ID: 1103031632

View in Genome Browser
Species Human (GRCh38)
Location 12:117619072-117619094
Sequence TCTCCTAGAAGGTTTCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103031632_1103031635 12 Left 1103031632 12:117619072-117619094 CCTTCAAGAAACCTTCTAGGAGA 0: 1
1: 0
2: 1
3: 19
4: 147
Right 1103031635 12:117619107-117619129 CTACAATGCTGTCTGCTAGATGG 0: 1
1: 0
2: 1
3: 7
4: 115
1103031632_1103031636 13 Left 1103031632 12:117619072-117619094 CCTTCAAGAAACCTTCTAGGAGA 0: 1
1: 0
2: 1
3: 19
4: 147
Right 1103031636 12:117619108-117619130 TACAATGCTGTCTGCTAGATGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1103031632_1103031638 29 Left 1103031632 12:117619072-117619094 CCTTCAAGAAACCTTCTAGGAGA 0: 1
1: 0
2: 1
3: 19
4: 147
Right 1103031638 12:117619124-117619146 AGATGGGCAGGCTACCAACCTGG 0: 1
1: 0
2: 2
3: 6
4: 79
1103031632_1103031637 17 Left 1103031632 12:117619072-117619094 CCTTCAAGAAACCTTCTAGGAGA 0: 1
1: 0
2: 1
3: 19
4: 147
Right 1103031637 12:117619112-117619134 ATGCTGTCTGCTAGATGGGCAGG 0: 1
1: 0
2: 2
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103031632 Original CRISPR TCTCCTAGAAGGTTTCTTGA AGG (reversed) Intronic
901240762 1:7691925-7691947 TCTCGATGAAGGTTTCTTCAAGG + Intronic
902609757 1:17590050-17590072 TCTCCAAGAGGGTAGCTTGAAGG - Intronic
903290874 1:22313496-22313518 TCTCCTAGAGGGACTCTTGCTGG + Intergenic
906812991 1:48848420-48848442 TCTCCTTAAAGGTTATTTGAAGG + Intronic
907099319 1:51813744-51813766 TCTCCATGAATGTTTATTGAAGG + Intronic
911186950 1:94913899-94913921 TCTCCAACAAGCTTTCTTGGAGG - Intronic
912539635 1:110404381-110404403 GAGCCTTGAAGGTTTCTTGAAGG + Intronic
915258912 1:154660975-154660997 TGGCCTGGAAGGTTTCCTGAAGG - Intergenic
915262351 1:154686179-154686201 TCTCCAAGAAGGTTACTAGCTGG + Intergenic
915700924 1:157795913-157795935 TCTCCTAGGTAGTTTCTTCAGGG + Exonic
920422664 1:205845671-205845693 TGTCCTAGAAGGCTTCCTAAAGG - Intronic
920541401 1:206781132-206781154 TCTTTTATAAGGTTTCTGGAAGG - Intergenic
921691690 1:218158344-218158366 TCTCCAACAACGTTTCTTGAGGG + Intergenic
922148647 1:222976522-222976544 TTTCCTAGGAGGTTTCTTTGTGG + Intronic
922915639 1:229255325-229255347 ACCCCTAGACTGTTTCTTGAAGG - Intergenic
923706309 1:236347662-236347684 TCTCCCAGAAGGTAACTTAAGGG + Intergenic
1068466910 10:57405790-57405812 TCTCCAAACAGGTTTCTGGAAGG + Intergenic
1070399022 10:76036555-76036577 TCTCCTGGGAGGTTTCTGGAAGG + Intronic
1081684282 11:45030600-45030622 TCACCTAGAGGGCTTGTTGAAGG - Intergenic
1081716069 11:45251564-45251586 TCACCCAGAAGGTTTCCTCAAGG + Intronic
1083476070 11:62916500-62916522 TCTCCTAGAGGGGTCCTTGGAGG + Intronic
1084070553 11:66730786-66730808 TATCTTACAAGGCTTCTTGAAGG - Intergenic
1084228143 11:67730393-67730415 TCTCCTGGAAGGATTAATGAGGG - Intergenic
1084352521 11:68612692-68612714 TCACATAAAAGCTTTCTTGAAGG + Intronic
1084675214 11:70630121-70630143 TATGCTAGAAGGTTCCCTGATGG + Intronic
1084847021 11:71908939-71908961 TCTCCTGGAAGGATTAATGAGGG + Intronic
1087925519 11:103914227-103914249 TGCCCTAGAAGGTTTGCTGAGGG - Intronic
1088287293 11:108201900-108201922 TCTCTAAGGAGGTTTCTTCAAGG - Intronic
1089935769 11:122362621-122362643 CCACTTAGAATGTTTCTTGAAGG + Intergenic
1090231512 11:125110224-125110246 TCTCAAAGAAGGTTTAATGATGG - Intronic
1093529947 12:20148850-20148872 TCTCCTAAAATGTTTCTATATGG + Intergenic
1098567786 12:71955298-71955320 TCTCCTGGGAGGTTTTTTTAAGG + Intronic
1099096949 12:78386195-78386217 TCTTCTGGAAGGTTGTTTGATGG + Intergenic
1099368236 12:81796734-81796756 TCTACTAAAACCTTTCTTGAGGG + Intergenic
1100132466 12:91513150-91513172 TCCCCGATCAGGTTTCTTGAAGG + Intergenic
1103031632 12:117619072-117619094 TCTCCTAGAAGGTTTCTTGAAGG - Intronic
1107030991 13:35853699-35853721 GCTCCTAGGAGGTTTCATGATGG - Intronic
1107439736 13:40415257-40415279 TCTCCTAGAATGTCTCAGGATGG + Intergenic
1111861763 13:93716302-93716324 TCTCCTAGAAGACCTCCTGAAGG - Intronic
1115373189 14:32642728-32642750 TCTCAAATAAGGTTTCTTGAGGG - Intronic
1115782434 14:36784640-36784662 TCTCCTAGAAGTTGTCTGGTTGG - Intronic
1116520999 14:45847060-45847082 TCACTTTGAAGGTTTCTTAAGGG - Intergenic
1121790465 14:96695751-96695773 TCTCCCAGGATGTTTCTTAAAGG + Intergenic
1122219591 14:100228098-100228120 TCCCCTAGGTGGTTTCTAGAAGG + Intergenic
1125420134 15:39496987-39497009 TCTCCTCCAAGGTTTCTCAAAGG + Intergenic
1126214949 15:46144019-46144041 TTTCCTAGCCTGTTTCTTGAGGG + Intergenic
1127567920 15:60211560-60211582 TATTCTGGAAGGTTTCTTGAGGG - Intergenic
1128702497 15:69814434-69814456 GATCCTGGAAGGTTTCTTGCAGG - Intergenic
1129512109 15:76132043-76132065 TCTCCCAGAAGACTTCTAGATGG + Intronic
1130709251 15:86263591-86263613 TGTCCTAGATGGCTTTTTGAAGG + Intronic
1137858834 16:51825481-51825503 TTGCTTAGAAGGCTTCTTGAAGG - Intergenic
1138183103 16:54956375-54956397 TCCCTGGGAAGGTTTCTTGAAGG - Intergenic
1139922433 16:70468655-70468677 TGTCCCAGAAGGTGTCTTGGTGG + Intronic
1146653567 17:34622008-34622030 GCTACTGGAAGGTTCCTTGAAGG - Intronic
1147250650 17:39151111-39151133 TCTCCTGGAAGGATACTGGAGGG - Intronic
1147285510 17:39400521-39400543 TATACTGGAAGGTTCCTTGAGGG - Intronic
1148084104 17:44984064-44984086 AGTCCCAGAAGGTTTCTTGGGGG - Intergenic
1148719312 17:49739493-49739515 TCACCTAGAAGATTTCTTAGGGG - Intronic
1148765513 17:50036428-50036450 CCTCCTAGAAGACTTCCTGAGGG + Intergenic
1153082531 18:1244840-1244862 TTTCCTAGGAAGCTTCTTGAGGG + Intergenic
1159069921 18:63612246-63612268 TCTGCTAAAAGGTTTCTTAAAGG + Intergenic
1163053093 19:14699724-14699746 TTTTCTAGAAGGTTTCCTGAAGG + Intronic
929432849 2:41903132-41903154 TCTCCTAGAAGCTTCCTAGAAGG + Intergenic
930694701 2:54399718-54399740 TCACACAGAAGGTTTCTTGAGGG - Intergenic
931177081 2:59865057-59865079 TCTTCTGGAAGGGTACTTGATGG - Intergenic
932771971 2:74505521-74505543 TCCCACAGTAGGTTTCTTGAGGG - Intronic
933278992 2:80311540-80311562 ACTCCCAGAAGGAATCTTGAAGG - Intronic
935677590 2:105609330-105609352 TCTTCTAAAGGGTATCTTGAAGG - Intergenic
936754249 2:115686669-115686691 TCTCCTAATACTTTTCTTGATGG + Intronic
939516395 2:143173880-143173902 TATCCTATAACGTTTCTTGTGGG - Intronic
940081510 2:149808193-149808215 TCTCCTTTAAGTTTTCCTGATGG + Intergenic
941048634 2:160705380-160705402 GCTACTAGGAGGTTTCTTGAGGG + Intergenic
942570276 2:177307147-177307169 GCTCCAAGAAGGTTTCTCAAAGG - Intronic
943903492 2:193470728-193470750 TCTCCTAAAAGGCTTATTGTGGG + Intergenic
945570290 2:211458594-211458616 TCTCAGAAAAGGTTTTTTGAAGG - Intronic
1168734327 20:116777-116799 TCTACCAGCAGGTTTTTTGATGG - Intergenic
1169808229 20:9581169-9581191 TCTCCTACATGGCTTTTTGATGG - Intronic
1170917710 20:20643980-20644002 TCTGCTAGAGGATTTATTGATGG - Intronic
1172146376 20:32761331-32761353 TCTCCCAGAAGGTCACTTTATGG - Intergenic
1173445620 20:43115389-43115411 TCCCAGAGAACGTTTCTTGATGG - Intronic
1178606676 21:34043117-34043139 TCACATACAAGGTTTCTTGTGGG - Intergenic
1182416690 22:30225852-30225874 TCTTCTAGGTGGTTTCTGGAGGG + Intergenic
949397977 3:3635367-3635389 TCTCATGGAAGGCTTCCTGAAGG + Intergenic
952269045 3:31814637-31814659 TCTCCTTCAAGGTTTCTGGAAGG + Intronic
952693144 3:36233623-36233645 TCTCCCAGAGGAGTTCTTGATGG - Intergenic
954655171 3:52190241-52190263 TCTCCTTGGAGGTTCCTAGAAGG - Intergenic
955336471 3:58090309-58090331 TCTTCTAGAATATTTCCTGAAGG + Intronic
955517805 3:59745361-59745383 TCTCATAGAATGTTTCTAAAAGG + Intergenic
955597043 3:60602491-60602513 TCTCCAAGAAGGTTTCATGAAGG - Intronic
955805411 3:62728917-62728939 TCACCCAGCAGGTTTTTTGAGGG - Intronic
956010865 3:64830104-64830126 TAGCCCAAAAGGTTTCTTGAAGG + Intergenic
957383498 3:79465795-79465817 ACTCCTGGAATGTTTCTTAATGG + Intronic
958448802 3:94247689-94247711 TCTGCTAGAAGGGTATTTGAGGG + Intergenic
959036586 3:101373303-101373325 TCTTCAAGAATGATTCTTGAGGG - Intronic
960481562 3:118197642-118197664 TCTTCTAGAATGTTTCTAGAAGG - Intergenic
960818326 3:121697813-121697835 TCTCCTCGATGGTTTGTTGGAGG + Exonic
960956490 3:123035167-123035189 TGTCCAGGAAGGCTTCTTGAAGG + Intergenic
961431811 3:126889111-126889133 GGTCCTTGGAGGTTTCTTGAAGG + Intronic
966594563 3:181713525-181713547 TCTCATAAAAGTTTTCTTGTCGG - Exonic
966642445 3:182205752-182205774 TCTCCCAGATGGCTTCTTCAGGG - Intergenic
967861782 3:194157625-194157647 TTTGCTAGAAGTTTTCTTGTGGG - Intergenic
968407066 4:350069-350091 TCTCCCTGCAGGTCTCTTGATGG + Intronic
968989095 4:3896698-3896720 TCTCTTGGAAGGATTCATGAGGG - Intergenic
970929180 4:21489053-21489075 TATCTCAGAAGGCTTCTTGAGGG - Intronic
972648239 4:40990589-40990611 ACTTCCAGAAGGCTTCTTGATGG + Intronic
973319579 4:48796177-48796199 GCTCCTAGGAAGTTTCTTAAAGG + Intergenic
973912852 4:55600632-55600654 TCTCCTTGAAAGTATATTGAGGG + Intronic
973928600 4:55765730-55765752 TCTCCTATTTGGTATCTTGATGG + Intergenic
973985670 4:56350025-56350047 TCTCCCAGAAGATCTTTTGAGGG - Exonic
975190318 4:71452800-71452822 TCTCCAAGAAGGTGACTTTAGGG - Intronic
975442600 4:74429117-74429139 TTTCCTGGAAGGCTTCTTGAAGG - Intergenic
977383303 4:96305139-96305161 TCTGCTAAAGGGTTTCTTGTTGG + Intergenic
978710034 4:111769156-111769178 TGTCTTAGAAGATTTCCTGAAGG - Intergenic
980542661 4:134214531-134214553 TCAAATAGAATGTTTCTTGAGGG - Intergenic
981056291 4:140365500-140365522 TCTCTTAGAATGTTTCTATATGG - Intronic
987725025 5:21687150-21687172 TCTTCTAGAATGTTTACTGAAGG - Intergenic
988095717 5:26606777-26606799 TCTCCTACTAGGAATCTTGAGGG + Intergenic
989266314 5:39478237-39478259 TCTCATAGCAGGATTCTTGATGG + Intergenic
990953072 5:61317817-61317839 TCTCTTAGACACTTTCTTGAGGG + Intergenic
991022057 5:61989671-61989693 TCTCCTGGAAAGTTTCTTCCTGG + Intergenic
991432484 5:66562725-66562747 TCTCCTAGATGGGTTTTTCAAGG - Intergenic
991480019 5:67068092-67068114 TCTTCTAGAAGGCATCTTCAGGG - Intronic
992941876 5:81770653-81770675 TTTCCTTGAAACTTTCTTGAGGG - Intergenic
997086308 5:130804207-130804229 TCTCCTAGAATGTATCTGGATGG + Intergenic
998504093 5:142658029-142658051 TGTCCTGGAAGATTTCTTGGAGG - Intronic
998508119 5:142688621-142688643 TCTCCTACAAGGTTTTATCAGGG - Intronic
1001102503 5:168825712-168825734 TCTTCTGGAAGCTTTCTGGATGG - Intronic
1003238073 6:4316504-4316526 TTTGCCAGAAGGTTTCTGGATGG + Intergenic
1005264858 6:24101140-24101162 TCTCCTAGAGAGCTTCTTAAAGG + Intergenic
1009762786 6:68029281-68029303 CTTCCTAGCAGTTTTCTTGAGGG - Intergenic
1012612962 6:101238095-101238117 TCTCCTAGAATACCTCTTGAAGG - Intergenic
1016269861 6:142276205-142276227 TATCCTTGAAGTTTTCTTAAAGG + Intergenic
1016966645 6:149724149-149724171 ACACCTAGAAGGAGTCTTGAAGG + Intergenic
1018571822 6:165219749-165219771 TCTGCTAGGAGTTTTCCTGAAGG - Intergenic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1018737929 6:166702770-166702792 GGACCTAGAAGGTATCTTGAAGG - Intronic
1020485216 7:8713091-8713113 TCTACAAGAAGCTTTCTTGTAGG + Intronic
1023586742 7:41738668-41738690 TCACAAAGAAGCTTTCTTGATGG - Intergenic
1028364146 7:90007404-90007426 TATCCAAAAAGGTTTCCTGAAGG - Intergenic
1029262979 7:99315982-99316004 TTTTCTAGAATGTTCCTTGATGG - Intergenic
1031448312 7:121882350-121882372 CCTCTTAGAAGGTTTCTAGTAGG + Intronic
1031959627 7:127976913-127976935 TCCCCTACATGGTGTCTTGAGGG + Intronic
1035882582 8:3258085-3258107 TGTCCAATAAGGTTTCTGGATGG + Intronic
1035931140 8:3781614-3781636 TCAACTATAGGGTTTCTTGATGG - Intronic
1037222954 8:16547758-16547780 TCTCCTAGAAGGTATTCTTATGG + Intronic
1041790590 8:61692581-61692603 TCACCTGGAAGGTTTTTGGAGGG - Intronic
1043432012 8:80204393-80204415 CCTCCTAAAAGGTTCCTAGATGG + Intronic
1043920517 8:85978109-85978131 TTTCTTAGAAGTTTACTTGAGGG + Intergenic
1044915755 8:97111257-97111279 CCTCCTAGAAGCTGTCTTCAAGG + Intronic
1046562117 8:115851338-115851360 TCTCCTCAAAAGTTACTTGAAGG + Intergenic
1047376518 8:124302829-124302851 TCTCATAGAAGTTTTCTTGTCGG - Intergenic
1048461529 8:134625461-134625483 TTTCCTGGAAGGCTTCTTGAAGG - Intronic
1054789110 9:69238504-69238526 TCTCCTAGAATGCTTCCTGTTGG + Intronic
1058427545 9:104888036-104888058 TCTCAGAAAATGTTTCTTGAGGG + Intronic
1058990149 9:110247834-110247856 TCTCCTGGAATGCTTCCTGAAGG - Intronic
1060193953 9:121610901-121610923 TCCCCTAGAAGGTATCTTCAAGG + Intronic
1060958213 9:127659714-127659736 TCTCCTGGAAGGTTTCTGCCGGG + Intronic
1061739071 9:132686246-132686268 TCTCCTAGATGGGTTCTTTCAGG + Intronic
1061919291 9:133773691-133773713 TCTTCTAGAATGTCTCCTGAAGG + Intronic
1187985246 X:24803052-24803074 TCTGGTTGAAGGTTTCTGGAGGG + Intronic
1189617768 X:42801351-42801373 TCTCATAGATGGTTCCCTGAAGG + Intergenic
1189993668 X:46618505-46618527 TCTTCTAGAAGCTTTATTGTTGG - Intronic
1190316631 X:49156112-49156134 TATCCTAGAATATTCCTTGAGGG - Intergenic
1194423319 X:93704339-93704361 TATCTTAGAAAGTTTCTTAAAGG - Intronic
1199327414 X:146515324-146515346 TTTCCTAAAAGTTTTCTTGTAGG + Intergenic
1199461125 X:148086307-148086329 ACTAGTACAAGGTTTCTTGAAGG - Intergenic
1199757512 X:150879140-150879162 TCTACTGGAAGGTTTCTCTACGG - Intronic
1199835695 X:151588050-151588072 TCTCATATAAGGTTTATTAAAGG - Intronic