ID: 1103036636

View in Genome Browser
Species Human (GRCh38)
Location 12:117662259-117662281
Sequence GTGTCTTGACAGAAGTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103036636_1103036640 3 Left 1103036636 12:117662259-117662281 CCAGCAAACTTCTGTCAAGACAC 0: 1
1: 0
2: 1
3: 17
4: 197
Right 1103036640 12:117662285-117662307 CCTCTCCTCCCTCTCTTCTGGGG 0: 1
1: 1
2: 6
3: 78
4: 641
1103036636_1103036644 18 Left 1103036636 12:117662259-117662281 CCAGCAAACTTCTGTCAAGACAC 0: 1
1: 0
2: 1
3: 17
4: 197
Right 1103036644 12:117662300-117662322 TTCTGGGGAGTAATGAACCTTGG 0: 1
1: 0
2: 0
3: 5
4: 136
1103036636_1103036638 2 Left 1103036636 12:117662259-117662281 CCAGCAAACTTCTGTCAAGACAC 0: 1
1: 0
2: 1
3: 17
4: 197
Right 1103036638 12:117662284-117662306 GCCTCTCCTCCCTCTCTTCTGGG 0: 1
1: 0
2: 7
3: 62
4: 557
1103036636_1103036637 1 Left 1103036636 12:117662259-117662281 CCAGCAAACTTCTGTCAAGACAC 0: 1
1: 0
2: 1
3: 17
4: 197
Right 1103036637 12:117662283-117662305 AGCCTCTCCTCCCTCTCTTCTGG 0: 1
1: 0
2: 4
3: 46
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103036636 Original CRISPR GTGTCTTGACAGAAGTTTGC TGG (reversed) Intronic
900572931 1:3368300-3368322 CTGTCTGGAGAGAAGTTTGCGGG + Intronic
903709749 1:25314653-25314675 TTGTCTATACAGAAGTTAGCTGG - Intronic
907272137 1:53297411-53297433 GTGTCCTGACAGTAGGGTGCAGG + Intronic
908145604 1:61238475-61238497 GTTTCTTGACAGAAGGGTACAGG - Intronic
911796942 1:102087962-102087984 GTGACTGGACAGATGTTTGGTGG - Intergenic
912474379 1:109926314-109926336 CTGGCTTGACAGAAGTTTATGGG - Intronic
912930792 1:113958877-113958899 CTCTGTTGACAGGAGTTTGCAGG - Intronic
913173835 1:116256175-116256197 GTGTCTTGACAGCAAAATGCAGG + Intergenic
913941132 1:125107434-125107456 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
914050630 1:144127306-144127328 CTGTCTTTAAAGACGTTTGCAGG + Intergenic
914128552 1:144838139-144838161 CTGTCTTTAAAGACGTTTGCAGG - Intergenic
915646367 1:157275594-157275616 GTGTTTACACAGAAGTGTGCAGG + Intergenic
916731733 1:167572731-167572753 GTTTCCAGACAGAAGTTTGAAGG + Intergenic
916822272 1:168411005-168411027 GTTTCTTGACTGAGGGTTGCAGG - Intergenic
917647000 1:177039111-177039133 GTCTCTTGACAGATGGTAGCTGG - Intronic
918223208 1:182455117-182455139 GTGACATGACAGAAGTTTTTAGG + Intronic
918532118 1:185535008-185535030 GTTTGTTGACAGAAGGTTACAGG + Intergenic
921973634 1:221177681-221177703 GTGTGTTGACAGGACTTTGCAGG - Intergenic
924722791 1:246638800-246638822 GTGTCCACACAGAAGTGTGCAGG + Intronic
1062949135 10:1484119-1484141 GTATCTTGACTGAAGCTAGCAGG - Intronic
1066781942 10:38959981-38960003 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1073982263 10:109168142-109168164 GTCTCTTGGCAGAAGAGTGCAGG + Intergenic
1076553116 10:131299263-131299285 ATGAATAGACAGAAGTTTGCAGG - Intronic
1078336009 11:10463765-10463787 GTTTTTGGAGAGAAGTTTGCAGG - Intronic
1079705609 11:23613720-23613742 ATGTCATGATAGATGTTTGCTGG - Intergenic
1080706659 11:34701624-34701646 GTGACTTGGCACAAGATTGCAGG + Intergenic
1087048690 11:93865729-93865751 GTGTCTACATAGAAGTGTGCAGG + Intergenic
1096859592 12:54515604-54515626 GTCTCTTTAGAGAAGTTTGGTGG + Intronic
1097558152 12:61166394-61166416 GTGTCCAGGCATAAGTTTGCTGG - Intergenic
1098362933 12:69672884-69672906 GTGCATTGACAGAAATTTGCAGG - Exonic
1099023148 12:77431892-77431914 GTGTGTTGATAGAAGATTCCTGG + Intergenic
1099861846 12:88231865-88231887 GTGTCTACACAGAAGTGTGCAGG - Intergenic
1103036636 12:117662259-117662281 GTGTCTTGACAGAAGTTTGCTGG - Intronic
1106981242 13:35284340-35284362 CTGTCTTTACAGTATTTTGCAGG + Intronic
1108721625 13:53138538-53138560 GTGCGTGGAGAGAAGTTTGCAGG - Intergenic
1111123239 13:83880631-83880653 TTGTCTTGAAAGGAGTTGGCAGG + Exonic
1114873918 14:26691751-26691773 GTATCTTAAGAGAAGTTTGAGGG - Intergenic
1114874429 14:26698063-26698085 GTGGCCTGACAGCACTTTGCAGG + Intergenic
1115009638 14:28529554-28529576 GTGTCTTCACAGTAGTTCGTAGG + Intergenic
1115122004 14:29948502-29948524 GTGTCCAGGCAGAAGTTTGCTGG - Intronic
1117834663 14:59791256-59791278 TTGTCTTGACAGAACTGTTCAGG - Intronic
1117982669 14:61357377-61357399 GTGACTACACATAAGTTTGCAGG - Intronic
1122790270 14:104181440-104181462 CTGTCTTGACCCCAGTTTGCTGG + Intergenic
1202938704 14_KI270725v1_random:120575-120597 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
1123394491 15:19917298-19917320 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1123420497 15:20126615-20126637 CTGTCTTTAAAGACGTTTGCAGG + Intergenic
1123445360 15:20326909-20326931 CTGTCTTTAAAGACGTTTGCAGG - Intergenic
1123529721 15:21133151-21133173 CTGTCTTTAAAGACGTTTGCAGG + Intergenic
1125262781 15:37846731-37846753 GTGTGGTGACAGGAGTTTGTGGG - Intergenic
1125827687 15:42690223-42690245 CTGGGTTGACAGAAGTCTGCAGG + Exonic
1129571713 15:76693150-76693172 ATGTCTTGGCAGAAGTTTTTTGG - Intronic
1130111414 15:80968450-80968472 GTGACTAGACAGAAGCTTGTAGG - Intronic
1133674181 16:8054319-8054341 GTGTGATGTCAGAAGTTTGAGGG + Intergenic
1135395819 16:22131011-22131033 GTGTCTTGGCTGAAGTATGTTGG + Intronic
1136697322 16:32095680-32095702 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
1136700520 16:32135414-32135436 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1136767135 16:32792051-32792073 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
1136797821 16:33038971-33038993 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
1136801013 16:33078650-33078672 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1136863392 16:33717436-33717458 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
1136869140 16:33788315-33788337 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1136872475 16:33820171-33820193 ATGTCCAGGCAGAAGTTTGCTGG - Intergenic
1136944840 16:34636636-34636658 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1136955180 16:34775742-34775764 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1136958904 16:34822167-34822189 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1136967027 16:34925474-34925496 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1137071195 16:35906307-35906329 GTGTCTACACAGAAGTGTGCAGG + Intergenic
1137085258 16:36112566-36112588 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
1137087628 16:36147583-36147605 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1137092072 16:36205756-36205778 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1137221762 16:46459860-46459882 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
1141884823 16:86884306-86884328 GTGGCTCCACAGAAGTCTGCAGG - Intergenic
1142195050 16:88735661-88735683 GTGTCTGGACACCTGTTTGCAGG - Intronic
1203069533 16_KI270728v1_random:1054297-1054319 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
1203099697 16_KI270728v1_random:1295897-1295919 ATGTCCAGGCAGAAGTTTGCTGG + Intergenic
1203103033 16_KI270728v1_random:1327753-1327775 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
1203124883 16_KI270728v1_random:1565583-1565605 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
1143638999 17:8184699-8184721 TTGTCTTGACACTAGTCTGCTGG - Intergenic
1145324235 17:21786660-21786682 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
1145326375 17:21832130-21832152 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1145711203 17:26980421-26980443 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1145965392 17:28913112-28913134 GTGTCTTGTCAGCTGTTTGCAGG + Exonic
1146503778 17:33386972-33386994 GTGTTTTGACAGAGTTTTGCTGG + Intronic
1146579723 17:34026139-34026161 GAGTCTTGCAATAAGTTTGCTGG + Intronic
1147624164 17:41888565-41888587 GACCCTTTACAGAAGTTTGCTGG - Intronic
1148293617 17:46479381-46479403 GCCACTTTACAGAAGTTTGCTGG + Intergenic
1148315803 17:46697083-46697105 GCCACTTTACAGAAGTTTGCTGG + Intronic
1150127747 17:62649197-62649219 CTGTCGTCACAGAAGTTGGCAGG + Intronic
1150370423 17:64632682-64632704 GTCTCTTGACAGAAGTCTGGAGG - Intronic
1152018728 17:77769285-77769307 GTGTCTTCACAGAAGAATGGTGG + Intergenic
1203182622 17_KI270729v1_random:77264-77286 GTCTCTAGACAGAAGTCTGTTGG - Intergenic
1203190558 17_KI270729v1_random:182760-182782 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1153136047 18:1918749-1918771 GTCTCTTTACAGAATTTTGAAGG - Intergenic
1154516638 18:15175051-15175073 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
1157349930 18:46875263-46875285 GTGACTGGACAGATGTTTGGTGG + Intronic
1157585574 18:48799017-48799039 GTGACTTGACAGGAGGTGGCTGG + Intronic
1161381910 19:3970059-3970081 GTGTCTGGAGAGAGTTTTGCGGG - Intronic
1168167008 19:54555526-54555548 GTGTCTGGAAAGATGTTTGTGGG - Intergenic
1202690037 1_KI270712v1_random:79944-79966 CTGTCTTTAAAGACGTTTGCAGG + Intergenic
926621863 2:15053810-15053832 GTGTCTTGAGGTAAGTGTGCAGG - Intergenic
927258824 2:21065429-21065451 TTGTCTTGACAGATGAATGCAGG + Intergenic
930763414 2:55060416-55060438 ATCTCTTGACAGATGTCTGCTGG + Intronic
932701565 2:73995861-73995883 GTCTCTGGACAGAACTTTCCTGG + Intronic
933956378 2:87376079-87376101 CTGTCTTTAAAGACGTTTGCAGG - Intergenic
934240527 2:90268104-90268126 CTGTCTTTAAAGACGTTTGCAGG - Intergenic
934252493 2:90370707-90370729 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
934256947 2:91432238-91432260 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
934272666 2:91548653-91548675 CTGTCTTTAAAGACGTTTGCAGG + Intergenic
935302548 2:101705393-101705415 GTGTCTGAACACAAGTGTGCTGG - Intronic
935858776 2:107304355-107304377 GTGTTTTTTCAGGAGTTTGCTGG + Intergenic
938151636 2:128890283-128890305 CAGTCTTGACAAAAGTTGGCTGG + Intergenic
938516968 2:132020043-132020065 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
941203158 2:162539943-162539965 GTATCTTGACAGAACTTAGTTGG - Intronic
941850636 2:170176554-170176576 GTGTCTTGGCAGATTTTTGCAGG - Intergenic
948404623 2:237707966-237707988 GTGACTGGACAGCAGTTCGCTGG + Intronic
948823595 2:240563131-240563153 GTGATTTGACAGAATTCTGCAGG + Exonic
1169858680 20:10129935-10129957 GTGACTTCACAGAAGGCTGCAGG - Intergenic
1170282549 20:14667018-14667040 GGATCTTGTCAGAAGTTTTCAGG - Intronic
1171179352 20:23081244-23081266 GTGTCTAGCGAGAAGTTAGCAGG + Exonic
1172297905 20:33826511-33826533 GTCTCTAGAGAGCAGTTTGCTGG + Intronic
1174184660 20:48698097-48698119 GTCTCTTGAGAGAAGCTGGCAGG - Intronic
1176254616 20:64145373-64145395 GTGTCGTGACAGATGTCAGCTGG + Intergenic
1176584609 21:8568558-8568580 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1177298482 21:19208403-19208425 GTGTGTTGACCCAAGTTTACTGG - Intergenic
1178031757 21:28535599-28535621 AAGTCTTGGCAGAAGTTAGCTGG + Intergenic
1179667149 21:42920791-42920813 GTGTCCACACAGAAGTGTGCAGG + Intergenic
1179784320 21:43720820-43720842 CTCTCTTGGCAGAAGTGTGCAGG + Intronic
1180267420 22:10545460-10545482 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1180551387 22:16544623-16544645 CTGTCTTTAAAGATGTTTGCAGG - Intergenic
1181352622 22:22269304-22269326 CTGTCTTTAAAGATGTTTGCAGG + Intergenic
1181375806 22:22457154-22457176 GTGACTGGACAGATGTTTGGTGG + Intergenic
1181960045 22:26616328-26616350 GTTTCTTTACAGACTTTTGCAGG - Exonic
1182802656 22:33044240-33044262 GTGTGTTGGCAGAAGATTGGTGG - Intronic
1183865613 22:40701906-40701928 GTATCCTCACAGAAGTGTGCAGG - Intergenic
1203325840 22_KI270738v1_random:16181-16203 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
949109706 3:244412-244434 GTTCCTTGACAGAAATTCGCAGG + Intronic
950048260 3:9964698-9964720 GTGTCTGGACATAAGGTTGGAGG - Intronic
952096024 3:29955241-29955263 GTGTCTTGAAAGGAGTCAGCGGG + Intronic
952247106 3:31606635-31606657 ATGTCCAGGCAGAAGTTTGCTGG + Intronic
952939705 3:38433046-38433068 ATGTCCAGGCAGAAGTTTGCTGG - Intergenic
955752819 3:62199593-62199615 TTGTTTTTATAGAAGTTTGCAGG + Intronic
955767230 3:62357621-62357643 GTGTCATGACTGAAGTTGTCTGG + Intergenic
955945792 3:64192231-64192253 ATCTCTTAACAGATGTTTGCTGG + Intronic
959859314 3:111198818-111198840 AAGTATTGAGAGAAGTTTGCAGG - Intronic
963352491 3:144168969-144168991 GTTTCTTGACAGAATATTGGTGG - Intergenic
963735815 3:149016632-149016654 GTGTCTGGTCAGTTGTTTGCTGG + Intronic
966314808 3:178633345-178633367 ATGTCCAGTCAGAAGTTTGCTGG - Intronic
968238855 3:197056751-197056773 GTGTCTTGACCTAAGTATACAGG - Intronic
968994192 4:3935471-3935493 GTGTCTTGAAAGAAAGATGCCGG - Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
976117043 4:81738986-81739008 GTATCTTGTCAGAAGTTGTCTGG - Intronic
977134686 4:93288955-93288977 CTGTCTTGAAAGAAAATTGCAGG - Intronic
982179251 4:152734490-152734512 GTGTCTTGACAGGAGCTGGAGGG + Intronic
983497043 4:168454375-168454397 GTGTCTTGACTGGAGTTAGACGG - Intronic
985369612 4:189271737-189271759 GAGTCTTGACAAAAGTTTAATGG - Intergenic
989660350 5:43791222-43791244 ATGGCTTGACAGAAGATAGCAGG - Intergenic
991041222 5:62177693-62177715 GAGTCTTGAAAGCAGTTTTCGGG + Intergenic
994587500 5:101728411-101728433 GTGTCTGGAAATAAGTTTGTAGG + Intergenic
995107369 5:108389728-108389750 GTGTCCTGCCAGAAGTTTAAGGG - Intergenic
995435452 5:112129868-112129890 ATGTCCTGACAGAAGTTTCTGGG - Intergenic
997295558 5:132766307-132766329 TTGTCTAGACAGAAGGTTCCGGG + Intronic
1001745766 5:174091168-174091190 GTGTCTAGACAGACGGTTGGCGG + Intronic
1002014316 5:176307034-176307056 GTATCTTTTCAGAAGTTTGTTGG - Intronic
1002549749 5:179978726-179978748 GTTTCTAGACAGCAGTCTGCTGG - Intronic
1002859970 6:1071793-1071815 GTCTCTTGGCAGAAGAATGCTGG + Intergenic
1005414704 6:25587394-25587416 GTGTCTGGACAGAGGCTTGTGGG + Intronic
1007666021 6:43513441-43513463 GTATATTGACAGAAAATTGCAGG - Exonic
1008245069 6:49161512-49161534 ATGTCCAGGCAGAAGTTTGCTGG - Intergenic
1010379698 6:75209920-75209942 GTTACTTGACAGAATTTTGAGGG - Intergenic
1010795779 6:80114924-80114946 GTTTCTTGACAGAAGTTACCAGG + Intronic
1011179151 6:84599910-84599932 ATCTCTTGAAAGAAGTTTTCAGG + Intergenic
1012552534 6:100477212-100477234 CTGTGTTGACAGTAGTTTGAAGG + Intergenic
1012683222 6:102209665-102209687 ATGTCCAGGCAGAAGTTTGCTGG + Intergenic
1014883059 6:126746522-126746544 ATGTCTAGGCAGAAGTTTGCTGG - Intergenic
1015750410 6:136552948-136552970 GTATCTTGATAGAATTGTGCAGG - Intergenic
1016317252 6:142804603-142804625 GTTAGTTGACAGAAGTATGCTGG - Intronic
1017742552 6:157419784-157419806 GTGTGTGGACATAAGTTTTCAGG + Intronic
1017943929 6:159078324-159078346 GGGTCTCAACAGAAGTTCGCTGG - Intergenic
1019176115 6:170160393-170160415 GTGTTTTGACAGAAGTTTTCAGG + Intergenic
1022195504 7:28062621-28062643 GTGATGTCACAGAAGTTTGCTGG - Intronic
1024807378 7:53159486-53159508 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
1025306038 7:57856946-57856968 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
1025477729 7:60947181-60947203 GTTTCTAGACAGAAGTTTGTTGG - Intergenic
1025483150 7:61011450-61011472 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1025554386 7:62286477-62286499 GTTTCTAGACAGAAGTCTGTTGG + Intergenic
1025560395 7:62366797-62366819 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1026969309 7:74458342-74458364 GTGTTGTGACAGATGATTGCTGG + Intronic
1029126962 7:98301153-98301175 CTGTGTTGACAGAAGTCTGCTGG + Intronic
1030291289 7:107874885-107874907 GTGTCTTGCCAGAAGTATAAAGG - Intergenic
1032433059 7:131878644-131878666 CTGTCCTCACAGAAGTTTGGGGG - Intergenic
1032594894 7:133229504-133229526 GTGTTTTGATAGATGTTTCCTGG + Intergenic
1034342039 7:150363707-150363729 GTGTCTTCACAGAGGATTTCTGG + Intergenic
1039397655 8:37240904-37240926 CTGTGTTGACAGAAGTTGGGGGG - Intergenic
1040098278 8:43470966-43470988 GTGACTTTACTGAAGGTTGCAGG - Intergenic
1040987415 8:53311504-53311526 GGACCTTGAAAGAAGTTTGCTGG + Intergenic
1043823639 8:84898870-84898892 GTGTCCTAACAGAGGTTTGCAGG - Intronic
1045778713 8:105838345-105838367 GGCCCTTTACAGAAGTTTGCTGG - Intergenic
1048892801 8:138963019-138963041 GTGTATTAACAGAGTTTTGCAGG + Intergenic
1051151106 9:14079941-14079963 GTGTCTTGGAAGAAGTCTGCTGG + Intergenic
1059986569 9:119825801-119825823 AGGTCTTGAAAGAAGTTTTCAGG + Intergenic
1060424338 9:123492235-123492257 GTGTCAGGACAGAGGCTTGCTGG + Intronic
1062187888 9:135228300-135228322 CTGTCTTGGGAGAAGTTAGCGGG - Intergenic
1203614513 Un_KI270749v1:46080-46102 GTTTCTAGACAGAAGTCTGTTGG - Intergenic
1187469223 X:19553250-19553272 GAGTCCTGGCAGAAGTTTCCTGG - Intronic
1187473320 X:19588487-19588509 GTGTCTTCAGATAATTTTGCTGG + Intronic
1190434226 X:50407799-50407821 GTGTCTGGACAAACTTTTGCTGG + Intronic
1190531804 X:51386170-51386192 ATGTCTAGGCAGAAGTTTGCTGG - Intergenic
1191591449 X:62889341-62889363 GAATCTTGACAAAAGGTTGCAGG + Intergenic
1192292509 X:69812641-69812663 TTGTCATGATAGAAGTCTGCAGG + Intronic
1195536317 X:106012874-106012896 ATGTCCAGGCAGAAGTTTGCTGG + Intergenic
1197480586 X:126980287-126980309 GTGCCTTGATATATGTTTGCTGG + Intergenic
1197657044 X:129127720-129127742 GTGTCATGACAGAAGATACCAGG - Intergenic
1200056441 X:153463818-153463840 CTGTCTTGACATAAGATGGCAGG - Intronic
1200764444 Y:7068549-7068571 CAGTCTAGACAGAAGGTTGCAGG - Intronic
1201905888 Y:19085255-19085277 GAGTCTTTACAGAGGTTTGAGGG + Intergenic
1201980252 Y:19899510-19899532 GTGGCTTCAGAGAAGTTTTCTGG - Intergenic