ID: 1103031632

View in Genome Browser
Species Human (GRCh38)
Location 12:117619072-117619094
Sequence TCTCCTAGAAGGTTTCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103031632_1103031638 29 Left 1103031632 12:117619072-117619094 CCTTCAAGAAACCTTCTAGGAGA 0: 1
1: 0
2: 1
3: 19
4: 147
Right 1103031638 12:117619124-117619146 AGATGGGCAGGCTACCAACCTGG 0: 1
1: 0
2: 2
3: 6
4: 79
1103031632_1103031636 13 Left 1103031632 12:117619072-117619094 CCTTCAAGAAACCTTCTAGGAGA 0: 1
1: 0
2: 1
3: 19
4: 147
Right 1103031636 12:117619108-117619130 TACAATGCTGTCTGCTAGATGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1103031632_1103031637 17 Left 1103031632 12:117619072-117619094 CCTTCAAGAAACCTTCTAGGAGA 0: 1
1: 0
2: 1
3: 19
4: 147
Right 1103031637 12:117619112-117619134 ATGCTGTCTGCTAGATGGGCAGG 0: 1
1: 0
2: 2
3: 5
4: 103
1103031632_1103031635 12 Left 1103031632 12:117619072-117619094 CCTTCAAGAAACCTTCTAGGAGA 0: 1
1: 0
2: 1
3: 19
4: 147
Right 1103031635 12:117619107-117619129 CTACAATGCTGTCTGCTAGATGG 0: 1
1: 0
2: 1
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103031632 Original CRISPR TCTCCTAGAAGGTTTCTTGA AGG (reversed) Intronic