ID: 1103037816

View in Genome Browser
Species Human (GRCh38)
Location 12:117670753-117670775
Sequence CTGTAATAGATGAAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103037810_1103037816 30 Left 1103037810 12:117670700-117670722 CCCTGTGTCTAGCACTGATCCCT 0: 1
1: 0
2: 2
3: 15
4: 142
Right 1103037816 12:117670753-117670775 CTGTAATAGATGAAGGAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 206
1103037813_1103037816 11 Left 1103037813 12:117670719-117670741 CCCTTTTGCTCTGGAGTAACTAA 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1103037816 12:117670753-117670775 CTGTAATAGATGAAGGAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 206
1103037811_1103037816 29 Left 1103037811 12:117670701-117670723 CCTGTGTCTAGCACTGATCCCTT 0: 1
1: 0
2: 2
3: 13
4: 128
Right 1103037816 12:117670753-117670775 CTGTAATAGATGAAGGAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 206
1103037814_1103037816 10 Left 1103037814 12:117670720-117670742 CCTTTTGCTCTGGAGTAACTAAA 0: 1
1: 0
2: 3
3: 11
4: 169
Right 1103037816 12:117670753-117670775 CTGTAATAGATGAAGGAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103037816 Original CRISPR CTGTAATAGATGAAGGAGAC AGG Intronic
900893017 1:5463326-5463348 CTGAAAGAGATGCAGGTGACAGG - Intergenic
902961236 1:19964174-19964196 CTCTAAAAGATAAAGGAGGCAGG + Intergenic
904891139 1:33780476-33780498 GTGTTATAGAGGAAGGAGATGGG - Intronic
905255818 1:36683221-36683243 CTGAAATACATGAAGTAGTCTGG + Intergenic
905477372 1:38238523-38238545 CTGAAGGAAATGAAGGAGACAGG - Intergenic
908471529 1:64448741-64448763 CTGAAATAGCTGGAGGAGAAGGG + Intergenic
910599324 1:89013728-89013750 CTGTAAAATATGAAGGACAATGG - Intronic
910704774 1:90117207-90117229 ATGTAATGGAAGCAGGAGACAGG + Intergenic
910798781 1:91124426-91124448 CTATAATATATGAAGGTGAGAGG - Intergenic
915228406 1:154428313-154428335 CTGTAGTAGATGTAGGGTACTGG + Intronic
917062702 1:171057491-171057513 CTGGAATACCTGAAGGAGATGGG + Intronic
918016097 1:180633507-180633529 TTGTAATAATTGAAGAAGACAGG + Intronic
919031652 1:192250751-192250773 CTGGAGTACCTGAAGGAGACAGG - Intergenic
919873616 1:201843944-201843966 TTGTAATAAATAAAGGAGAAGGG + Intronic
920210499 1:204324834-204324856 CTGTGTTGGATAAAGGAGACTGG + Intronic
921892731 1:220369279-220369301 CTGTGATGGATGAAGGAGAGGGG - Intergenic
924210296 1:241758392-241758414 CAGTAATAAATGAAGCAGAAAGG - Intronic
1063428679 10:5968915-5968937 CTGTTACAGATGCAAGAGACAGG - Intronic
1064823797 10:19371896-19371918 CTGAAATAAATGAATGAGAAAGG + Intronic
1067793000 10:49301821-49301843 CTGTCTTAGATGAAGGGGAAAGG + Intronic
1068097037 10:52504330-52504352 CTTTAATGGAAGTAGGAGACTGG - Intergenic
1068995111 10:63193611-63193633 CTGTAATAGATGGAAGAGAATGG - Intronic
1069897421 10:71688324-71688346 CTGCAGTGGCTGAAGGAGACAGG + Intronic
1070481823 10:76890301-76890323 CTGTATTATATGAAGGGCACTGG + Intronic
1072714381 10:97740123-97740145 CTGAAATACATGAGAGAGACTGG + Intronic
1075484762 10:122813100-122813122 CTCTACAAGATGCAGGAGACAGG - Intergenic
1076501759 10:130942726-130942748 CTGGAAGAGCTGCAGGAGACCGG + Intergenic
1078385272 11:10885525-10885547 CTGGAAGATATGAAGCAGACAGG - Intergenic
1082647280 11:55743279-55743301 ATGTAAAACATGAAGGAGAAAGG + Intergenic
1082934246 11:58639896-58639918 CTGTAACAGATGAAGGAAGTGGG - Intergenic
1085894803 11:80626064-80626086 CTGTTATAGAAGAAATAGACTGG - Intergenic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1088083103 11:105944386-105944408 CTGTGAGACATGAAGGAGAGTGG - Intronic
1088149967 11:106732917-106732939 TTGTAGCAGATGAATGAGACAGG - Intronic
1088217584 11:107529801-107529823 CTGTATTAAAAGTAGGAGACAGG - Intronic
1088583159 11:111334652-111334674 CTGTGAAAGATGCAGGAGCCTGG + Intergenic
1088748371 11:112823240-112823262 CTGTTATAGCAGAAGGAGACAGG + Intergenic
1089720654 11:120417169-120417191 CTGTAAAACATGAGGGAAACGGG - Intronic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1093727229 12:22528556-22528578 CTATATTTGATGAAGGGGACTGG - Intronic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1095449901 12:42319431-42319453 CAGTGAAAGATGAAGGAGATGGG - Intronic
1095612805 12:44150295-44150317 CTGTAAGAGATGAGAGAAACAGG + Intronic
1096989637 12:55789343-55789365 CTGTGATAAATGCAGGAGGCAGG - Intronic
1099760193 12:86911531-86911553 CTGTTATAAATGACTGAGACTGG - Intergenic
1103037816 12:117670753-117670775 CTGTAATAGATGAAGGAGACAGG + Intronic
1103041475 12:117698994-117699016 CTCTTTTAGATGAAGGGGACGGG - Intronic
1106423736 13:29605956-29605978 CTGTCAGAGCTGAAAGAGACAGG + Intergenic
1107687025 13:42912157-42912179 CTGAAAGAGAGAAAGGAGACAGG + Intronic
1108106225 13:47013689-47013711 CTGTATCAGCTGAAGGAGATGGG + Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1110208470 13:72946106-72946128 CTGTAATCAATGAAGGAAAGAGG + Intronic
1110610099 13:77478267-77478289 CTACAATAGATCAAGGAGGCTGG - Intergenic
1111108304 13:83674313-83674335 AGGTAGTAGAGGAAGGAGACTGG + Intergenic
1111713187 13:91843946-91843968 CTTTAATAGATAAAGAACACAGG + Intronic
1111933811 13:94538523-94538545 CTACAATAGATGAAGAAGAGGGG - Intergenic
1112678468 13:101732951-101732973 CTGTAAAAGATGAAAGAGATTGG - Intronic
1114933939 14:27509268-27509290 CTGTGAAAAATAAAGGAGACAGG - Intergenic
1116373452 14:44166604-44166626 GTGTAATAAATGAGGGAGAAAGG - Intergenic
1116567436 14:46467322-46467344 CTGTCATAGTTAAAGGAGAGTGG - Intergenic
1117287043 14:54295946-54295968 CTGAAAGACAAGAAGGAGACGGG - Intergenic
1117564362 14:56978156-56978178 CTGTATTACATGAATGAGTCTGG - Intergenic
1118370071 14:65130315-65130337 CTGTACTAGATGAGAAAGACAGG - Intergenic
1118530838 14:66703172-66703194 CTGGAATACCTGAAGGAGATGGG + Intronic
1119806481 14:77485457-77485479 CTGGAATAGAAAAAGGAGCCAGG - Intronic
1120219410 14:81715305-81715327 CTGCAATAGATAAAGAGGACAGG - Intergenic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1122291782 14:100684674-100684696 CCGTAATAGATGCCAGAGACGGG + Intergenic
1122499308 14:102185968-102185990 CTCTATTAGATGTTGGAGACAGG + Intronic
1123144871 14:106119064-106119086 CTGCCACAGATGAAAGAGACAGG + Intergenic
1124150294 15:27171844-27171866 CTGTAATAGAATATGCAGACTGG + Intronic
1126878066 15:53065526-53065548 TTGTAATAGATTAAAGAAACTGG - Intergenic
1128671631 15:69578240-69578262 CTGGAATAAGTGCAGGAGACTGG + Intergenic
1128741104 15:70084210-70084232 TTGTTATAGAGGAAGGAGTCTGG - Intronic
1129895944 15:79105956-79105978 CAATAATGAATGAAGGAGACTGG + Intergenic
1131138121 15:89954385-89954407 CTATAGGAGACGAAGGAGACAGG - Intergenic
1131925928 15:97383672-97383694 CTGTAATAGCTAAAGGGGAGTGG - Intergenic
1134347909 16:13408850-13408872 CTGTAATACAGACAGGAGACAGG + Intergenic
1136694325 16:32063915-32063937 CTGCCACAGATGAAAGAGACAGG - Intergenic
1136794824 16:33007178-33007200 CTGCCACAGATGAAAGAGACAGG - Intergenic
1136875084 16:33847207-33847229 CTGCCACAGATGAAAGAGACAGG + Intergenic
1138907025 16:61349309-61349331 CTGAAATAAATGAAGGAGCCAGG - Intergenic
1139213089 16:65100315-65100337 ATGTAATAGGAGAAGAAGACTGG + Intronic
1141377770 16:83547819-83547841 CTGAAATAGATAAAGGAGTGAGG + Intronic
1203097085 16_KI270728v1_random:1268829-1268851 CTGCCACAGATGAAAGAGACAGG - Intergenic
1143124796 17:4635090-4635112 GTGTAATGGATGAAGGAGAGAGG - Intronic
1144209731 17:13003918-13003940 CTGTGAGAGAGGAAGGAGAGAGG - Intronic
1144258325 17:13491959-13491981 CTGTAATCATTGAAGGAGAGTGG - Intergenic
1147112962 17:38277457-38277479 CTGTGACAGAGGAAGGAGAATGG - Intergenic
1148416659 17:47511768-47511790 CTGTGACAGAGGAAGGAGAATGG + Intergenic
1148726737 17:49797445-49797467 CTGTAATAGGAAAAAGAGACTGG + Intronic
1148959077 17:51378058-51378080 CTGTGATACATAAAGGAGGCTGG - Intergenic
1149797935 17:59538608-59538630 ATGTACTAGAAGAAGGAGAAGGG - Intergenic
1150821750 17:68440371-68440393 CTGTAACAGAAAGAGGAGACTGG - Intronic
1153231463 18:2940837-2940859 CTAAAATATATGAAGGAGAAGGG + Intronic
1155327893 18:24684005-24684027 AAGTAACAGATGGAGGAGACTGG - Intergenic
1155847959 18:30732459-30732481 TTGGAGTACATGAAGGAGACAGG + Intergenic
1156660202 18:39337542-39337564 CTAAAATAGATGAATGAGAAGGG - Intergenic
1157733423 18:50024635-50024657 CTGTAATAGGGGCAGGAGCCAGG + Intronic
1159471051 18:68856631-68856653 CTGTATTAGCTGAAGGACTCAGG + Intronic
1159991376 18:74912831-74912853 CTCTTATAAATTAAGGAGACTGG - Intronic
1160206660 18:76840192-76840214 CTTTAAAAAATGAGGGAGACCGG + Intronic
1164035253 19:21448721-21448743 ATGAAATTGATGAAGGAGTCTGG - Intronic
925044282 2:759810-759832 CTGGCCTAGATAAAGGAGACTGG - Intergenic
925073547 2:990491-990513 CTGTAATAGGAGAAAGAGGCAGG - Intronic
928774135 2:34738180-34738202 TTGCAATAGATGAAAGAGATTGG - Intergenic
928918147 2:36496437-36496459 CTATATTAGATGAAAGAAACAGG - Intronic
929393772 2:41499210-41499232 GTGAAATAGATGAAGGTAACAGG + Intergenic
931164536 2:59732860-59732882 CTGGAAGAGAATAAGGAGACAGG - Intergenic
935748220 2:106208290-106208312 CTGTAATAGGTGAAAGAAAGAGG + Intergenic
936074191 2:109391293-109391315 CTGTAATGGCTGAAGCATACAGG - Intronic
938589711 2:132724585-132724607 CTGTGATAGATGAAGGGGAAGGG - Intronic
939939924 2:148336958-148336980 CTGGAAGACATAAAGGAGACTGG - Intronic
941388688 2:164884807-164884829 CTGTAAGAGATAAAGTAGAAGGG - Intergenic
942932842 2:181516606-181516628 CTGTTATGGTTGAAGGAGAATGG + Intronic
943795333 2:191985999-191986021 CTTTCATAGCTCAAGGAGACGGG - Intronic
944895210 2:204157021-204157043 GTGAAAGATATGAAGGAGACTGG + Intergenic
945553111 2:211246064-211246086 CAGTAAGAGATGAATGAGACAGG - Intergenic
946035868 2:216741764-216741786 CTCTAATAGAGGAGGGAAACAGG - Intergenic
948741072 2:240046340-240046362 CTTTGAGAGATGAGGGAGACTGG - Intergenic
1168956812 20:1840291-1840313 CTGCAATGGAGGGAGGAGACAGG + Intergenic
1171983911 20:31646069-31646091 CTGTGAGAGATAAAGGAGAGAGG + Intergenic
1172403930 20:34673585-34673607 CTGAAATAGATGAATCAGAAAGG - Intronic
1172638211 20:36424160-36424182 CTGTGACAGGTGAAGGGGACAGG + Intronic
1173337611 20:42125502-42125524 CTGTAATAGGTTAGGCAGACAGG - Intronic
1175285789 20:57835994-57836016 CTGTAATTGGTGATGAAGACGGG + Intergenic
1176296830 21:5077691-5077713 ATGAAATAGATGAAATAGACAGG + Intergenic
1176296955 21:5078770-5078792 ATGAAATAGATGAAATAGACAGG + Intergenic
1177059898 21:16358219-16358241 CTGAAATAAATGAAGAAAACAGG + Intergenic
1177415216 21:20784263-20784285 CAGTCAGAGATGAAAGAGACAGG + Intergenic
1177737103 21:25104656-25104678 ATGTAATAAATAAAGGAGACAGG - Intergenic
1178239814 21:30886173-30886195 CTGGAATCTATGTAGGAGACAGG + Intergenic
1178674490 21:34619380-34619402 CTGCAATTGATGTAAGAGACAGG - Intergenic
1179860073 21:44183177-44183199 ATGAAATAGATGAAATAGACAGG - Intergenic
1179860219 21:44184430-44184452 ATGAAATAGATGAAATAGACAGG - Intergenic
1181163737 22:20972746-20972768 CTGTAATTGAAAAAGGAGGCGGG + Intronic
1181828477 22:25539349-25539371 CTGGAACAGAAGAAGGAGATTGG - Intergenic
1181846470 22:25713396-25713418 TTATAATAGATCAATGAGACTGG + Intronic
1183296700 22:37034041-37034063 CTGGAATGAATGGAGGAGACAGG - Intergenic
949592857 3:5511728-5511750 TTGGAATACCTGAAGGAGACAGG + Intergenic
952796711 3:37245294-37245316 CTTTTATAGATGAAGGAGTGAGG + Intronic
953724504 3:45386229-45386251 ATGTAGTTGATGATGGAGACAGG - Intergenic
954821154 3:53328898-53328920 CTGTAATCAGTGAAGGAGAAAGG - Intronic
955134527 3:56203311-56203333 TTGTAGAAGCTGAAGGAGACCGG + Intronic
956716202 3:72082270-72082292 CTGTGATGGATGACGGAGAACGG - Intergenic
958091104 3:88877323-88877345 CACTAATAAATGAAGGAGACAGG + Intergenic
960260876 3:115567063-115567085 ATGAAGGAGATGAAGGAGACTGG + Intergenic
960823979 3:121763281-121763303 CTGTAATAGATGCAGAAAACAGG - Intergenic
962562029 3:136616300-136616322 TTTCAATAGATAAAGGAGACAGG + Intronic
963286899 3:143442100-143442122 CTGAAATAGGAGAGGGAGACAGG + Intronic
965076007 3:163977309-163977331 CTGGAATAAAAGAAGGAGAAGGG - Intergenic
965656145 3:170987397-170987419 CTGTAAGAAATGCAGGAGACAGG + Intergenic
966050400 3:175610417-175610439 CTGTTACAGATGAGGGAGAAAGG + Intronic
967595444 3:191322615-191322637 CTATAATAGCTGAAGGGGACTGG + Intronic
973916195 4:55636654-55636676 CTGGAAGAGGTGAAGGAGAAAGG - Intronic
974105010 4:57459961-57459983 CTGTAATAAATGGTGGAGACTGG - Intergenic
976002142 4:80386403-80386425 CTGGAGGAGATGAAGGACACAGG - Intronic
976786348 4:88825877-88825899 TTGTTATAAATGATGGAGACTGG - Intronic
976894909 4:90097559-90097581 CTGAAAGAGGTGAAGGAGAAAGG + Intergenic
980254409 4:130359259-130359281 CAGTAAAAGATAAAGGAGAAAGG + Intergenic
980865003 4:138543736-138543758 TTGCAGTACATGAAGGAGACAGG + Intergenic
982527395 4:156496460-156496482 TTGTAATAGAAGAATGAGATTGG - Intergenic
984092258 4:175388578-175388600 CTGGAGTACCTGAAGGAGACAGG + Intergenic
984554558 4:181198595-181198617 ATATAATAGATATAGGAGACGGG + Intergenic
984658204 4:182342964-182342986 CTTTAATAAAAGAAGGAGATTGG - Intronic
984713744 4:182906935-182906957 CTGTGATAAATGCAGGATACTGG - Intronic
986415529 5:7524543-7524565 CTGTAGAAGATCAAAGAGACTGG - Intronic
989682459 5:44045692-44045714 CTGGAGTACCTGAAGGAGACAGG - Intergenic
996678981 5:126209273-126209295 CTTCAATATATGAGGGAGACAGG + Intergenic
998219264 5:140263118-140263140 CTGGACTAGATGGAGGAGGCCGG - Intronic
998524978 5:142834452-142834474 CCATAATAGATAAAGGATACAGG - Intronic
1003153313 6:3571048-3571070 CTGTAGTAGATGAATGACAGAGG + Intergenic
1003222349 6:4172287-4172309 TTGTAAAAGATGCAGCAGACAGG - Intergenic
1005947754 6:30606688-30606710 CTGTCAGAGGTGAAGCAGACTGG + Intronic
1006024451 6:31138307-31138329 CTGTAAAGGAGGAAGGAGAAAGG + Intronic
1016171423 6:141022699-141022721 TTCTAATAGATGGTGGAGACTGG + Intergenic
1016737486 6:147495025-147495047 GTGTAATTGATGAAGGAAAGAGG + Intergenic
1020395929 7:7717358-7717380 TTTTAATAGATGAAAGAAACAGG - Intronic
1021955870 7:25823813-25823835 CTATGATAGATGAAGGGGCCAGG - Intergenic
1022634803 7:32121255-32121277 TTGGAATACCTGAAGGAGACAGG + Intronic
1023322905 7:39018945-39018967 CTGCAATACAAGAAGGAGGCAGG - Intronic
1026246471 7:68624675-68624697 ATGTAAGAGATGAAAGTGACTGG + Intergenic
1027882381 7:83857039-83857061 CTGAAATACATTAAGGAGATCGG - Intergenic
1027980826 7:85219334-85219356 CTGTAATACATTAAGGGCACTGG - Intergenic
1029463705 7:100711790-100711812 CTCTAGTAGATGCAGGAGCCTGG - Intergenic
1031253498 7:119417762-119417784 CTTTGATCGAAGAAGGAGACTGG + Intergenic
1031818365 7:126469093-126469115 CTTTATTAGGTGAAGGAGATGGG - Intronic
1033289027 7:140065701-140065723 CTGTACCAGAGGGAGGAGACAGG + Intergenic
1033879569 7:145863747-145863769 CTGGAGTAACTGAAGGAGACAGG + Intergenic
1036288380 8:7464304-7464326 CTTAAAAAGATGAAGGAGAAGGG - Intergenic
1036333095 8:7847224-7847246 CTTAAAAAGATGAAGGAGAAGGG + Intergenic
1037652397 8:20850691-20850713 CTGAACTAGATGAATGAGAGAGG + Intergenic
1039125556 8:34197332-34197354 TTGTGATAGATGCAGGAGGCAGG - Intergenic
1040434028 8:47372114-47372136 CTGTAATAGATCAGGGACATGGG - Intronic
1040748554 8:50676248-50676270 CTGGAGTACCTGAAGGAGACAGG - Intronic
1041569136 8:59316877-59316899 CTGTAATTGGGGAAGGAGAGAGG - Intergenic
1046510187 8:115192318-115192340 CTTTTAAAGATGAAGAAGACAGG - Intergenic
1047099608 8:121662207-121662229 GTGTAATAGATGCAGATGACTGG + Intergenic
1047668329 8:127117141-127117163 CTGTAATATATTCAGGACACAGG - Intergenic
1047966180 8:130048550-130048572 CTGCAACAGATGGAGCAGACAGG - Intergenic
1049123459 8:140762360-140762382 ATGGAATAGATGAAGGTAACAGG - Intronic
1049737654 8:144218381-144218403 CTGGAATAGGTGCAGGAGTCCGG - Intronic
1050039099 9:1469613-1469635 CTTTAATAAATGTAGGAGTCAGG + Intergenic
1050357367 9:4795381-4795403 CTGTAAGAAATTAAGCAGACAGG - Intronic
1051930140 9:22375242-22375264 GTGGAATAGCTGAAGGAAACTGG - Intergenic
1052330219 9:27260115-27260137 CTGCTATAGAAGAAAGAGACAGG + Intergenic
1052394904 9:27927257-27927279 ATTTAATAGATGAAGGAGGAAGG + Intergenic
1055320374 9:75078072-75078094 CTGGGAAAGATGAAGGAGAAAGG + Intronic
1055535957 9:77244661-77244683 CTGAAATAGATAAAGAACACAGG - Intronic
1058986385 9:110212049-110212071 GTGTAAAAGGTGAAGGAGAAAGG - Intergenic
1059702383 9:116787680-116787702 TTGCAATAGAGGAAGGAGAGAGG - Intronic
1188092323 X:25978288-25978310 CTGGAATACCTGAAGGAGACAGG + Intergenic
1188346143 X:29068304-29068326 GTATAATAGAAGAAGGAGATTGG - Intronic
1189141948 X:38616444-38616466 CTGCCATAGATGAATGAGGCAGG - Intronic
1189209167 X:39268654-39268676 CTGTAATAGATGAAGTAATATGG - Intergenic
1189661083 X:43300421-43300443 CTTTCATAAATGAAGGTGACAGG - Intergenic
1190939499 X:55026859-55026881 CTGAAATTGAGGAAGGAGAAGGG + Intronic
1191895362 X:65987031-65987053 CTGTTATAGAAGAGGGAGAAGGG + Intergenic
1195687295 X:107598449-107598471 CTGTGAGAGATGTAGAAGACAGG + Intronic
1196349544 X:114710021-114710043 CTGGAAAAGAAGCAGGAGACTGG + Intronic
1196771991 X:119303656-119303678 CAATAATAAATGCAGGAGACTGG - Intergenic
1198688173 X:139250165-139250187 GTGTATTAGTTGAAGGAAACTGG - Intergenic
1198986061 X:142455517-142455539 CTATCATAGAAGAAGGAGTCAGG - Intergenic
1199411602 X:147530051-147530073 ATGAAATATATGAAGGAAACGGG - Intergenic