTGCTAGATGGG | 0: 1 1: 0 2: 0 3: 7 4: 88 |
||||
| 1103031628_1103031635 | 28 | Left | 1103031628 | 12:117619056-117619078 | CCAAAGATAACTCCCACCTTCAA | 0: 1 1: 0 2: 1 3: 17 4: 180 |
||
| Right | 1103031635 | 12:117619107-117619129 | CTACAATGCTGTCTGCTAGATGG | 0: 1 1: 0 2: 1 3: 7 4: 115 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1103031628 | Original CRISPR | TTGAAGGTGGGAGTTATCTT TGG (reversed) | Intronic | ||