ID: 1103031832

View in Genome Browser
Species Human (GRCh38)
Location 12:117621246-117621268
Sequence CTCAGGAAACTTAGTTATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 10, 2: 13, 3: 68, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103031832 Original CRISPR CTCAGGAAACTTAGTTATGG TGG (reversed) Intronic
902070613 1:13732251-13732273 TTCAGGAAGCTTAGTTAGGCAGG + Intronic
902972220 1:20062083-20062105 CTCAGGAAGCTTAGTCATAGTGG - Intronic
903116712 1:21184273-21184295 GTTAGGAAACTTACTTAGGGTGG - Intergenic
903360284 1:22772661-22772683 CTCAGGAAACTCAGTCAGGCTGG + Intronic
904456051 1:30648849-30648871 CTCAGGGAACTTACTAAAGGCGG - Intergenic
905321017 1:37117411-37117433 CTGAGGAAACTGAGTTAGAGAGG + Intergenic
905688053 1:39922852-39922874 CTCAGTAAACTTATTCGTGGAGG + Intergenic
905698159 1:39991255-39991277 CTCAGTAAACTTATTCGTGGAGG + Intergenic
906187928 1:43875682-43875704 CTCAGGAAACACAATCATGGCGG - Intronic
906871575 1:49487608-49487630 CTCAGGAAACATAATCATGGTGG - Intronic
907633439 1:56107515-56107537 CTCAGGAAACCTGGTCATGAAGG + Intergenic
908346009 1:63233831-63233853 CTCAGGAAACATAATCATGGAGG + Intergenic
909691449 1:78411566-78411588 CTGAGGAAACTTAGTTTGGCTGG - Intronic
909798459 1:79774603-79774625 CTCAGGAAACATAATCATGGTGG + Intergenic
910166671 1:84335797-84335819 CTTAGGAAACTTAGTTTGGCTGG + Intronic
910265693 1:85334651-85334673 CTCAGGAAACCTAATCATGGTGG - Intronic
910826744 1:91417126-91417148 TTCAGGAAACTTAATAATCGTGG - Intergenic
911031459 1:93493322-93493344 CACAGGAAATTTATTTTTGGTGG + Intronic
911735373 1:101331172-101331194 CTCAGGAAACTCAATCATGGTGG + Intergenic
911794590 1:102059407-102059429 CTCTGGAAGCTTGGTTCTGGAGG - Intergenic
911972283 1:104453316-104453338 CTCAGGAAATGTAGTCATGGAGG - Intergenic
912112876 1:106364524-106364546 CTCAGGAAACTTAGTCATGGTGG - Intergenic
912209561 1:107543545-107543567 CTCAGGAAGCTGAGTTACTGGGG + Intergenic
912788313 1:112625714-112625736 ATTAGGAAGCTTACTTATGGGGG - Intronic
914828121 1:151150391-151150413 CTCTAGAAGCTTAGTTATGAAGG - Intergenic
916157793 1:161873377-161873399 GTCACAAAACTTAATTATGGAGG + Intronic
916159880 1:161898872-161898894 CTCAAGAAACTTATTTAGTGAGG - Intronic
916512361 1:165483578-165483600 CTCAGAAAACTTAATCATGGTGG + Intergenic
918616405 1:186549553-186549575 CTTAGGAAGCTTAGTTTTGCTGG + Intergenic
918752582 1:188290884-188290906 CACAGGAAACCTAATCATGGTGG + Intergenic
919165628 1:193887930-193887952 CTCAGGAAACTTAATCGTGGCGG - Intergenic
919390313 1:196976229-196976251 AAGAGGAAACTTACTTATGGTGG - Intergenic
919629239 1:199943814-199943836 CTAAGGAAACGTAGGGATGGAGG + Intergenic
919932107 1:202227857-202227879 CTCAAGACACTTTCTTATGGAGG + Intronic
920380029 1:205529803-205529825 CTGAGGAAACTGAGGCATGGAGG - Intronic
921465218 1:215478674-215478696 CTCAGGAAATTAAATTATGGTGG + Intergenic
921640594 1:217548006-217548028 CTCAGGAAACTTAACTATCATGG - Intronic
921685380 1:218083415-218083437 CACAGGAAACTTGTTTATGCTGG - Intergenic
921880651 1:220250867-220250889 CTCAGGAAACACAGTGGTGGAGG - Intronic
923236363 1:232036899-232036921 TTCAGGCATCTTAGCTATGGCGG - Intronic
923410004 1:233698715-233698737 CTCAGGAAACACAATCATGGTGG + Intergenic
923752376 1:236757774-236757796 CTTAGGACACTTAGTTTTGGTGG - Intronic
923938267 1:238789917-238789939 CACAGGAAACTTATTTATACTGG + Intergenic
1063783085 10:9349441-9349463 CTCAGGAAACTTAATCGTGGTGG + Intergenic
1064039140 10:11943424-11943446 CTCAGGAAACTTCTTCATTGTGG - Intronic
1064627955 10:17280880-17280902 CTCAGGAAACACAATCATGGTGG + Intergenic
1066128138 10:32362520-32362542 CTTAGGAAACATAGTCATGGTGG - Intronic
1067736325 10:48854214-48854236 CTCAGGAGACTTAGGTAGGAGGG - Intronic
1067752346 10:48980016-48980038 ATTAGGAAACTTACTTAAGGGGG + Intronic
1068823693 10:61409335-61409357 CTCAGGGAACATGGTGATGGAGG - Exonic
1070391725 10:75976736-75976758 ATGAGGAAACTGAGGTATGGAGG + Intronic
1070454353 10:76596059-76596081 CTTATGAAACTTAGTTTTGCTGG + Intergenic
1071197492 10:83178025-83178047 CTCAGGAAACACAATCATGGAGG + Intergenic
1071229347 10:83566427-83566449 ATCATGGAACATAGTTATGGTGG - Intergenic
1071860624 10:89669047-89669069 CTTAGGGAACTTAGTCATGGCGG + Intergenic
1072641825 10:97216730-97216752 CTCAGGAAACACAATTATGGTGG - Intronic
1073741821 10:106416125-106416147 CTTATGAAGCTTAGTTTTGGTGG - Intergenic
1080986286 11:37470365-37470387 CTCAGGAAACTTAATGATCATGG + Intergenic
1082723565 11:56708069-56708091 TTCATGAAACTTAGTTTTGCTGG - Intergenic
1087077278 11:94136932-94136954 CTCGGGAAACACAGTCATGGCGG + Intronic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1087939333 11:104076180-104076202 TTCAGGAAACATAATCATGGTGG - Intronic
1088154858 11:106790576-106790598 CTCAGCAATCTCAGTTGTGGAGG - Intronic
1090064162 11:123488914-123488936 CTCAGGGAAAATAGTTAGGGGGG + Intergenic
1090117204 11:123985452-123985474 CACAGGAAACTTGGATATGGGGG + Intergenic
1091020115 11:132091812-132091834 CTCAGGAAACTTACTGATAATGG - Intronic
1092495260 12:8986959-8986981 CTCAGGAAACTTAGTCATGGTGG - Intronic
1092940394 12:13402376-13402398 CTCAGGAAACTTAACAATCGTGG - Intergenic
1093157969 12:15710975-15710997 CTCAAGAGACTAAGTTAGGGAGG - Intronic
1093570855 12:20664133-20664155 CTCAGGAAACATAATCATGGTGG - Intronic
1094299176 12:28941919-28941941 CTAAGCAAACTGAGATATGGAGG + Intergenic
1095109747 12:38279935-38279957 CTCAGGAAACTTAGTCATGGTGG - Intergenic
1095175202 12:39084285-39084307 CTCAGGAAACTTACATAAGATGG + Intergenic
1098223180 12:68291894-68291916 CTTGGGAAACTGAGTAATGGTGG + Intronic
1099076436 12:78114458-78114480 CTCAGGAAACAGAATCATGGTGG + Intronic
1099699313 12:86063263-86063285 CTTATGAAACTTAGTTTGGGTGG - Intronic
1099969221 12:89483319-89483341 CTCAGGAAACTTACAAATTGTGG - Intronic
1100193860 12:92221940-92221962 GTCAGGAAACTCCATTATGGAGG - Intergenic
1100751377 12:97702033-97702055 ATGAGGAAACTTAGATAAGGAGG - Intergenic
1101023835 12:100581084-100581106 TACAGAAAACTTAATTATGGAGG - Intronic
1102600162 12:114023593-114023615 CTCAGGAAACTTAGTCATGGCGG - Intergenic
1103031832 12:117621246-117621268 CTCAGGAAACTTAGTTATGGTGG - Intronic
1107672167 13:42757420-42757442 CTCAGGAAACAGAATCATGGTGG + Intergenic
1109804839 13:67425644-67425666 CTCAGGAAACACAATCATGGTGG + Intergenic
1109928078 13:69173856-69173878 TTCAGGAAACTGAGTAAAGGTGG - Intergenic
1113013102 13:105793419-105793441 CTCAGGAAACATATTCATGGCGG + Intergenic
1113573131 13:111372909-111372931 CTCAGAAAACTCAGTCGTGGTGG - Intergenic
1114748896 14:25181681-25181703 TTCTGGATACTTATTTATGGTGG + Intergenic
1114780576 14:25534008-25534030 CTCAGGAAACACAATCATGGTGG + Intergenic
1114869916 14:26644059-26644081 CTTATGAAACTTAGTTTGGGTGG + Intergenic
1115505140 14:34086616-34086638 CTCAGGAAACACAATCATGGAGG + Intronic
1116712917 14:48391935-48391957 CTCAGGAAACTTAGTCATGGCGG + Intergenic
1116713219 14:48396312-48396334 CTCAGGAAACTTAATCATGGTGG - Intergenic
1117112936 14:52477064-52477086 CTTAGGAAGCTTAGTTTTGCTGG - Intronic
1117977397 14:61311734-61311756 CTCAGGAAACTTATTTCGGTTGG + Intronic
1118046340 14:61975479-61975501 CTCAGCAAACTTAATCATGATGG + Intergenic
1118608214 14:67518698-67518720 ATCAAGAAAATTACTTATGGGGG - Intronic
1120406944 14:84102344-84102366 CTCAGGAAACAGAATTATGGTGG - Intergenic
1120894118 14:89514475-89514497 CCCAGGAAAGTTCGTTATCGTGG + Intronic
1121086097 14:91147101-91147123 CTCAGGAAACTCACTTAAGGGGG + Intronic
1121992927 14:98578200-98578222 TTCATGAAACTTAGTTCTGAGGG - Intergenic
1122193063 14:100062988-100063010 CTCAGGAAGCTGAGGTAAGGAGG + Intronic
1123411200 15:20061270-20061292 CTCAGGAAACTCAGTCACGGTGG - Intergenic
1123520546 15:21068381-21068403 CTCAGGAAACTCAGTCACGGTGG - Intergenic
1124110189 15:26778087-26778109 CTCAGGAAACATAATCACGGCGG + Intronic
1125930348 15:43595272-43595294 TTCAGAAAACTTAAGTATGGGGG - Intronic
1125943516 15:43695104-43695126 TTCAGAAAACTTAAGTATGGGGG - Intronic
1127744006 15:61945138-61945160 CTCAGGAAACTGAATCATGGTGG - Intronic
1132479345 16:159379-159401 CTCCTGAAACTTACATATGGAGG - Intronic
1135759047 16:25121612-25121634 CTCAGGAAACTTAGTCATGGCGG + Intronic
1138010208 16:53372585-53372607 CTCAAGAAGCTTAGTTGGGGTGG + Intergenic
1138683130 16:58701307-58701329 CTCAGGAAACTTAACAATCGTGG - Intergenic
1141448246 16:84078249-84078271 GTCAGGTAACTTAGGTAAGGTGG - Intronic
1142938435 17:3359525-3359547 CTTAGGAAACTTAGTTTGGCTGG + Intergenic
1146624347 17:34424450-34424472 CTCAGGAAACACTGTTATGGGGG - Intergenic
1148219762 17:45853177-45853199 CTGAGGACACTTATTCATGGTGG - Intergenic
1148693032 17:49543980-49544002 CTCAGGAAACATAACCATGGTGG + Intergenic
1149138865 17:53404985-53405007 CTCAGGAAACTTACACATGGTGG - Intergenic
1149648889 17:58263825-58263847 CTCAGGAAACTAAGCTTTGGTGG - Intronic
1150118369 17:62576165-62576187 TTCAGGAAACTGAGTTAAAGAGG + Intronic
1151387863 17:73766290-73766312 CCCCGGAAACTTTCTTATGGAGG + Intergenic
1151729454 17:75902209-75902231 CTCAGGAGACTGAGTTGGGGAGG - Intronic
1152165821 17:78704915-78704937 CTTAGGAAACAAAGTCATGGGGG + Intronic
1153433698 18:5046382-5046404 CTCAGGAAACTTAACAATTGTGG - Intergenic
1156615961 18:38784414-38784436 CTCAAAAAACTTAATCATGGTGG + Intergenic
1157228797 18:45893918-45893940 ATCAGGGAACTTACTTATGAAGG + Intronic
1157789969 18:50522930-50522952 CTCAGCAAACTTATTTAGGCTGG - Intergenic
1158107281 18:53899922-53899944 CTCAGGAAACTTAGTCATGATGG - Intergenic
1160532853 18:79575707-79575729 CTCAGGCACCTTGGTGATGGTGG + Intergenic
1162332114 19:10036762-10036784 CTCAGGAGGTTTCGTTATGGTGG + Intergenic
1162593404 19:11608053-11608075 CTCAGGAAACTTAATCATGACGG + Intronic
1164751572 19:30659227-30659249 CTCAAGAAACTTAGTCATGGTGG + Intronic
1164898497 19:31898103-31898125 CTCAGGAAACATAATCATGGTGG + Intergenic
925053151 2:832874-832896 CTCAGGAAACTTAGTCGTGGGGG - Intergenic
925140020 2:1543888-1543910 CTCTGGAAACACAGTCATGGTGG + Intergenic
925246739 2:2390215-2390237 CTCAGGAAACACAGTGATGGTGG + Intergenic
925429371 2:3778022-3778044 CTCAGGTAACCTACTGATGGAGG - Intronic
925429398 2:3778146-3778168 CTCAGGAAACCCACTGATGGAGG - Intronic
927075904 2:19577270-19577292 CCCAGCAGTCTTAGTTATGGAGG - Intergenic
927098777 2:19770638-19770660 CTCAGGAAACACAATCATGGTGG + Intergenic
928019668 2:27693534-27693556 TTCATGAAACTTAGTTTTGTTGG + Intronic
928620295 2:33081924-33081946 CTCAGGAAACTTAACAATCGTGG - Intronic
928899390 2:36301180-36301202 CTCAGGAAACACAATCATGGTGG + Intergenic
929078471 2:38097881-38097903 CAAAGGAAACCTAGTTAGGGTGG + Intronic
929351216 2:40957730-40957752 CTCAGGAAACTGAATCATGGAGG + Intergenic
929892079 2:45926429-45926451 CTCAGGATCTTTTGTTATGGTGG + Intronic
931944607 2:67291125-67291147 CTCAGGCAACTTAGAAATTGTGG - Intergenic
932363655 2:71131134-71131156 CTGAAGAAGCTTAGTCATGGGGG - Intronic
933455880 2:82518453-82518475 CTCAGGAAACTAACTTATAGAGG + Intergenic
933539257 2:83618178-83618200 ATCAGGAAACTTCGTCATGATGG + Intergenic
933864279 2:86501606-86501628 CTCAGGAAACACAGTCGTGGCGG + Intergenic
933949619 2:87317370-87317392 CTCAGGAAACACAATTATGGTGG + Intergenic
935039517 2:99412522-99412544 CTGAGGAAACTTAGCTCTTGGGG - Intronic
935372984 2:102366705-102366727 CTCAGGAAACTTACAAAAGGGGG + Intronic
936330574 2:111544227-111544249 CTCAGGAAACACAATTATGGTGG - Intergenic
945774404 2:214086601-214086623 CTCAGGAAACATAATCACGGTGG - Intronic
946151281 2:217773152-217773174 CTCAGGAAACTTACAAATGGTGG - Intergenic
946534245 2:220608927-220608949 CTCAGGAAACTTAACTATCATGG + Intergenic
947995396 2:234523116-234523138 CTCAGGAAACACAATAATGGCGG - Intergenic
948012267 2:234658674-234658696 CTCAGGAAACATAATCACGGCGG + Intergenic
948209700 2:236183706-236183728 CTCAGGAAGCTCAATCATGGTGG - Intergenic
1173645540 20:44631143-44631165 CTTAGGAAACATATTTATGTAGG - Intronic
1174395027 20:50242070-50242092 TTTAGGGAACTTGGTTATGGTGG + Intergenic
1174541461 20:51292987-51293009 CTCAGGAAACACAATCATGGCGG + Intergenic
1174802463 20:53575843-53575865 CTCAGGAACCTTGGTTTGGGAGG + Exonic
1177679758 21:24351529-24351551 CTCAGGAAACATAATCATGGTGG + Intergenic
1177820387 21:26024582-26024604 CTCAGCAAAACTACTTATGGCGG - Intronic
1178764957 21:35441605-35441627 CTCAGAAACATTATTTATGGGGG + Intronic
1179230400 21:39498950-39498972 CTCAGGAAACTTAGTCATGGTGG + Intronic
1179315545 21:40240820-40240842 CCCAAGAAGCTTAGATATGGTGG - Intronic
1179807765 21:43850913-43850935 CTCAGGAAACTTACAAATTGTGG + Intergenic
1181129477 22:20722090-20722112 CTCAGGAAACAGAATCATGGTGG - Intronic
1183167123 22:36156386-36156408 CTCAGGAGACCTAGGTATTGTGG - Intronic
1183849761 22:40575111-40575133 CACAGGAAACTTAGGCATGGAGG - Intronic
1183876723 22:40789150-40789172 CTCAGGAAAATTAGCTGTGGGGG + Intronic
1184956412 22:47889772-47889794 CTCAGGAAACACAATTATGGTGG - Intergenic
1185149200 22:49154424-49154446 CTCAGGAGACTTTGCTCTGGGGG + Intergenic
1185210236 22:49566643-49566665 CTCAGACAACCTAGTTTTGGAGG + Intronic
1185226677 22:49657442-49657464 CTCAGGAAACACAATCATGGCGG + Intronic
949491675 3:4595268-4595290 TTCAGGAAACTTTGTCATGGTGG + Intronic
949521224 3:4855857-4855879 CTCAGGAAACTTAGTCATGGCGG - Intronic
951034849 3:17921632-17921654 CTCAGGAAACACAATCATGGTGG - Intronic
952221240 3:31326367-31326389 CTCAGGAAACTCAATCATGGTGG + Intergenic
953256538 3:41296450-41296472 GCCAGGAAACTCAGTTCTGGTGG - Intronic
953410967 3:42690358-42690380 CTCAGGAAGGTCAGTTTTGGAGG + Intronic
953514003 3:43572242-43572264 CCCAGGAAACTTATTGTTGGTGG - Intronic
953835298 3:46338197-46338219 CTCAGGAAACACAGTTATGATGG + Intergenic
954004444 3:47579660-47579682 CCCAGGAACCTGAGTTTTGGTGG - Exonic
954005480 3:47587186-47587208 CTCATGAAACTTGGTTAGGATGG - Exonic
955260393 3:57383637-57383659 CTCAGGAAGCTGAGTTGGGGTGG + Intronic
955700633 3:61678865-61678887 CTCCCAAAACTTAGGTATGGGGG - Intronic
957784636 3:84866335-84866357 CTCAGGAAACACAATCATGGTGG - Intergenic
957847407 3:85755622-85755644 CTCAGGAAACTCAATCATGGTGG + Intronic
958148324 3:89656673-89656695 CTGAGGAAACTTAGTTTAGCTGG + Intergenic
960700472 3:120434415-120434437 CTGAGGAAACTTAGTTTATGAGG + Intronic
961972721 3:130987436-130987458 CTCAGGAGACTGAGTCATGAGGG - Intronic
962530305 3:136274373-136274395 TTTAGGAAACTTAGTTTTGCTGG + Intronic
963053207 3:141160018-141160040 CTTAGGAAACTTAGTTTGGCTGG - Intergenic
963245987 3:143063156-143063178 CTCAGGAAGCTTAGTCATGGTGG - Intergenic
965112629 3:164447526-164447548 CTTAGGATACTTACTCATGGTGG - Intergenic
965317977 3:167213924-167213946 CTTAGGAAACTTAGTTTGGCTGG - Intergenic
965394910 3:168151775-168151797 CTCAGGAAACTTAAGCATGGTGG - Intergenic
965721993 3:171672229-171672251 CTCTGGAAACTTAGTTAGCTGGG - Intronic
966217533 3:177518878-177518900 CTCAGGAAACATAATCATGGTGG + Intergenic
966342921 3:178945543-178945565 CTCAGGAAACTTAACCATGGTGG + Intergenic
966414635 3:179676170-179676192 CTCAGGAAACAAAATCATGGCGG - Intronic
967480788 3:189970982-189971004 CAAAGGAAACTTACTAATGGAGG - Intronic
967566406 3:190978786-190978808 CTCAGGAAACATAATCACGGTGG - Intergenic
968388534 4:168360-168382 CTCATAAAATTTAGTTAGGGAGG + Intergenic
968524445 4:1048857-1048879 CTCAGGAAACTTAGTCATGGTGG + Intergenic
969103496 4:4787691-4787713 CTCAGGAAACACAATCATGGCGG - Intergenic
970745773 4:19293581-19293603 CTTAGGAAACTTAGTTTGGCTGG + Intergenic
971004004 4:22353478-22353500 CTTATGAAACTTAGTTTTGCTGG - Intronic
971332868 4:25696728-25696750 CTCAGGAAAATTATTTAGAGTGG + Intergenic
971740335 4:30511553-30511575 CTCAGGAAGGTAAGTTATTGGGG + Intergenic
971858782 4:32078367-32078389 TTCAGGAAACATATTTATCGAGG + Intergenic
972517300 4:39820323-39820345 CTCAGGAAACTTAATCATGGTGG + Intergenic
972651145 4:41018905-41018927 CACAAGAGACTTAGGTATGGGGG + Intronic
975626886 4:76359159-76359181 CTCAGAAAACATAATCATGGTGG - Intronic
976141865 4:82001367-82001389 CACAGGAAACATGGCTATGGAGG - Intronic
977047094 4:92080859-92080881 CTTATGAAACTTAGTTTTGCTGG - Intergenic
977138726 4:93339789-93339811 CTCAGGAAACACAATCATGGTGG + Intronic
979454729 4:120914572-120914594 CTCAGGAAACAGAATCATGGTGG + Intronic
980844291 4:138305524-138305546 GTGATGGAACTTAGTTATGGCGG - Intergenic
981076764 4:140600480-140600502 CTTAGGAAAATTAGCTGTGGGGG + Intergenic
981866261 4:149423204-149423226 CTCAGGAAACTTACAACTGGTGG + Intergenic
982272861 4:153609213-153609235 CTTAGGAAACACAGTTATGGTGG + Intronic
983105500 4:163681524-163681546 TTCAGGTAACTGAATTATGGGGG + Intronic
983755681 4:171331811-171331833 CTCAGGAAGCTTAGTTTTTCTGG - Intergenic
984306939 4:178005491-178005513 CTCAGGAAACATAATCATGGTGG + Intergenic
984733794 4:183092085-183092107 CTCAGGAAACTTATTGATTATGG + Intergenic
985169821 4:187136929-187136951 CACAGGTAACTTATCTATGGTGG - Intergenic
985394577 4:189528768-189528790 TTCATGAAACTTAGTTTTGATGG + Intergenic
986359445 5:6962272-6962294 CTCAGTGAACTGATTTATGGAGG + Intergenic
987003928 5:13689568-13689590 CTCAGGAAACGTAATCATGGTGG - Intergenic
988119455 5:26942114-26942136 CTCAGGAAACACAATCATGGTGG + Intronic
989179158 5:38558672-38558694 CTCAGGAAACTTAACAATCGTGG + Intronic
989197162 5:38726884-38726906 CTCAGGAAACACAATCATGGCGG + Intergenic
989254548 5:39352054-39352076 CTCAGGAAACCCAATCATGGTGG + Intronic
989817356 5:45752057-45752079 CTCAGGAAACATCATCATGGTGG + Intergenic
990182764 5:53180771-53180793 CTCAGGAAACATAATCATGACGG - Intergenic
990935675 5:61146265-61146287 CTCAGGGAACTTAGATTTGGTGG + Intronic
991010356 5:61876156-61876178 GGCAGGAAAATTAGTTAAGGAGG - Intergenic
991111509 5:62905270-62905292 CTTAGGAAACATAATCATGGTGG + Intergenic
991156371 5:63440970-63440992 CACAGGAAACTTATTTATACTGG - Intergenic
991992245 5:72351583-72351605 CTCAGGAAATACAGTCATGGGGG + Intronic
993615016 5:90100301-90100323 CTCAGAAAACTAAGATTTGGGGG + Intergenic
993713662 5:91253019-91253041 CTCAGGAAACACAATCATGGTGG - Intergenic
995576421 5:113540502-113540524 CTCAGGAAACTTAGTCATGATGG + Intronic
995636143 5:114193190-114193212 CTCAGAAAACTCAGTCATGCAGG - Intergenic
995895672 5:117007599-117007621 CTCAGGAAACTTACACATGGTGG + Intergenic
996964548 5:129292371-129292393 CTCATGAAACTCATTTAGGGAGG + Intergenic
998690868 5:144586012-144586034 CTCAGCAAACCTATTTATGAAGG + Intergenic
998799838 5:145857886-145857908 CTCATGGAACTTAGTTTTAGAGG - Intergenic
999034204 5:148329013-148329035 CTCATAAAAATTAGTTAGGGAGG + Intronic
999053915 5:148553379-148553401 CTCAGGTAACTTAAATATGCAGG - Intronic
1000031915 5:157409003-157409025 CTTAGGAAACTTAGTTGGGCTGG - Intronic
1001526111 5:172430035-172430057 ATGAGGAAACTGAGTCATGGGGG - Intronic
1005078228 6:21929749-21929771 CTCAGGAAATGCAGTCATGGCGG + Intergenic
1005879776 6:30047260-30047282 CTCAGGAAACACAATAATGGTGG + Intergenic
1006916964 6:37600970-37600992 CTCAGGAAAGTTCTTTATAGCGG - Intergenic
1007893425 6:45319364-45319386 CTCAAGTAATTTTGTTATGGAGG - Intronic
1008848055 6:55992618-55992640 CTCAGGAGACATAATCATGGTGG + Intergenic
1008930839 6:56938240-56938262 CTCAGGAAGCTGAGATAAGGAGG - Intronic
1009707884 6:67278163-67278185 CTCAGGAATCCTAGTTATGGCGG + Intergenic
1009773300 6:68173356-68173378 CTCAGGAAACAGAATCATGGTGG - Intergenic
1011518914 6:88182712-88182734 CTCAGAAAACATAATCATGGTGG - Intergenic
1011981560 6:93385853-93385875 CTCAGGAAACATAATCATGGTGG + Intronic
1013672313 6:112418024-112418046 CTCAGGAAGCTGAGGTTTGGAGG + Intergenic
1014250016 6:119105487-119105509 CTCAGGAAACTGAATCATGGTGG - Intronic
1014564544 6:122931504-122931526 CTCAGGAAACTTGGATAGGTGGG + Intergenic
1014951357 6:127559231-127559253 CTCAGGAAACACAATCATGGAGG - Intronic
1015239472 6:131007325-131007347 CTCAGGAAACAAAGTTACGGTGG - Intronic
1017287611 6:152694950-152694972 CTCATGAAACTTATTGCTGGTGG + Intergenic
1017408968 6:154149190-154149212 CTCAGGAAACTTAACAATCGTGG + Intronic
1018511288 6:164527109-164527131 CTCAGCAAACATAATTATGGAGG - Intergenic
1021355937 7:19653318-19653340 CTTAGGAAGCTTAGTTTTGCTGG - Intergenic
1022481751 7:30748351-30748373 CTCAGGAATGTCAGTTTTGGGGG + Intronic
1022888310 7:34669273-34669295 GTAAGGAAACTTGTTTATGGTGG + Intronic
1024024062 7:45396563-45396585 CACAGGAAACTTGTTTATGCTGG - Intergenic
1024731539 7:52258891-52258913 CCCAGGAAGCTTAGTTCTGAGGG + Intergenic
1024865685 7:53903368-53903390 CTCAGGAAACTTTCACATGGTGG + Intergenic
1024895874 7:54261344-54261366 CTCAGGAAACACAGTCATGGTGG + Intergenic
1027441405 7:78222993-78223015 CTCATGAAACATGGTTATGGGGG + Intronic
1027869635 7:83690891-83690913 CACAGGAAACTTCTTTATAGTGG + Intergenic
1028393220 7:90338414-90338436 CTCAGGAAACTTAATCATGGTGG - Intronic
1028534428 7:91876098-91876120 ATCAGGAAAATGAGTTATTGAGG - Intronic
1030268339 7:107643840-107643862 CTCAAGAAACTTATTTCTGCTGG + Intergenic
1031194079 7:118590333-118590355 CTCAGGAAACTCAAACATGGTGG - Intergenic
1031268382 7:119611788-119611810 CACAGGAAACTTTGTTATCCTGG - Intergenic
1031342384 7:120619320-120619342 CTCAGGAAACTGAGCCAGGGAGG + Intronic
1032007376 7:128313863-128313885 CTCAGGAAACTTAATCATAGTGG - Intronic
1032366630 7:131306140-131306162 CTCAGGAAACGTAATCATGGTGG - Intronic
1032630698 7:133647938-133647960 CTCAGAACACTTTGTTATGTTGG + Intronic
1033532142 7:142274873-142274895 CTTAGGAAACTTAGTTTGGCTGG - Intergenic
1033790781 7:144790512-144790534 CTCAGGAAACTTAACAATCGTGG + Intronic
1034113616 7:148562814-148562836 CTTAGGAAACTTAGTCATGGCGG + Intergenic
1034477640 7:151296021-151296043 CTCAGGAAACACAATCATGGTGG + Intergenic
1034778286 7:153852355-153852377 CTCAGGGAACTTAGTCATGATGG + Intergenic
1034824971 7:154253856-154253878 CTTAGGAAACACAATTATGGTGG + Intronic
1035548066 8:498942-498964 CTCAGGAAACTTACGTAAGGAGG - Intronic
1035634562 8:1134719-1134741 CTCAGGAAACTTATTCATGGTGG + Intergenic
1036057275 8:5270231-5270253 CTCAGGAAACACATTCATGGAGG - Intergenic
1037384374 8:18322021-18322043 CTCAGGAAACTTACAAATGGCGG + Intergenic
1038233381 8:25727506-25727528 CTTAGGAATCTTAGTTTGGGTGG + Intergenic
1038301557 8:26355345-26355367 CTCAGGAGACTGAGGTAGGGAGG - Intronic
1038310052 8:26439540-26439562 CTCAGGAGACTGAGGTAGGGAGG - Intronic
1040945793 8:52883014-52883036 TTCAGGAAACATAATCATGGTGG + Intergenic
1041217755 8:55617625-55617647 CTTATGAAGCTTAGTTTTGGTGG - Intergenic
1041265607 8:56061239-56061261 CTCAGGAAACTTAATCATGGCGG - Intergenic
1042608149 8:70567206-70567228 CTTAGGAAGCTTAGTTTTGCTGG - Intergenic
1043102330 8:76061240-76061262 CTCAGGAAACATAATCATGGTGG - Intergenic
1043396688 8:79844178-79844200 CTCATGAAGCTTGGTTTTGGTGG - Intergenic
1043841955 8:85116672-85116694 CTAAGAAAATTTAGTTATAGAGG - Intronic
1043844589 8:85149929-85149951 CTTATGAAACTTAGTTTTGTTGG - Intergenic
1044065373 8:87692522-87692544 GTCAGGAAATTGAGTTGTGGAGG - Intergenic
1046365661 8:113227722-113227744 CTCAGAAAACATAATTATGGTGG - Intronic
1046611378 8:116429417-116429439 CTCAGGAAACACAGTCATGGTGG + Intergenic
1047151369 8:122267269-122267291 CTCAGGAAACATAATCATGGCGG + Intergenic
1047466275 8:125117747-125117769 CTCAGGAAACCTAGTTAAAAGGG - Intronic
1047827904 8:128597782-128597804 CTCACAAAACTTAGTCATGGTGG + Intergenic
1047939464 8:129815197-129815219 CTCAGGAAACTTAGCAATCATGG - Intergenic
1052863115 9:33448835-33448857 TTAAGCAAACTTAATTATGGGGG + Intergenic
1054989646 9:71308636-71308658 CTCAGCAAACAAAGTAATGGGGG + Intronic
1055926895 9:81519612-81519634 CTCAGGAAACTTAGTGATGGTGG + Intergenic
1056069275 9:82968950-82968972 CTCAGGAAACTTAGCTGAGATGG - Intergenic
1056400868 9:86225836-86225858 CTCAGGAAATGAAGATATGGAGG + Intronic
1056709645 9:88980459-88980481 CCCAGTAAACTTGTTTATGGAGG + Intergenic
1057182085 9:93035708-93035730 CTCAGGACACTTGGCTTTGGGGG + Exonic
1057694376 9:97312828-97312850 GTGAGGAAACTCAGTCATGGGGG - Intronic
1058209057 9:102144622-102144644 CACAGGAAACTTAGTCATGGTGG + Intergenic
1058653310 9:107197181-107197203 CTCAGGAAACACAATCATGGCGG + Intergenic
1059565070 9:115376056-115376078 CTCAGGAAACTTAGAAATCATGG + Intronic
1059617959 9:115971464-115971486 CTCAGAAAACATAATCATGGTGG + Intergenic
1062025831 9:134340234-134340256 CTCAGGACCCTTAGCTAAGGAGG - Intronic
1062424885 9:136501638-136501660 CTCTGGAAACTTAGAATTGGGGG - Intronic
1062670141 9:137703979-137704001 CTCAGGAAACTTAGCAATCATGG + Intronic
1188473235 X:30563289-30563311 CTCAGGAAACACAATCATGGTGG - Intronic
1189728871 X:43997769-43997791 TTCAGGAAACATAATCATGGTGG + Intergenic
1189767894 X:44390890-44390912 CTCAGGAGGCTGAGTTAGGGAGG - Intergenic
1189950624 X:46226593-46226615 CACAGGAAACTTATTTATTCTGG - Intergenic
1191609025 X:63091535-63091557 CTTATGAAACTTAGTTTGGGTGG - Intergenic
1192524745 X:71831834-71831856 CTCATGAAACTTAGTTTGGCTGG - Intergenic
1192695692 X:73413477-73413499 CTCAGAAAACTTAATCTTGGAGG - Intergenic
1192759012 X:74076306-74076328 CTCATGAAACTTAGTTTGGCTGG + Intergenic
1193528288 X:82620468-82620490 CTCATGAAGCTTAGTTTTGCTGG - Intergenic
1193800140 X:85925202-85925224 CTTATGAAACATAGATATGGAGG - Intronic
1193934246 X:87596124-87596146 TTCGGGAAACTTATTTATGGTGG - Intronic
1196312579 X:114185372-114185394 CTTATGAAACTTAGTTTTGCTGG - Intergenic
1196571480 X:117270259-117270281 CTCATGAAACTTAGTTTGGCTGG - Intergenic
1196583407 X:117401650-117401672 CTTAGGAAACTTAGTTTGGCTGG - Intergenic
1197581767 X:128293227-128293249 CTGAGGAAACATAATCATGGTGG - Intergenic
1197740470 X:129888623-129888645 CTCAGGAAACAGAATCATGGTGG - Intergenic
1198999964 X:142624121-142624143 CTCAGGGAACTTACTCGTGGCGG + Intergenic
1200747580 Y:6916095-6916117 CACACGAAAAATAGTTATGGGGG - Intronic
1201331768 Y:12831072-12831094 CTTAGGAAACTTAATCATGGTGG - Intronic