ID: 1103031636

View in Genome Browser
Species Human (GRCh38)
Location 12:117619108-117619130
Sequence TACAATGCTGTCTGCTAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103031630_1103031636 16 Left 1103031630 12:117619069-117619091 CCACCTTCAAGAAACCTTCTAGG 0: 1
1: 0
2: 4
3: 31
4: 280
Right 1103031636 12:117619108-117619130 TACAATGCTGTCTGCTAGATGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1103031632_1103031636 13 Left 1103031632 12:117619072-117619094 CCTTCAAGAAACCTTCTAGGAGA 0: 1
1: 0
2: 1
3: 19
4: 147
Right 1103031636 12:117619108-117619130 TACAATGCTGTCTGCTAGATGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1103031629_1103031636 17 Left 1103031629 12:117619068-117619090 CCCACCTTCAAGAAACCTTCTAG 0: 1
1: 0
2: 1
3: 8
4: 151
Right 1103031636 12:117619108-117619130 TACAATGCTGTCTGCTAGATGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1103031628_1103031636 29 Left 1103031628 12:117619056-117619078 CCAAAGATAACTCCCACCTTCAA 0: 1
1: 0
2: 1
3: 17
4: 180
Right 1103031636 12:117619108-117619130 TACAATGCTGTCTGCTAGATGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1103031633_1103031636 2 Left 1103031633 12:117619083-117619105 CCTTCTAGGAGACCTTGAGAATT 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1103031636 12:117619108-117619130 TACAATGCTGTCTGCTAGATGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1103031634_1103031636 -10 Left 1103031634 12:117619095-117619117 CCTTGAGAATTACTACAATGCTG 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1103031636 12:117619108-117619130 TACAATGCTGTCTGCTAGATGGG 0: 1
1: 0
2: 0
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103031636 Original CRISPR TACAATGCTGTCTGCTAGAT GGG Intronic