ID: 1103032945

View in Genome Browser
Species Human (GRCh38)
Location 12:117632520-117632542
Sequence TAGAAAAAGGAGTAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 543}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103032945_1103032950 -3 Left 1103032945 12:117632520-117632542 CCTGCCACCTACTCCTTTTTCTA 0: 1
1: 0
2: 5
3: 53
4: 543
Right 1103032950 12:117632540-117632562 CTAGCTTTGATTTCAGGTTCAGG 0: 1
1: 0
2: 6
3: 108
4: 1188
1103032945_1103032951 -2 Left 1103032945 12:117632520-117632542 CCTGCCACCTACTCCTTTTTCTA 0: 1
1: 0
2: 5
3: 53
4: 543
Right 1103032951 12:117632541-117632563 TAGCTTTGATTTCAGGTTCAGGG 0: 1
1: 2
2: 34
3: 747
4: 2609
1103032945_1103032953 11 Left 1103032945 12:117632520-117632542 CCTGCCACCTACTCCTTTTTCTA 0: 1
1: 0
2: 5
3: 53
4: 543
Right 1103032953 12:117632554-117632576 AGGTTCAGGGGTACATGTGCAGG 0: 370
1: 1761
2: 3453
3: 4247
4: 3804
1103032945_1103032949 -9 Left 1103032945 12:117632520-117632542 CCTGCCACCTACTCCTTTTTCTA 0: 1
1: 0
2: 5
3: 53
4: 543
Right 1103032949 12:117632534-117632556 CTTTTTCTAGCTTTGATTTCAGG 0: 1
1: 1
2: 17
3: 130
4: 1213
1103032945_1103032954 24 Left 1103032945 12:117632520-117632542 CCTGCCACCTACTCCTTTTTCTA 0: 1
1: 0
2: 5
3: 53
4: 543
Right 1103032954 12:117632567-117632589 CATGTGCAGGTTTGTTATACAGG 0: 144
1: 1122
2: 3857
3: 9079
4: 11442
1103032945_1103032952 -1 Left 1103032945 12:117632520-117632542 CCTGCCACCTACTCCTTTTTCTA 0: 1
1: 0
2: 5
3: 53
4: 543
Right 1103032952 12:117632542-117632564 AGCTTTGATTTCAGGTTCAGGGG 0: 1
1: 2
2: 77
3: 1077
4: 3203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103032945 Original CRISPR TAGAAAAAGGAGTAGGTGGC AGG (reversed) Intronic
901572008 1:10168595-10168617 TAGAAAAAGCATAAGGTGCCGGG + Intronic
901699500 1:11037199-11037221 TACAAAAATTATTAGGTGGCGGG - Intronic
901742187 1:11349512-11349534 TAGAAAAGGCAATATGTGGCTGG + Intergenic
901753889 1:11429275-11429297 GAGAAAGGGGAGAAGGTGGCAGG + Intergenic
902688989 1:18097900-18097922 GAGAAAGAGGAGGAGGTGTCAGG - Intergenic
903116607 1:21183497-21183519 GAGAAAAAAAAGGAGGTGGCGGG + Intergenic
905120793 1:35680242-35680264 AAGAAAAAGGTGAAGTTGGCCGG - Intergenic
905258786 1:36703088-36703110 GAGAAAGAGGAGGAGGTGCCAGG + Intergenic
905612726 1:39368796-39368818 TAGAAAAACCACTAAGTGGCTGG - Intronic
906176283 1:43775986-43776008 AAGAAAAAGGAATAGAAGGCAGG - Intronic
906674730 1:47685092-47685114 TTGTAAAAGGAGTAGGTGGGAGG + Intergenic
907000650 1:50850657-50850679 TAAAAAAATGAGTACCTGGCAGG + Intronic
908278197 1:62499096-62499118 TCCAAAAAGGAATAGGTGGCTGG - Intronic
908506163 1:64802366-64802388 TACAAAAGGGAGCAGGTGGGGGG - Intronic
909740476 1:79023649-79023671 GAGAAAAAGGAGCAGGTGAAAGG - Intergenic
909862792 1:80630134-80630156 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
909944754 1:81650900-81650922 TAGAAAATGGAGGTGGGGGCAGG - Intronic
910260336 1:85288133-85288155 TTAAAAAATGAGAAGGTGGCTGG + Intergenic
910523438 1:88150068-88150090 TAGAAAAGGGAATTGATGGCAGG + Intergenic
910698273 1:90045236-90045258 TAGAAGAATCAGTGGGTGGCAGG + Intergenic
910867613 1:91802654-91802676 TAGAAAAAGAAGTATGGGCCAGG - Intronic
911251551 1:95582101-95582123 TAGAAAAAGGAAAAGGTTGGGGG + Intergenic
911420739 1:97637368-97637390 TAACAAAAGAAGTAGGTAGCTGG - Intronic
912387448 1:109278892-109278914 TAGAAATTGGAGCAGGGGGCTGG + Intergenic
913190166 1:116406763-116406785 TAGAGAAAGGGGTAGGGGTCAGG - Intronic
913446174 1:118952976-118952998 TAGAAATAGGAAAAGATGGCTGG + Intronic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
915479186 1:156173519-156173541 TAGAAGAAGGGATAAGTGGCAGG + Intronic
916282265 1:163064710-163064732 AAGAAAGAGGAGTAAGAGGCAGG + Intergenic
916374681 1:164139452-164139474 AAGGAAAAGGGGCAGGTGGCTGG + Intergenic
917443504 1:175087305-175087327 AAGAGAAAGGAGCAGGTAGCGGG + Intronic
917467982 1:175300058-175300080 TAGTAAAAGAAATAAGTGGCAGG + Intergenic
917863396 1:179170291-179170313 TTGAAAAAGTAGTAGGAGGTGGG - Intronic
918348483 1:183628714-183628736 TAAAAGAATGAGTAGGTGACAGG + Intronic
918371364 1:183864761-183864783 TAGAGAAAGGAGCAGGTGGATGG + Intronic
919515317 1:198515012-198515034 GAGGAAAGAGAGTAGGTGGCCGG + Intergenic
920365719 1:205447470-205447492 TGGAACAGGGAGTAGGAGGCGGG + Intronic
920368572 1:205462218-205462240 TAGAAAAAGGTGTGGGAGCCAGG - Intergenic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
921131225 1:212221695-212221717 AAGACAATGGAGAAGGTGGCTGG + Intergenic
921595724 1:217051758-217051780 TAAAAAAAGGAGTATGGGGATGG - Intronic
922513815 1:226191533-226191555 TAGAAAAACAGGTAGTTGGCCGG - Intergenic
923077443 1:230622807-230622829 AAGATAAGAGAGTAGGTGGCAGG - Intergenic
923218197 1:231869611-231869633 AAGAAAGAGGAGGAGGTGCCAGG + Intronic
923480148 1:234376214-234376236 GAGAAAAAGCAGTGGGTTGCAGG - Intronic
924078672 1:240369143-240369165 TAGAAAAGGCAGGAGGTGGAGGG - Intronic
924264360 1:242266818-242266840 TAGAAAAGAGAGAAGCTGGCCGG + Intronic
924553882 1:245102723-245102745 TACAAAACAGAGTAGGAGGCAGG + Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1064212217 10:13369645-13369667 TTGAAAAAGGAGTAGAAGGCCGG + Intergenic
1064516938 10:16160215-16160237 TAGACAGAGAGGTAGGTGGCTGG - Intergenic
1064989034 10:21239719-21239741 TAAAAAATGCAGTAAGTGGCAGG + Intergenic
1065077714 10:22097841-22097863 TAGAAAAGGTAGTAAGAGGCTGG - Intergenic
1065298366 10:24298499-24298521 TAGAAATAGGAGTAGCGAGCCGG + Intronic
1065367326 10:24949377-24949399 TTTAAAAAGGGGCAGGTGGCTGG - Intronic
1065839297 10:29687712-29687734 TAGAAAAAGGGGCAGGTAGGTGG - Intronic
1065947001 10:30614004-30614026 TAGAAAAAATAATAGGTGGCGGG - Intronic
1066264424 10:33761923-33761945 AAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1066441282 10:35441468-35441490 TGGAAAAAGCGGTAGGAGGCTGG + Intronic
1066720445 10:38331668-38331690 TAGAAAAAAGAGAAGCTGGCTGG - Intergenic
1067402364 10:45988429-45988451 GAGAAAAGGGAGTAGGTGAAAGG + Intronic
1067665062 10:48270697-48270719 TTGAAAGAGGAGGAGGTGGGGGG - Intronic
1068715121 10:60179396-60179418 TACAAAAATGACTACGTGGCCGG + Intronic
1070209767 10:74304529-74304551 TCTAAAAAGCAGTAGGTGACAGG + Intronic
1070631144 10:78085678-78085700 TAGAACAGGGGGTATGTGGCAGG + Intergenic
1071400885 10:85269549-85269571 GAGAGAGAGGAGGAGGTGGCAGG + Intergenic
1071496709 10:86172704-86172726 TAGAGAGAGGAGCAGATGGCAGG - Intronic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072456907 10:95584454-95584476 TAGAACAAGGAGTATGGGCCAGG - Intergenic
1072479572 10:95797659-95797681 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1074753863 10:116610303-116610325 TAGAAACAGAAGTCGGTGGCCGG - Intergenic
1075193643 10:120334981-120335003 TAGAAAAAGCACTAGATGGCCGG + Intergenic
1075247615 10:120837741-120837763 GACAAAAGGGAGGAGGTGGCAGG + Intergenic
1075471606 10:122694875-122694897 TAGAAATTGGAGTTGGTGGGGGG - Intergenic
1076599161 10:131645954-131645976 GAGGAAAAGGAGCAGGTGGAGGG - Intergenic
1077232497 11:1464318-1464340 TTGAAAAAGGATGTGGTGGCCGG + Intergenic
1078074801 11:8148882-8148904 TAAAAAAAAGAGGAGTTGGCTGG + Intronic
1078232898 11:9459174-9459196 TAAAAAATGGATTAGGTGGCCGG - Intergenic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1079514219 11:21248046-21248068 TACAAAAAAGAGCAGGAGGCCGG + Intronic
1079639399 11:22785277-22785299 TGGAAAAAAGAGGAGGTGGTAGG - Intronic
1081475330 11:43424470-43424492 TAGAAACATGAAAAGGTGGCTGG + Intronic
1083633058 11:64105582-64105604 TAGCATTAGGAGTAGCTGGCAGG - Intronic
1083655694 11:64228366-64228388 TTGAAAAAGGAGTAAGTGGCCGG + Intronic
1084860508 11:72014930-72014952 GAGGCAAAGGAGAAGGTGGCAGG - Exonic
1085488012 11:76885063-76885085 TAGAAAAAGAAGGATCTGGCTGG - Intronic
1086338968 11:85827559-85827581 TAGAATATGGAGGAGTTGGCAGG - Intergenic
1087224872 11:95587256-95587278 AAGAAAAAGGAATATGTGGTAGG + Intergenic
1087768496 11:102181514-102181536 AGAAATAAGGAGTAGGTGGCAGG - Intronic
1087973739 11:104517890-104517912 AAAAAAAAGGAGTAGGAAGCAGG - Intergenic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1088593310 11:111421616-111421638 TACAAAAAGTAGAAGGCGGCTGG + Intronic
1089103937 11:115986532-115986554 TAGAAAATGGAGTATATAGCCGG - Intergenic
1089272838 11:117314145-117314167 CAGAAACAGGAGTAGGTCCCAGG + Intronic
1089545440 11:119220947-119220969 TAAAAAAAAGTATAGGTGGCCGG + Intronic
1089751677 11:120655830-120655852 TAGGAGGAGGAGCAGGTGGCGGG + Intronic
1090014277 11:123072006-123072028 GAGAATAAGTAGTGGGTGGCAGG - Exonic
1091117845 11:133031356-133031378 TAGATGAATGAGTAGGTGGATGG + Intronic
1092143541 12:6200129-6200151 TTGAAGAAGGAGTGGGTGGCGGG + Intronic
1092276824 12:7067754-7067776 TGGAAAATGGAGGAGGTGGTAGG + Exonic
1092338030 12:7651317-7651339 TAGAGAAAAGAGTTGTTGGCTGG + Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1093018859 12:14184569-14184591 AAGAAAAAGAAGTACATGGCCGG + Intergenic
1094207790 12:27858989-27859011 TAGAAAATGGAGATGGGGGCCGG + Intergenic
1094607921 12:31965251-31965273 TTGAAAAGGGAGTAGCCGGCAGG - Intronic
1094659005 12:32448358-32448380 TAGAAAAAGGGGTGCTTGGCTGG + Intronic
1094715319 12:33008179-33008201 GAGGAAAAGTAGTTGGTGGCAGG - Intergenic
1096023092 12:48338379-48338401 GGGAAAAAGGAGGTGGTGGCAGG + Exonic
1096625020 12:52889526-52889548 CAGAAAAAGAAATAGATGGCTGG + Intergenic
1097032495 12:56099778-56099800 TAGAAAAAGGAGGAGTTGGCTGG + Intronic
1097865569 12:64556820-64556842 AAAAAAAAGGGGTAGGGGGCAGG - Intergenic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1099580705 12:84443833-84443855 TAGAAAAAGGAGCAGGTGAAAGG - Intergenic
1100095567 12:91030624-91030646 TAGGAAATGTAGCAGGTGGCGGG + Intergenic
1100237086 12:92672061-92672083 GAAAAAAAAGAGGAGGTGGCCGG - Intergenic
1100254684 12:92871003-92871025 TAGAAAAAGGACTTTGAGGCTGG - Intronic
1100608234 12:96169467-96169489 AAGAAAAAGTGGTAGGTGGCAGG + Intergenic
1100963945 12:99992047-99992069 GAGAAAAAGGAGCAGGTGACAGG + Intergenic
1101146276 12:101843752-101843774 TAGAAGCAGGAGTAGATGCCAGG - Intergenic
1101334215 12:103781983-103782005 TAGAAAAATGGGCCGGTGGCTGG - Intronic
1101636116 12:106542963-106542985 TAGAAATAGAAGTAGGGGCCAGG + Intronic
1102301204 12:111772859-111772881 TAGAAATAGATTTAGGTGGCCGG + Intronic
1102500308 12:113347562-113347584 TATAAAAAGGAGAAAGGGGCTGG + Intronic
1102606429 12:114071228-114071250 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1102780854 12:115563329-115563351 CAGGAAAAGGATGAGGTGGCGGG - Intergenic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1103714318 12:122935169-122935191 CAAAAAAAAGAGCAGGTGGCAGG + Intronic
1105339079 13:19502917-19502939 TAGGAAAAGGAGCAGGTCACAGG - Intronic
1106426256 13:29633208-29633230 TAGAAAGAGGAGCTGGTGGCTGG - Intergenic
1106653835 13:31721053-31721075 GAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108618756 13:52160476-52160498 TATATAAAGGAGGAGGTGGGAGG + Intergenic
1111590058 13:90334602-90334624 TAGAAAAAGAAATATGGGGCGGG - Intergenic
1111657680 13:91174056-91174078 TAGAAATTGGATTTGGTGGCCGG - Intergenic
1111749447 13:92309903-92309925 GATAAAAAGTAGTAGGTTGCAGG - Intronic
1112192304 13:97189908-97189930 TTGAAAAAGCACTAGGTAGCAGG - Intergenic
1114260263 14:21031515-21031537 TAAAAAAGGGAGTAGGTGAGAGG - Intronic
1114526779 14:23371483-23371505 TAGAAGAAGCAGGTGGTGGCTGG - Intergenic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1115309057 14:31961216-31961238 AAAAAAAAAGAGTAAGTGGCTGG - Intergenic
1115755501 14:36523419-36523441 TAGAAAAAGCAGTTGGGGGGTGG - Intergenic
1116505947 14:45681442-45681464 TAGACAAAGGAGTAAATGGCAGG - Intergenic
1116820156 14:49620192-49620214 TGGAAAATGGAGGAGGTGGGTGG - Intronic
1117125862 14:52625185-52625207 TAGAAAATAGAGGAGGGGGCTGG + Intronic
1117243064 14:53854992-53855014 GAGATAAAGGAGTGGGTGGAGGG + Intergenic
1117770692 14:59131247-59131269 CATCAAAAGCAGTAGGTGGCAGG - Intergenic
1118010247 14:61603519-61603541 TATAAAATGGAGTTGTTGGCTGG + Intronic
1118453442 14:65924849-65924871 TATCAAAGGAAGTAGGTGGCTGG - Intergenic
1120163257 14:81168131-81168153 GAGAAAAAGGAGCAGGTGCAAGG - Intergenic
1120188921 14:81422278-81422300 GAGAAAAAGGAGGAGGTGCCAGG - Intronic
1120819355 14:88897718-88897740 CAGAAAATGGATTAGGTGGGGGG - Intergenic
1121204125 14:92147383-92147405 TAGAAAAAGGAGTAAGTTGGAGG + Intronic
1121510459 14:94509410-94509432 CCGAAAAAGGACTAGGAGGCTGG - Intronic
1121518303 14:94568557-94568579 TAGAAAATGGAGGAGGGGCCGGG + Intronic
1122357156 14:101130130-101130152 GAGACAAGGGAGGAGGTGGCAGG + Intergenic
1123464049 15:20501075-20501097 TAGAAATATCAGTAGATGGCCGG - Intergenic
1123654016 15:22499346-22499368 TAGAAATATCAGTAGATGGCCGG + Intergenic
1124097813 15:26665599-26665621 CAGAAAAAGGAGCTGGTGTCAGG + Intronic
1124165235 15:27320251-27320273 TAATAAAAGGAGCAGGTGACAGG - Intronic
1124307922 15:28594544-28594566 TAGAAATATCAGTAGATGGCCGG + Intergenic
1125665710 15:41428562-41428584 AAAAAAAAGGAGTAGGGGGCCGG - Intronic
1126354611 15:47782253-47782275 TAGAAGTAGGGGTAGGTGGGTGG - Intergenic
1126934671 15:53693652-53693674 TAGAAATAGTAGTAGTTAGCTGG - Intronic
1127084173 15:55409106-55409128 TTGAAAAAGGATTTGGTGGCCGG + Intronic
1127260883 15:57325368-57325390 TAAAAAAATGAGTAAGAGGCAGG - Intergenic
1127451279 15:59118781-59118803 CTGAAAAAGGAGGAGATGGCAGG - Intronic
1128478978 15:68021153-68021175 TATAAAAAGAAATAGTTGGCTGG + Intergenic
1129498040 15:76005821-76005843 GAGAAAGAGGAGGAGTTGGCAGG + Intronic
1129765037 15:78159291-78159313 AAGAAAAAGGAGGAGGGGGTAGG - Intronic
1129908004 15:79203309-79203331 TGGAAAAAGGAGGAGGGGCCAGG + Intergenic
1130528667 15:84728628-84728650 TAGAAAAAGCAGAAGAGGGCCGG - Intergenic
1130686532 15:86042460-86042482 GAGAAAAAGGACAAGGTGTCTGG - Intergenic
1130801037 15:87263509-87263531 TAGCAAAAAGACCAGGTGGCTGG - Intergenic
1132082235 15:98876160-98876182 TGGAAAAAGCAGAAGGTTGCTGG + Intronic
1134120494 16:11580752-11580774 AAGAAAAAGGAATAGGGGCCTGG - Intronic
1134148624 16:11787995-11788017 TAAAAAAAGGAGTATGGGGCTGG - Intronic
1134249697 16:12565750-12565772 TGAAAAAAGGTGAAGGTGGCAGG - Intronic
1134766880 16:16767023-16767045 TAGATAGATGAGTAGGTGGATGG - Intergenic
1136023063 16:27452225-27452247 TCGAAAAATGAATAGGAGGCTGG + Intergenic
1137507376 16:49065878-49065900 TAGAAAAAAGAGCAGGTGGAAGG - Intergenic
1137552208 16:49445367-49445389 TGGAAGAAGGAGAAGGTGTCAGG - Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137783374 16:51116312-51116334 GGGAAAAAGGAGAAGGGGGCTGG - Intergenic
1138670689 16:58611900-58611922 GAGAAAAAGAAGTAGGTGTGAGG - Intronic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1140127591 16:72131158-72131180 TAGAAAAAGAAGTGGGAGGAAGG + Intronic
1140483901 16:75278868-75278890 TAAGAAAAGGTGTGGGTGGCTGG + Intergenic
1140591239 16:76355309-76355331 TAATAAAAGGAGCTGGTGGCTGG + Exonic
1140858836 16:79001649-79001671 AAAAAAAAGGAGCTGGTGGCAGG + Intronic
1140872784 16:79122272-79122294 AAGAAAAGGGAGGAGGTGGGAGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141636384 16:85316167-85316189 CTGAAAATGGAATAGGTGGCTGG - Intergenic
1142525023 17:534134-534156 TTCAAAAAGTGGTAGGTGGCTGG - Intronic
1142872726 17:2831371-2831393 AAGAAAAAGAAATAGGAGGCTGG - Intronic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143385160 17:6524898-6524920 TTGAAGAAGGAGTATATGGCTGG - Intronic
1143843741 17:9756140-9756162 TAGAATAAGGAAGTGGTGGCCGG - Intergenic
1145956787 17:28860271-28860293 TAAAAAAAAGAGAGGGTGGCCGG - Intronic
1146603102 17:34235486-34235508 TGGAAAAGGGAGCAGGTGGGAGG - Intergenic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147328016 17:39679239-39679261 GAGAAAAAGCAGCAGATGGCCGG - Intronic
1147976128 17:44249156-44249178 TAGAAAAGAGAGGAGGTGGCTGG - Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148929812 17:51119642-51119664 TATAAAAAGGATTGGGGGGCGGG - Intronic
1149652170 17:58282276-58282298 AAAAAAAAAGAGTGGGTGGCGGG - Intergenic
1149812789 17:59693691-59693713 AACAAAAAGGAGCAGGGGGCAGG - Intronic
1150513077 17:65776519-65776541 TATAAAAAGGGGCAGCTGGCCGG - Intronic
1151026497 17:70683756-70683778 TATAGAAAGCAGTAGGTGCCAGG + Intergenic
1151947184 17:77326089-77326111 TGGAAGAAGGGGTAGGAGGCGGG - Intronic
1152350893 17:79783704-79783726 AAGATAAAGGAGAAGTTGGCTGG - Intronic
1153671806 18:7418985-7419007 TAAAGAAAGCAGTAGGGGGCTGG - Intergenic
1153716580 18:7855920-7855942 TAGAAAAAGCAGAAGGTGCCTGG + Intronic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1154172926 18:12063780-12063802 TAGAGAAGGGAGCAGGTGGCCGG + Intergenic
1154195703 18:12264847-12264869 TAGAAAGTGGAGAAGTTGGCCGG - Intronic
1154470576 18:14696427-14696449 TATAAAAAGTATCAGGTGGCTGG + Intergenic
1154989182 18:21583997-21584019 GAGAAAAAGGAGATGGTGGAAGG + Intronic
1155559031 18:27055390-27055412 TAGAAAAAGTGGAAGGTGGTAGG + Intronic
1155944651 18:31834762-31834784 TAGAAGAAAGAATAGGTGACAGG - Intronic
1156477443 18:37414884-37414906 TAGATAGATGAGTAGGTGGGTGG - Intronic
1156701862 18:39835503-39835525 TAGGAAAAGGAGTTGTAGGCAGG - Intergenic
1157153753 18:45244628-45244650 AAGAAAAAGGAGTGGGGGGGTGG + Intronic
1157593935 18:48852457-48852479 TAGAAAAAGTTGGAGGTGGGGGG - Intronic
1157926806 18:51775639-51775661 TAGATAAAGGAGTAGGGAGAAGG - Intergenic
1159235519 18:65667898-65667920 AATAAAAAGGAGTGGGTGGCTGG - Intergenic
1159977877 18:74738441-74738463 AAAAAAAAGGAGAAGTTGGCCGG + Intronic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1161172283 19:2818712-2818734 AAGAACAAAGAATAGGTGGCCGG + Intergenic
1161861495 19:6801616-6801638 TAGAAAAAAGGGTGGGTGGAGGG - Intronic
1161865710 19:6830789-6830811 AAGAAAATAAAGTAGGTGGCTGG + Intronic
1162992339 19:14311750-14311772 TAGAAATAGGAGTTGGAGCCAGG + Intergenic
1163499396 19:17666956-17666978 TAGAAAAAAGACTAGGGGCCAGG + Intronic
1164588304 19:29491501-29491523 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1164720680 19:30429582-30429604 TCGAAAAAGGATCAGGTGACTGG - Intronic
1164863850 19:31587486-31587508 TATAAAAAGGGGTAAGTGCCAGG - Intergenic
1164973023 19:32548755-32548777 AAGAAAAAGGTGAATGTGGCCGG + Intergenic
1165674543 19:37710166-37710188 AAGAAAATGGAGTGGATGGCCGG + Intronic
1166391260 19:42410163-42410185 TACAGAAAGGAGAAGTTGGCTGG - Intronic
1167563330 19:50239843-50239865 TAGAAAAAGGTGTGTGTGGCCGG - Intronic
1168276935 19:55284019-55284041 GAGAGAAAGGACGAGGTGGCGGG + Intronic
1168565532 19:57419175-57419197 CAGTAAAAGGAACAGGTGGCTGG - Intronic
1168650866 19:58091383-58091405 TAGAAAAAAGCGTAGGGAGCGGG + Intronic
1168711472 19:58502908-58502930 TAGAAAGATGGATAGGTGGCTGG + Intronic
925449063 2:3952813-3952835 TAGAAAAAGCACTAACTGGCCGG - Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925765990 2:7235825-7235847 TAGCCATAGGAGTGGGTGGCTGG + Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926948583 2:18216492-18216514 AAAAAAAAGGAGTGGGAGGCGGG + Intronic
928477243 2:31641032-31641054 TGGAAAAATGAGTAGATGGGAGG - Intergenic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929325968 2:40611052-40611074 GAGAAAGAGGAGGAGGTGCCGGG + Intronic
929719184 2:44349666-44349688 TAGAAAAAAGAATACGAGGCCGG + Intronic
930063266 2:47308579-47308601 AAAAAAAAAGAGAAGGTGGCAGG - Intergenic
930126749 2:47804381-47804403 AAGAAATAGTAGTAGTTGGCTGG + Intronic
930261977 2:49157559-49157581 TAGAAAATGTAATAAGTGGCTGG - Intergenic
930296048 2:49555299-49555321 CAGAATAAAGAGTAAGTGGCAGG - Intergenic
930365518 2:50434376-50434398 TAGAAAAAGCAAAAGATGGCCGG - Intronic
930470079 2:51801366-51801388 GAGAAAAAGGAGGAGTTGCCAGG + Intergenic
930837816 2:55813286-55813308 TAGAGAAAAGAGTAGATGGGGGG - Intergenic
930967511 2:57348190-57348212 TTGTAAAAGGTGTAGGGGGCAGG + Intergenic
931019232 2:58024136-58024158 TAGAGACAGGATTTGGTGGCCGG - Intronic
931764414 2:65442210-65442232 TAGAAAAAGGAATAGAAGGCCGG + Intergenic
932056339 2:68447801-68447823 TTCAAAAAGGAAAAGGTGGCCGG - Intergenic
932372754 2:71206278-71206300 TAGATAAAGGAGTTTGTGTCTGG + Intronic
932387669 2:71352178-71352200 TATAAAGAGGAGGAGGGGGCCGG + Intronic
933483852 2:82893639-82893661 TAGAGAAATAAGTAGGTGGCAGG - Intergenic
933661725 2:84933056-84933078 AAGAAGAAGAAGTAGGGGGCAGG + Intergenic
933883162 2:86692219-86692241 TATAAAAAGGATAATGTGGCTGG + Intronic
934046492 2:88176988-88177010 AAGACAAGGGAGTAGGAGGCAGG - Intronic
934133924 2:88976834-88976856 TAGAAATAGGAAAAGGTAGCTGG + Intergenic
934744599 2:96750887-96750909 CAGAAAGAGGGGTTGGTGGCAGG + Intergenic
934777758 2:96949931-96949953 GCGACACAGGAGTAGGTGGCAGG + Intronic
935277865 2:101491364-101491386 TAGAAATAGGAACAGGGGGCTGG + Intergenic
936476035 2:112840570-112840592 TAGATATATGAGCAGGTGGCTGG + Intergenic
936477392 2:112851246-112851268 AAGAAAATGGAGAAGGTGCCAGG + Intergenic
937959128 2:127441266-127441288 TAGAAAAGTGAATAGGTGGCTGG + Intronic
938236406 2:129709945-129709967 TTGAAAAAGGAGAAGGTGAAAGG - Intergenic
938310516 2:130285883-130285905 TAGAGAAGGGAGCAGGTGGTCGG - Intergenic
938444411 2:131366484-131366506 TAGAGAAGGGAGCAGGTGGTCGG + Intergenic
938834547 2:135086957-135086979 TAAGAAAACGATTAGGTGGCTGG - Intronic
938935254 2:136121903-136121925 TAGAGAAAGGAGGAGGTGCCAGG + Intergenic
939107204 2:137963123-137963145 TATAAAAGGGAGTTGGGGGCTGG + Intergenic
939224175 2:139344247-139344269 GAGAAAGTGAAGTAGGTGGCTGG + Intergenic
939582992 2:143973492-143973514 TAGAAAAATGAGAAATTGGCCGG + Intronic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940938857 2:159533255-159533277 TAGAAAAAGGATTATGTATCAGG - Intronic
941085099 2:161108172-161108194 TAGAAAATGTAGCAGGTGGTAGG - Intergenic
941272798 2:163451382-163451404 TTAAAAAAAGAGTAGCTGGCCGG - Intergenic
941719649 2:168799773-168799795 AAGGACAAGGAGCAGGTGGCTGG - Intronic
941831332 2:169963446-169963468 TAGAAAAAGGATGAAGTGGTAGG - Intronic
942044824 2:172094445-172094467 AAAAGAAAGGAGGAGGTGGCAGG - Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
944355570 2:198783647-198783669 TGGAGAAAGGAATAGGTGGGGGG - Intergenic
944382972 2:199132867-199132889 TGTAAAAAGGAGTAAGAGGCCGG - Intergenic
944614147 2:201442844-201442866 TAGAGAAAGAACTGGGTGGCTGG + Intronic
944907373 2:204276023-204276045 AAGCCAAAGCAGTAGGTGGCTGG - Intergenic
944908981 2:204290772-204290794 TTGAAAGAGGACAAGGTGGCTGG + Intergenic
944932720 2:204536226-204536248 GAGAAAGAGGGGTAGGGGGCAGG + Intergenic
945730622 2:213528284-213528306 TAGAAAAAGTAGTCTTTGGCAGG + Intronic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946829013 2:223708489-223708511 TAGAAAAAGGGACATGTGGCTGG - Intergenic
948276027 2:236709505-236709527 GAGAAATAGGACAAGGTGGCTGG + Intergenic
1170283089 20:14673620-14673642 TATAAAATGGAAAAGGTGGCTGG + Intronic
1170497185 20:16937191-16937213 TATAAAAAGAAATAGGTGCCGGG - Intergenic
1170577894 20:17678401-17678423 AAGAAAAAGGAGTGGGAGGGGGG - Intronic
1170939877 20:20839938-20839960 TAGACAGAGGAGGAGGTGCCAGG - Intergenic
1171278796 20:23879821-23879843 TAGAAAGAGGAGGAGGAGCCAGG - Intergenic
1171479889 20:25446328-25446350 TAGAAAAAGGAGTAGGGGCCGGG - Exonic
1172129117 20:32644150-32644172 TAGAAAAAGGAGTTGTAGCCAGG + Intergenic
1172543879 20:35743926-35743948 TAAAAAAAAAACTAGGTGGCAGG + Intergenic
1172979143 20:38927793-38927815 TAGAAAAAGCGGCAGGGGGCCGG - Intronic
1173820633 20:46017971-46017993 GAGAAAAAGCAGTGGGTGTCTGG + Intergenic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174291477 20:49512042-49512064 TAGATAAATGAGTGGGTGGATGG + Intronic
1174429002 20:50454352-50454374 TAGCAAAAGGTGGAGGTGGGGGG - Intergenic
1174528932 20:51195656-51195678 GAGAAAAGGGAGGAGGTGCCGGG + Intergenic
1174827930 20:53785686-53785708 CAGAAAAAGGTGTATTTGGCAGG - Intergenic
1174886027 20:54335423-54335445 TAGAAAAAGGAAGAGGTCTCTGG + Intergenic
1174992980 20:55534186-55534208 AAGAAAAGGAAGAAGGTGGCCGG + Intergenic
1175081557 20:56424878-56424900 TAGATGAGGGAGGAGGTGGCTGG + Intronic
1175102102 20:56586597-56586619 AAAAAAAAGGAGTGGGGGGCGGG + Intergenic
1175172152 20:57088315-57088337 TAGAGAAAGGGGTTGGTGTCGGG + Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176735541 21:10542825-10542847 TATAAAAAGGAGCAGGTCGTAGG + Intronic
1176803906 21:13461439-13461461 TATAAAAAGTATCAGGTGGCTGG - Intergenic
1177073221 21:16538209-16538231 TAAAAAAACGTGTATGTGGCTGG + Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177659335 21:24062619-24062641 TAGAAAATGGAGATGGTGGTCGG - Intergenic
1178110682 21:29367104-29367126 CAGAAAGAGGAGGAGGTGCCAGG - Intronic
1178595164 21:33946884-33946906 TAGAAAAGGTAATAGTTGGCCGG - Intergenic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179389890 21:40978241-40978263 TAGAAAAGAGAGTACCTGGCAGG + Intergenic
1180031379 21:45210818-45210840 CAGGAAAAGGAGGAGCTGGCAGG + Intronic
1180226799 21:46398327-46398349 AAGAAAAGCGAGTGGGTGGCAGG - Intronic
1181130441 22:20728463-20728485 TAGGAAAAGGAGTAAGAGGCAGG - Intronic
1181975484 22:26726351-26726373 TAGAATGAGGAGTAAGTGACAGG - Intergenic
1182901328 22:33900748-33900770 TATAAAAAGGGGAAGCTGGCTGG + Intronic
1183032275 22:35115168-35115190 TAGAAAAGGAAGGTGGTGGCTGG + Intergenic
1183255728 22:36760645-36760667 TAGAAACAGGACTAGGAGTCAGG - Intronic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183266921 22:36833582-36833604 CAGAAATAGCAGTAAGTGGCAGG + Intergenic
1183741199 22:39669570-39669592 TAGATAAATGAATGGGTGGCTGG + Intronic
1184361454 22:44021387-44021409 GAGAAAAAGGAGCAGGTGAAAGG + Intronic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184728211 22:46358226-46358248 CAGAAACATGAGTAGGTGGGAGG + Intergenic
949908840 3:8883087-8883109 GAGAAAAAGGAGTATGTGAGGGG + Intronic
950225470 3:11230080-11230102 GAACAAAAGGAGTAGGTGGCTGG + Intronic
950350038 3:12340886-12340908 AATAAAAAGGATTAGATGGCTGG + Intronic
950642379 3:14356713-14356735 TAGTAAAAGGAGAAACTGGCCGG + Intergenic
951036183 3:17934855-17934877 TAGAAAAAGGAGTGTTTGGCAGG - Intronic
951184673 3:19699342-19699364 TAGATAAATGAGTGGGTGGATGG - Intergenic
952246553 3:31599103-31599125 TAAAAAAATATGTAGGTGGCTGG - Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952432611 3:33238611-33238633 GATAAAAAGAAGAAGGTGGCCGG + Intergenic
952486500 3:33816853-33816875 GAGAATAAGGAGCAGATGGCAGG + Intronic
953612470 3:44458701-44458723 GAGAAAAAGGAGCAGGTGAAAGG - Intronic
953915688 3:46919544-46919566 TAGAAACAGAAGTGGCTGGCCGG + Intergenic
954008635 3:47614950-47614972 GAGACAAGGGAGTAGGTGGGTGG - Intronic
954255191 3:49400303-49400325 TAGAAACAGGAGGTGGTGGGGGG - Intronic
954788836 3:53115537-53115559 GAGAGAAAGGAAAAGGTGGCGGG - Intronic
954843196 3:53531146-53531168 TACAAAAATGAGGAGGAGGCTGG - Intronic
954912745 3:54122542-54122564 CAGAAAAAGGAGCGGGTGGGGGG - Intronic
955238084 3:57157380-57157402 AAGACAAAGGAGTAGGGGCCTGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955475140 3:59328784-59328806 TGGAAAAAGGGAAAGGTGGCTGG + Intergenic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956272422 3:67462199-67462221 AAGAAAAAGGAGCAGGTGAAAGG - Intronic
956988701 3:74736504-74736526 TAGAAAAAGTTGGCGGTGGCTGG - Intergenic
957546416 3:81643988-81644010 TATAAAAATGGATAGGTGGCTGG - Intronic
957785176 3:84873511-84873533 TAGAAAAAGGAGTATTAGGCTGG + Intergenic
957960629 3:87246431-87246453 TAGAAAAAGGGATTGTTGGCTGG - Intronic
959034658 3:101346940-101346962 TAAAAAAAGGAGGAGGAGGGAGG + Intronic
959972818 3:112426404-112426426 AAGAAAGAGGAGGAGGTGCCAGG + Intergenic
960016806 3:112900204-112900226 TAGAAAAAGGAGTATGTGGAGGG + Intergenic
960018915 3:112926961-112926983 TAGAAGAAGAAGTATGTGGAGGG + Intronic
960651705 3:119958374-119958396 TCGAAAAAGGGGTGGGTGGGTGG + Intronic
960720312 3:120618883-120618905 TAGAGGAAGGTGCAGGTGGCGGG + Intergenic
960850499 3:122047933-122047955 AAGAAAAAGAAATAGGTGGGAGG - Intergenic
961460875 3:127049619-127049641 AAGACAAAGGAGGAGCTGGCAGG + Intergenic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
963095798 3:141537978-141538000 TAGAAACAGCAGTTGCTGGCAGG - Intronic
963771618 3:149392052-149392074 GAGAAAAAGAGGTAGGTGGAGGG - Intergenic
964316361 3:155448732-155448754 TAGAAAAAGGGGTAGGAGAATGG - Intronic
964455592 3:156862260-156862282 TAGAAAAAATAATAAGTGGCTGG - Intronic
964976399 3:162625503-162625525 TATAAAATAGACTAGGTGGCTGG + Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
966601684 3:181781758-181781780 TGTAAAAAGGAGTGAGTGGCTGG - Intergenic
966676958 3:182600065-182600087 TAAAAAAAAGAGGGGGTGGCTGG + Intergenic
966702007 3:182863755-182863777 TAGAAAAAAGATTAGATGGTAGG - Intronic
967472974 3:189884396-189884418 TAGAAAAAACAATAGGTGCCAGG + Intronic
968032895 3:195518073-195518095 AAGTACAAGGAGTAGGTGGTGGG + Intronic
968166236 3:196467459-196467481 TTGAGAAGGGAGTATGTGGCTGG - Intergenic
968219352 3:196923956-196923978 AAGAAAAATGAGTAGGTTTCCGG + Intronic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969543501 4:7808814-7808836 GAGAAAGAGGAGCAGGTGCCAGG - Intronic
970397100 4:15680034-15680056 TACAAAATGGAGTATGTGACAGG + Intronic
970536216 4:17032042-17032064 TAGAAAGAGGAGCAGGTTTCTGG - Intergenic
970736318 4:19173095-19173117 AAGGAAAAGGAGTAGGTTGGTGG - Intergenic
971919800 4:32923107-32923129 AAGACAAAGGAGCAGGTGGCTGG - Intergenic
972374808 4:38460299-38460321 CAGAGGAAGAAGTAGGTGGCTGG - Intergenic
972785033 4:42318725-42318747 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974624778 4:64411194-64411216 TAAAAAAAGGAATAGTTGGCTGG + Intergenic
975719425 4:77235562-77235584 AAGTACAAAGAGTAGGTGGCAGG + Intronic
975838835 4:78453250-78453272 AAGAAAAAGGAGGCAGTGGCAGG + Intronic
976199598 4:82564986-82565008 TATAAAAAGGAGTAAGAGGCCGG - Intergenic
976241674 4:82964348-82964370 AAGAAAAAAGAGTAAGTGGCTGG - Intronic
976283604 4:83349278-83349300 GAGAAAAATGAGTAGGAGGATGG - Intergenic
976737917 4:88329195-88329217 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
977530198 4:98192181-98192203 TATAAAAAGAAACAGGTGGCCGG - Intergenic
977598562 4:98911361-98911383 TAGAAAGAGTTGTAGGAGGCTGG + Intronic
977614668 4:99074827-99074849 TATAAAAAAAATTAGGTGGCTGG + Intronic
977629080 4:99221564-99221586 TAGAGAAAGGAGTCGCAGGCTGG + Intergenic
977971088 4:103215277-103215299 TGGAAAAAGTAGTAGGGGGCTGG + Intergenic
978287506 4:107095855-107095877 TAGTAAAAGGAGTAGCTTTCAGG + Intronic
978309539 4:107371224-107371246 TATAAGAAGAAATAGGTGGCTGG + Intergenic
978384990 4:108169319-108169341 GAGGAAAAGGAGTGGGTGGGTGG - Intergenic
979005697 4:115293507-115293529 TAGAAAAAGGATTTGCTGTCAGG + Intergenic
979691958 4:123568837-123568859 TAAAAAAGGGAGTTGGTGGCCGG - Intergenic
980125676 4:128771689-128771711 TAGAAATTGGAGTAGAAGGCCGG + Intergenic
980387687 4:132107592-132107614 CAAAAAAAGTAGGAGGTGGCGGG + Intergenic
980669482 4:135986075-135986097 GAGAAAGAGGAGAAGGTAGCTGG + Intergenic
982253524 4:153431214-153431236 CAGAAAAAGGAGTAGGTTGTAGG + Intergenic
983557767 4:169073757-169073779 TATAAAAAGCAGAATGTGGCCGG + Intergenic
983802231 4:171946993-171947015 TAGAAAATGGATTAGATGTCGGG + Intronic
984167912 4:176324990-176325012 TAGGAAATGGAGTGGGTAGCCGG + Intronic
987183695 5:15392526-15392548 TAGAAAAAGGAGAAATCGGCCGG + Intergenic
987375200 5:17227698-17227720 TAGAAAAATGAGTTATTGGCCGG - Intronic
988314767 5:29610462-29610484 TAGAAAAAGGAGTCAAAGGCCGG + Intergenic
988516311 5:31907786-31907808 TAAGAAAAGGATCAGGTGGCTGG + Intronic
989539914 5:42606504-42606526 AAGAAAGAGGAGAAGGTGCCAGG + Intronic
990045027 5:51418597-51418619 TGGAAAAAGCAGTACGGGGCTGG + Intergenic
991340653 5:65604527-65604549 TAGGAAAAGGAGTAGGTAAAAGG + Intronic
992164665 5:74037773-74037795 TAGAAAAAGAAGTATTTAGCAGG - Intergenic
992418626 5:76578606-76578628 TAGAAAAAGAATGATGTGGCCGG - Intronic
994322028 5:98405347-98405369 TAGAAGAAGGGGTAGGCAGCTGG - Intergenic
994610084 5:102024924-102024946 CAAAAAAAAGAGTAGGTTGCAGG + Intergenic
994749309 5:103719209-103719231 TAGAAATAGGAGTGGGCGGGGGG - Intergenic
994766989 5:103931000-103931022 TATAAAATGGAGTCTGTGGCCGG - Intergenic
995259244 5:110082632-110082654 TTGAAATAGAGGTAGGTGGCTGG - Intergenic
996118808 5:119648296-119648318 TAGAAAAAGGGTCTGGTGGCTGG + Intergenic
996545469 5:124673699-124673721 TAGAAAATGGAGTAGGGGAGAGG + Intronic
997294402 5:132760790-132760812 GACAAGAAGAAGTAGGTGGCAGG - Exonic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
998552442 5:143090517-143090539 TAGAGGAAGGTGCAGGTGGCGGG + Intronic
998978958 5:147679275-147679297 TAGAAAATGTAGTTGGAGGCTGG - Intronic
1000088365 5:157908662-157908684 TAGCAAAAGGAGTAGGGAGCAGG + Intergenic
1000440437 5:161256845-161256867 CAGAAAAAGTGGGAGGTGGCTGG - Intergenic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1001082247 5:168676021-168676043 TAGATAAATAAGTAGGTGGGTGG - Intronic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1002062458 5:176633903-176633925 TAGAAAGATCAGTAGGAGGCTGG + Intronic
1002548247 5:179967152-179967174 GAGAAGAAGGAGTAGGTAGGTGG - Intronic
1003227083 6:4215725-4215747 AAGAAAGAGGAGGAGGTGCCAGG - Intergenic
1003228560 6:4228731-4228753 TAGAAAAATGAGTAGAAGGCTGG + Intergenic
1003362461 6:5441216-5441238 TAGAAAATGGACTGAGTGGCTGG - Intronic
1003463125 6:6351065-6351087 TGAAAAAAGGGGAAGGTGGCTGG + Intergenic
1003760226 6:9171889-9171911 TAGAGAAAGGGGTGGGTGGTGGG - Intergenic
1003860556 6:10318715-10318737 TATAAATAAGAGTAGGTGCCCGG - Intergenic
1004538517 6:16526466-16526488 TAGAATATTCAGTAGGTGGCCGG + Intronic
1004725339 6:18306183-18306205 TAAAAAAAGGGGTTGGGGGCGGG - Intergenic
1005966635 6:30731186-30731208 TAAAAATAGGAGCCGGTGGCCGG + Intronic
1007475658 6:42118260-42118282 TAGAGGCAGGAGTAGGTGGGAGG + Intronic
1007647456 6:43393976-43393998 AAGAAAAATGAGTAAGGGGCTGG + Intergenic
1008004302 6:46393745-46393767 GAGAAAAAGTAATAGGTGGTTGG - Intronic
1008068787 6:47078686-47078708 TAGAAAAAGTACTCGGAGGCTGG + Intergenic
1008908880 6:56711793-56711815 TAAAAATAGGAGGAGGTGGCCGG + Intronic
1010521285 6:76841174-76841196 TAGAAAAAACACTAGGTGGATGG + Intergenic
1011130400 6:84046483-84046505 TATAAAAAGGAGAATTTGGCTGG + Intronic
1011515716 6:88150334-88150356 GAGAAAAAAAACTAGGTGGCTGG - Intronic
1011675742 6:89731805-89731827 GAGAAAAAGGAAAAGGTGGGGGG - Intronic
1011813618 6:91161738-91161760 TAGAAAGAGGAAGAGTTGGCCGG - Intergenic
1012295080 6:97512367-97512389 GAGAAAATGGGGTAGGTGCCTGG + Intergenic
1013287839 6:108696224-108696246 TGATAAAAGGAGTAGGTGGTGGG + Intergenic
1013314024 6:108924219-108924241 TTGAAAAATGAGCAGGAGGCCGG + Intronic
1013715150 6:112951141-112951163 TAGAAATAGGAGGAACTGGCCGG - Intergenic
1014006917 6:116429650-116429672 TAGAAATATGAGGAGTTGGCCGG + Intronic
1014249084 6:119097792-119097814 GAGAAAAAGGAGCAGGTGAAAGG - Intronic
1014273564 6:119361808-119361830 CAGAAAAAGAAGTAGGTACCTGG - Intergenic
1014677789 6:124389255-124389277 TAGAAAAAGTAGTGGGAGGTGGG - Intronic
1014721943 6:124927391-124927413 TAAAAAAAGGCCTAAGTGGCTGG - Intergenic
1014871709 6:126604014-126604036 TAGACAGAGGAGGAGGAGGCAGG - Intergenic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1018226609 6:161635166-161635188 TAGAAAAAAGAGTAGATTTCTGG + Intronic
1018227257 6:161640127-161640149 TGGAAAAAGGATTAAGTGGTTGG - Intronic
1018336172 6:162792302-162792324 CAGAAATAGGAGTAAGGGGCAGG + Intronic
1018897069 6:168027154-168027176 TAGAAAAAGGGAAAGGTGGCCGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020178432 7:5901736-5901758 TAGAGATAGGGGTAAGTGGCTGG - Intronic
1020728202 7:11843736-11843758 TAGAAAAGAGAGAAGGGGGCAGG - Intergenic
1021158857 7:17246846-17246868 GAGAAAAAGGAGAAGGTGAAAGG - Intergenic
1021316003 7:19147708-19147730 AAGAAAAAGGAGTAAGGGGGAGG - Intergenic
1021617475 7:22517713-22517735 AAGAACAAGGAATAGCTGGCTGG - Intronic
1021649405 7:22818998-22819020 TAGAAAAAGGACGGGGTGGAGGG + Intronic
1022011005 7:26308216-26308238 GAGAAAAAGGAGCAGGTTGAAGG - Intronic
1022399095 7:30018964-30018986 TAGAAAGAGGAGTAGGAAGAAGG + Intronic
1022886617 7:34653338-34653360 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1022888160 7:34667648-34667670 TAAAGACAGGAGTAGGTGGTTGG + Intronic
1022927061 7:35067127-35067149 AAGAACAAGGAATAGCTGGCTGG - Intergenic
1023225144 7:37961293-37961315 CAGTAAAAGCAGGAGGTGGCTGG - Intronic
1023541633 7:41272405-41272427 TATAAAAAGGAGTAGAAGCCAGG - Intergenic
1025032377 7:55568373-55568395 TAGAAAAAGGAACAGTTGTCAGG - Intronic
1025245666 7:57314890-57314912 TAGCAAAAGGTGGAGGTGGGGGG + Intergenic
1025869338 7:65416021-65416043 TTGAAAAAGGATTAGATGGATGG + Intergenic
1026719309 7:72817105-72817127 TAGAAAAAGGACAGGTTGGCCGG + Intronic
1027512549 7:79101426-79101448 TAGAAAAAGGAAAATGGGGCCGG + Intronic
1027548054 7:79555267-79555289 TAGAAAAAAGACTACCTGGCCGG - Intergenic
1027784686 7:82566105-82566127 AAGAAAGAGGAGAAAGTGGCCGG - Intergenic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1028375202 7:90138397-90138419 AAGAACAAGGAATAGCTGGCTGG + Intergenic
1028544783 7:91985941-91985963 TAGAAAAAGGGGGAATTGGCTGG - Intronic
1028754695 7:94421772-94421794 TAGACCAAGGAGTAGGAGGTAGG - Intronic
1029026062 7:97418169-97418191 TAGCACAGGGAGTATGTGGCTGG - Intergenic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1030731525 7:112995538-112995560 TAGAAAATGGAGTAGATACCAGG - Intergenic
1030954436 7:115834333-115834355 TAGAAATAAAAGAAGGTGGCAGG - Intergenic
1031515525 7:122693657-122693679 TATAAAAGGGAGTAAGAGGCTGG + Intronic
1031555340 7:123168271-123168293 TAGAAAAGGAAGCAAGTGGCAGG + Intronic
1032356924 7:131219916-131219938 TAGAGAAACTAGCAGGTGGCAGG - Intronic
1032763124 7:134963900-134963922 TAGAAAAGGGACTTTGTGGCTGG + Intronic
1035734219 8:1876120-1876142 TAGAAATATGGGTAGGTGGATGG - Intronic
1036155973 8:6342124-6342146 TTTAACAAGGAGTTGGTGGCCGG + Intergenic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1037999752 8:23381636-23381658 TAGAAAAAGGGGTATAAGGCAGG - Intronic
1038041148 8:23725421-23725443 TAGAAAGTGCAGAAGGTGGCTGG + Intergenic
1038349696 8:26764563-26764585 TGGAAAAAGGAGTCGGAGGCTGG + Intronic
1040778745 8:51080234-51080256 TAGAAAAAGTGGTAGTCGGCTGG + Intergenic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1042861854 8:73322352-73322374 TAGAAAGAGGAGAAGGTGTTTGG - Intronic
1045475978 8:102553064-102553086 TGGAAAAAGCAATAGGAGGCCGG + Intronic
1046901766 8:119531049-119531071 TAGAAAAAGGAGGTTGGGGCTGG - Intergenic
1047056302 8:121168300-121168322 TAGAAAAGCAAGTAGATGGCCGG - Intergenic
1048010132 8:130448793-130448815 CAGAGAAGGGAGTAGGTGGTGGG + Intergenic
1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG + Intergenic
1048649512 8:136459420-136459442 TAGAAAAAAGAGTCAGTGACTGG + Intergenic
1050282182 9:4061962-4061984 TAAAAAATGGGGAAGGTGGCAGG + Intronic
1050602466 9:7266820-7266842 TAGGAACAGGGGTAGGGGGCCGG - Intergenic
1051401390 9:16687329-16687351 TAGACCAAGGAGCAGGTAGCAGG - Intronic
1051421401 9:16892959-16892981 TAGAAAAAGGACCCTGTGGCTGG + Intergenic
1051598510 9:18849192-18849214 TTAAAACAGGACTAGGTGGCAGG + Intronic
1051989305 9:23131950-23131972 TAGAAAAAGGAATAGATGGCAGG - Intergenic
1052193931 9:25689441-25689463 TAGAAAAAGTAGCACCTGGCCGG + Intergenic
1052870451 9:33501155-33501177 TATAAAAAGGAGTAGTGGCCGGG + Intergenic
1053247388 9:36545782-36545804 TATAAAAAAGAATAGGCGGCCGG + Intergenic
1053830698 9:42077049-42077071 TCAAAAAAGGAGCTGGTGGCTGG - Exonic
1054599861 9:67110388-67110410 TCAAAAAAGGAGCTGGTGGCTGG + Intergenic
1054900992 9:70369545-70369567 TAGAAAATGTAGGAAGTGGCAGG + Intergenic
1055298150 9:74854572-74854594 GAGAAGAAGGAGGAGGTTGCTGG - Intronic
1055473957 9:76643000-76643022 TGGCAAAGGGAGGAGGTGGCAGG + Intronic
1055810610 9:80143678-80143700 TAGAAAAAAGAGAAGTTGGTCGG + Intergenic
1057021146 9:91698642-91698664 GAGAAAAAGGAGCAGGTGGAAGG - Intronic
1057842978 9:98501139-98501161 AAAAAAAAGGAGCAGGGGGCGGG - Intronic
1058575863 9:106400413-106400435 TAGAGATAGGAGAAGGTAGCAGG + Intergenic
1058716018 9:107722549-107722571 TTGAAAAAGAAGTAGGGGCCAGG - Intergenic
1058770555 9:108227129-108227151 TGGAAAAAGGAGAAGGTGCTGGG - Intergenic
1059698760 9:116755064-116755086 TAGAAGCCGGAGTTGGTGGCAGG - Intronic
1059821442 9:117977951-117977973 TAGAAGAAGAAATAGTTGGCTGG + Intergenic
1060189507 9:121583089-121583111 TAGAAAACGGAGAAGCTGGCCGG + Intronic
1060431689 9:123556270-123556292 GATAAAAAGGAGTAGGAGGGTGG + Intronic
1060677107 9:125525375-125525397 TAGAAAAAGTAACAGGAGGCCGG + Intronic
1061025235 9:128044158-128044180 TAGAAAAATGGAAAGGTGGCTGG + Intergenic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061812310 9:133169411-133169433 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
1186284222 X:8026855-8026877 TGGAAAGATGAGTAGGTGGGTGG - Intergenic
1186337494 X:8606390-8606412 TAGAAAAACTGGTAGGTGGGAGG + Intronic
1186687994 X:11945673-11945695 GAGAGAGAGGAGTAGGTGCCAGG + Intergenic
1186900161 X:14045893-14045915 GAGAAAAAGGGGTTGGAGGCTGG + Intergenic
1186974970 X:14892342-14892364 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1187013278 X:15301730-15301752 TTGAAAAATGAGTAGGGGCCTGG - Intronic
1187997830 X:24947565-24947587 TAGAAAAATCTGCAGGTGGCTGG - Intronic
1188526617 X:31094424-31094446 TAGAAAAGGGAGGAGGTCCCCGG - Intergenic
1189338744 X:40187884-40187906 AAAATAAAGGAGTAGGTTGCTGG - Intergenic
1189463860 X:41263444-41263466 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
1190833767 X:54081853-54081875 TGGAAAAAAGAGTAGGTAGCGGG - Intronic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1192079611 X:68033836-68033858 GAGAAAGAGGAGGAGGTGCCAGG - Intergenic
1192336389 X:70223867-70223889 TAGAGAAAGGAGTAGGAAGTGGG - Intergenic
1192444285 X:71198948-71198970 TTGAAAAAGGCGAAGCTGGCTGG - Intergenic
1192448076 X:71225044-71225066 AAGGAAAAGGAGGAGGTGTCTGG + Exonic
1195195658 X:102495402-102495424 TAGATAAAGAAATAGATGGCTGG - Intergenic
1195302302 X:103542634-103542656 TAGAGAAAAGAGGAGGTGCCTGG - Intergenic
1198385701 X:136127558-136127580 TAGAGTATTGAGTAGGTGGCGGG + Intergenic
1198634380 X:138679373-138679395 TAAAAAATGGAGTATGGGGCTGG - Intronic
1198714479 X:139542277-139542299 TAAAAAAAGGAAAAGGTGACAGG + Intronic
1199049302 X:143218213-143218235 TAGAAAAAGGAGTGGGGAGGAGG - Intergenic
1199278666 X:145974564-145974586 TAGAGGAAGGTGGAGGTGGCGGG - Intergenic
1199284644 X:146042498-146042520 TAGAAAGAGGAGGTGGGGGCCGG + Intergenic
1199502813 X:148527746-148527768 TAGAATGAGGATGAGGTGGCGGG - Intronic
1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG + Intronic
1200751047 Y:6944549-6944571 TAGGGGAAGGAGTAGGTAGCAGG - Intronic
1201546993 Y:15176264-15176286 GAGAGGAAGCAGTAGGTGGCTGG - Intergenic
1201902432 Y:19057336-19057358 CAGAACAAGGTGTGGGTGGCAGG + Intergenic