ID: 1103038427

View in Genome Browser
Species Human (GRCh38)
Location 12:117675142-117675164
Sequence GTAAATGCAGAATTCCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103038427_1103038432 14 Left 1103038427 12:117675142-117675164 CCCAGCTGGAATTCTGCATTTAC 0: 1
1: 0
2: 5
3: 22
4: 238
Right 1103038432 12:117675179-117675201 GAGGAATGTCTGTCTCCCCTAGG 0: 1
1: 0
2: 2
3: 7
4: 179
1103038427_1103038430 -5 Left 1103038427 12:117675142-117675164 CCCAGCTGGAATTCTGCATTTAC 0: 1
1: 0
2: 5
3: 22
4: 238
Right 1103038430 12:117675160-117675182 TTTACTTATGTGGTTACCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 151
1103038427_1103038433 15 Left 1103038427 12:117675142-117675164 CCCAGCTGGAATTCTGCATTTAC 0: 1
1: 0
2: 5
3: 22
4: 238
Right 1103038433 12:117675180-117675202 AGGAATGTCTGTCTCCCCTAGGG 0: 1
1: 0
2: 2
3: 14
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103038427 Original CRISPR GTAAATGCAGAATTCCAGCT GGG (reversed) Intronic
900994834 1:6115305-6115327 TTAATTGCAGAATTCCAACATGG + Intronic
903298598 1:22362091-22362113 TAAAATCCAGGATTCCAGCTTGG + Intergenic
905634697 1:39542300-39542322 GAAAATTCAGTATTTCAGCTAGG + Intergenic
906465001 1:46070549-46070571 GGAAATGCAGAAGTTAAGCTGGG + Intronic
908563629 1:65331936-65331958 GAGAATGAAGATTTCCAGCTTGG - Intronic
909059782 1:70866805-70866827 AAAAATGCAGAAGTCCAGATTGG - Intronic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
911632424 1:100198359-100198381 GTAAGTGCAGAGTTTCAGTTTGG + Intronic
914954140 1:152145790-152145812 GTAAATGCTCAATTCAAGTTAGG + Intergenic
915040881 1:152967485-152967507 GCAGATGCAGAACTCCAGATTGG + Intergenic
917363265 1:174200805-174200827 ATAAATGCAAAATACCAGCAGGG - Intronic
920815455 1:209327207-209327229 TGACATGCAGAAGTCCAGCTGGG + Intergenic
921125426 1:212173471-212173493 GGAACTGCAGAATTGCAGCCTGG + Intergenic
921607682 1:217174747-217174769 GTTAATGAAGAAGTCCAGGTGGG - Intergenic
921941079 1:220840501-220840523 GGAAGTGAAGAATTCCAGTTTGG + Intergenic
923890504 1:238210209-238210231 CAAAAAGCAGAATTCCAGTTAGG - Intergenic
1063382551 10:5595134-5595156 GTGAACGGAGAATTCCATCTCGG - Intergenic
1063703007 10:8403902-8403924 GTAACTGGTGAATTGCAGCTTGG - Intergenic
1064708936 10:18103240-18103262 TTAAATGCTGAATTCCACTTGGG + Intergenic
1064735057 10:18373562-18373584 GTAGAACCAGAATTCAAGCTTGG + Intronic
1066326018 10:34359259-34359281 GTAAATGGAGAATCCCTGTTGGG - Exonic
1066423130 10:35280115-35280137 GTAAAGAAAGAATACCAGCTTGG + Intronic
1066596611 10:37057800-37057822 GTAAAAGGAGATTTTCAGCTTGG - Intergenic
1066606387 10:37178434-37178456 AAAAATGCAGAATCCCAGGTCGG - Intronic
1066705551 10:38174259-38174281 GTAAAGGTAGAAGTCAAGCTTGG - Intergenic
1066984894 10:42456075-42456097 GTAAAGGTAGAAGTCAAGCTTGG + Intergenic
1067389443 10:45849417-45849439 GTAAAGGTAGAAGTCAAGCTTGG + Intronic
1067502027 10:46814428-46814450 GTAAAGGTAGAAGTCAAGCTTGG - Intergenic
1067592560 10:47525597-47525619 GTAAAGGTAGAAGTCAAGCTTGG + Intronic
1067639676 10:48033670-48033692 GTAAAGGTAGAAGTCAAGCTTGG + Intergenic
1067873821 10:49986638-49986660 GTAAAGGTAGAAGTCAAGCTTGG - Intronic
1068225631 10:54103782-54103804 TTAAATGCAGAATCCCTACTTGG + Intronic
1070136651 10:73699782-73699804 GTAAAGGTAGAAGTCAAGCTTGG + Intergenic
1071552185 10:86575025-86575047 GTAAATTTAAAATACCAGCTGGG - Intergenic
1071604925 10:86979423-86979445 ATAAATGCAGAAATATAGCTGGG + Intronic
1072926145 10:99619482-99619504 GAGAATGCAGAATTCCAGACTGG - Intronic
1073739180 10:106386633-106386655 ATGATTACAGAATTCCAGCTGGG + Intergenic
1075878479 10:125828080-125828102 TTAAATGCAGTAGTCCAGGTGGG + Intronic
1075932016 10:126306637-126306659 GCCAATGCAGAATTCAAACTGGG - Intronic
1076238308 10:128882975-128882997 GTCCATGCAGAATTCCATCATGG + Intergenic
1077773409 11:5245518-5245540 GTAACTGCTGAATTCCTGGTTGG - Intergenic
1079127320 11:17727062-17727084 GTAAATGCCAAAGTCCAGGTGGG - Intergenic
1080715749 11:34798122-34798144 GTAAATGCACCATTCCAAATGGG - Intergenic
1081921945 11:46786569-46786591 GTAAGTCCATAATACCAGCTGGG + Intronic
1082006793 11:47423769-47423791 GTAAAAGCAAAACTCCATCTCGG + Intronic
1083495343 11:63047275-63047297 GTAGATAAAGAATTCCAGCTTGG - Intergenic
1083782916 11:64927203-64927225 GAAAAGGGAGATTTCCAGCTTGG - Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1086733961 11:90283148-90283170 GTAATTGGAGAACTCCAGCTTGG - Intergenic
1089230681 11:116972471-116972493 TTCAATGCAGCATACCAGCTGGG - Intronic
1091547935 12:1516820-1516842 ATAGATACAGAATTCCAGTTGGG - Intergenic
1092299974 12:7238283-7238305 GTAAATCCAGAATTCAATCAAGG + Intergenic
1093964265 12:25308753-25308775 TTAAATGCAGGATCCCTGCTTGG - Intergenic
1095546098 12:43372118-43372140 CCAAATGCACATTTCCAGCTTGG - Intronic
1096119126 12:49075584-49075606 GTAAATGGAGAACTCCAGCTTGG - Intergenic
1096127228 12:49128798-49128820 GTAAATGGAGAACTCCAGCTTGG + Exonic
1096134178 12:49185850-49185872 GTAAATAGAGAACTCCAGCTTGG + Exonic
1096144957 12:49272371-49272393 GTAAATGGAGAACTCCAGCTTGG - Exonic
1098106546 12:67073566-67073588 GCAAATCCAGAATAACAGCTGGG - Intergenic
1100821178 12:98432094-98432116 TTAAATAATGAATTCCAGCTGGG + Intergenic
1101556314 12:105813254-105813276 ATAAATGGAGAATTCCAGAGTGG + Intergenic
1101589254 12:106111630-106111652 GGAAATGCAGAATCCCAGGCTGG - Intronic
1101749834 12:107574425-107574447 AGAAATGCAGAATCTCAGCTGGG + Intronic
1103038427 12:117675142-117675164 GTAAATGCAGAATTCCAGCTGGG - Intronic
1105307236 13:19177467-19177489 GTAAATGGCAAATTCTAGCTTGG + Exonic
1105684742 13:22769883-22769905 GTAAATTCAGAATTCAAGCAGGG - Intergenic
1106174661 13:27319849-27319871 GTTAGTGCAGATTTCCAGGTTGG + Intergenic
1106315064 13:28586130-28586152 GAAAATGTAGATCTCCAGCTTGG + Intergenic
1106750984 13:32767799-32767821 ATAATTGCAAAATTCCAGCATGG + Intronic
1107407434 13:40127807-40127829 GTTGATGCAGAATAGCAGCTGGG + Intergenic
1107457630 13:40569582-40569604 GTAAATGACGGATTGCAGCTCGG - Intronic
1108757500 13:53521760-53521782 TTAAATGCTGAAGCCCAGCTTGG - Intergenic
1109158727 13:58945360-58945382 GGAAATGGAGAATTCAAGTTTGG + Intergenic
1113423820 13:110191200-110191222 ATGATTGCTGAATTCCAGCTGGG + Intronic
1115509076 14:34122153-34122175 GTAAATGCTGTATTCAAGATAGG - Intronic
1117206278 14:53446936-53446958 GTAAAGGTAGAATTCAACCTAGG - Intergenic
1119256927 14:73206694-73206716 TTAAATACAGAATACCAGCATGG + Intronic
1119866118 14:77976265-77976287 GCAAATGCAGAATGCCAACGTGG - Intergenic
1120003954 14:79335762-79335784 CTAAATGCAGAAGAGCAGCTGGG - Intronic
1120122000 14:80692238-80692260 GTAAATGCAGAAGTTTAGTTGGG + Intronic
1202895869 14_GL000194v1_random:9753-9775 GCAAATGTAGAATTTAAGCTTGG + Intergenic
1125953299 15:43772265-43772287 GTCACTGGAGAATTCCAGGTAGG + Exonic
1127596977 15:60494844-60494866 GTACATGCAGAATCCCTTCTGGG + Intronic
1127680657 15:61294170-61294192 GTAAGTGCAGGATTCTAGATTGG - Intergenic
1128434760 15:67635729-67635751 CTAAATGTAGAATTCTAGGTTGG + Intronic
1129104261 15:73295181-73295203 CTAAATGCAGAACTCCAAATTGG - Intronic
1129919467 15:79307892-79307914 GAAAATGCAGAAGTCCAGAAGGG - Intergenic
1130260652 15:82351846-82351868 ATAATTGCAGGATTCCAGCCAGG - Intergenic
1130280585 15:82517161-82517183 ATAATTGCAGGATTCCAGCCAGG + Intergenic
1130471956 15:84233344-84233366 ATAATTGCAGGATTCCAGCCAGG + Intergenic
1130479450 15:84347915-84347937 ATAATTGCAGGATTCCAGCCAGG + Intergenic
1130492320 15:84440214-84440236 ATAATTGCAGGATTCCAGCCAGG - Intergenic
1130594253 15:85237981-85238003 ATAATTGCAGGATTCCAGCCAGG + Intergenic
1131667584 15:94586768-94586790 GTAGATGCATCATTCCATCTCGG + Intergenic
1131719080 15:95147702-95147724 GAAAATCCAAAATTCAAGCTGGG + Intergenic
1131835759 15:96389000-96389022 GTAAATGGAGAGCTCCAGCTTGG + Intergenic
1132329246 15:101000182-101000204 GTAAATGGAGAATTTCAGAAAGG - Intronic
1133183347 16:4076031-4076053 GCAAATGCAAAATAACAGCTGGG + Intronic
1135148049 16:19980298-19980320 AAAAATGCAGATTTCCAGCATGG + Intergenic
1135880776 16:26253854-26253876 TAAAATGCAGATTTCCATCTGGG + Intergenic
1137387354 16:48054036-48054058 GTGAATGCAGAAGTCCTGCCTGG + Intergenic
1138449685 16:57086211-57086233 GTAACTGCAGTTTTACAGCTTGG - Intergenic
1138538842 16:57676021-57676043 GCTCCTGCAGAATTCCAGCTAGG - Intronic
1141181914 16:81759495-81759517 GAAAATGCAGCTTTCCTGCTTGG - Intronic
1141670119 16:85487226-85487248 GTAAATGCAGAATTTTTCCTGGG - Intergenic
1143902490 17:10184608-10184630 GGAAATGCAGAATCCCAGTGTGG + Intronic
1144607185 17:16677294-16677316 GCAAATGTAGAATTTAAGCTTGG + Intergenic
1147751146 17:42734450-42734472 GAAAATGAAGATTACCAGCTGGG + Intronic
1149426843 17:56563413-56563435 TTAAATGCAGAATCACTGCTTGG - Intergenic
1152125899 17:78446543-78446565 GTGAATGGAGAATGCCAGCGTGG - Intronic
1155226059 18:23730241-23730263 GTAAAAGCAAAATTACAGATAGG - Intronic
1155337276 18:24777571-24777593 TTAAATGCAGAATCTCTGCTTGG + Intergenic
1155571785 18:27202581-27202603 ATATATGCAGTTTTCCAGCTTGG + Intergenic
1156031568 18:32719241-32719263 GAAAGTGCAGGTTTCCAGCTGGG - Intronic
1158260553 18:55601430-55601452 GTAAAATCAGAAGTCCAGTTGGG - Intronic
1159213825 18:65364343-65364365 GAAAATGAAGAATGTCAGCTAGG - Intergenic
1159564355 18:70032039-70032061 GTGGAAGCAGAACTCCAGCTGGG + Intronic
1159918203 18:74204282-74204304 CTAAAGGGAAAATTCCAGCTGGG + Intergenic
1163204064 19:15789458-15789480 GCAAATGCAGAATCCCAGGCTGG - Intergenic
1165403544 19:35616956-35616978 GCTAATGCAATATTCCAGCTGGG + Intronic
1167328730 19:48841022-48841044 GTAAATTCGGAAATCCAGTTTGG + Intronic
925620625 2:5789086-5789108 CTAACTGCAGGATTCCAGCTTGG - Intergenic
926184064 2:10674542-10674564 TTAAAAGCAGAGTTTCAGCTGGG + Intronic
927391759 2:22604190-22604212 GGAAATGAAGACTTCCAGCATGG + Intergenic
928762301 2:34599104-34599126 GTAAATACAAAATTCCAGGTGGG - Intergenic
929053980 2:37860251-37860273 GTAAATGTACACTTCCAGCAAGG - Intergenic
929270121 2:39962972-39962994 TTAAATGCAGAATCCCTGCTTGG + Intergenic
930733379 2:54750278-54750300 GGAATGGCAGAGTTCCAGCTTGG - Intronic
934966349 2:98727240-98727262 GAAAATGCAGCAATCCAGCCAGG + Intronic
936563438 2:113562149-113562171 AGAAATGCAGAACTTCAGCTGGG - Intergenic
937077358 2:119116971-119116993 GTCACTGCAGAAATCCAGCAGGG + Intergenic
937233672 2:120417688-120417710 GGAAATTCAGAGTTCCAGTTTGG + Intergenic
937812432 2:126213616-126213638 GTAAATCCAGAAGTCTCGCTGGG + Intergenic
938492330 2:131768192-131768214 GCAAATGTAGAATTTAAGCTTGG - Intergenic
942497015 2:176550452-176550474 GTTCATGCAAAATACCAGCTAGG - Intergenic
944828536 2:203509476-203509498 GTAAATACAGACTTCAAGATGGG + Intronic
945328275 2:208509061-208509083 ATTAATGCAGAATTCTAGGTTGG + Intronic
945492120 2:210468508-210468530 GTAAATGCAGTCTTTTAGCTTGG - Intronic
946366300 2:219251183-219251205 GTAGATGGAGAATTCCAGCTTGG + Exonic
946369371 2:219271284-219271306 GTAGATGGAGAATCCCAGCTTGG - Intronic
947287356 2:228531452-228531474 CTAAAGGGAGAATTCAAGCTGGG + Intergenic
947699588 2:232221506-232221528 GGAAAAGAAAAATTCCAGCTGGG + Intronic
947893355 2:233645548-233645570 GTAAATACACCATTCCAACTGGG + Intronic
947946509 2:234107941-234107963 TTATATGCAGAATTCAACCTGGG + Intergenic
947977375 2:234378604-234378626 GATGATGCAGAATTCCAGCAAGG - Intergenic
948565177 2:238881754-238881776 ATAGATGCAGCATTCCTGCTGGG - Intronic
1169212747 20:3776971-3776993 GTAAATCCTGAGATCCAGCTGGG - Intergenic
1176307108 21:5129382-5129404 TTAATGGAAGAATTCCAGCTAGG - Intergenic
1176972709 21:15285418-15285440 GTAAATCCAGAAATGAAGCTGGG - Intergenic
1177608145 21:23408607-23408629 GTAAATGGAGAACTGCAGCTTGG + Intergenic
1178388640 21:32180266-32180288 GTAGAAGCAGAGTTCCAGCTTGG - Intergenic
1179792739 21:43764800-43764822 ATTTAGGCAGAATTCCAGCTGGG - Intergenic
1179849951 21:44132648-44132670 TTAATGGAAGAATTCCAGCTAGG + Intergenic
1180704080 22:17798061-17798083 GGAAATGCAGCATTCCAGGCTGG - Intronic
1181377676 22:22473029-22473051 GCAAATGCAGAAATCCAGAAGGG - Intergenic
1181419000 22:22784649-22784671 GCAAATGTAGAATTTAAGCTTGG + Intronic
1184693921 22:46129551-46129573 GTAAATGCGGAAATACGGCTTGG + Intergenic
1184966061 22:47973089-47973111 GAAAATGGAAAATTCCAGATTGG - Intergenic
951297781 3:20960442-20960464 CTAAATGGAGAAGTCAAGCTGGG + Intergenic
951642924 3:24856043-24856065 GTAAATGCAGATTTCAGGCCAGG - Intergenic
951852857 3:27162397-27162419 GCAAATGCAGAATTATAGTTGGG - Intronic
952921521 3:38288059-38288081 GTAGGTACAGAATTTCAGCTTGG - Intronic
957376245 3:79362676-79362698 CAAAAGGCAGAATTTCAGCTGGG - Intronic
957890896 3:86356147-86356169 ATAGATACAGAATTCCATCTTGG - Intergenic
957988492 3:87601027-87601049 TTAAATGCAGTACTCCAGTTTGG + Intergenic
961871835 3:129994014-129994036 ACAAATGCAGAACTCCAGCATGG - Intergenic
963887160 3:150595586-150595608 TTACATGCAGAATACCAGCCTGG - Intronic
964297197 3:155246608-155246630 GTAAATGCAGAATCTCTGCTTGG - Intergenic
966418092 3:179709752-179709774 GAAAATGGAGAAGACCAGCTGGG - Intronic
967079239 3:186033684-186033706 GTAAAGGCGGTACTCCAGCTAGG - Intergenic
967429058 3:189360833-189360855 GTTAAAGCAGAATTCAGGCTGGG + Intergenic
968343496 3:197980145-197980167 ATAAATTCAGAATTAGAGCTAGG + Intronic
969438870 4:7205634-7205656 GGAAATGCCTAATTTCAGCTGGG + Intronic
969727039 4:8926115-8926137 GTAAAGGGAGAAGTCAAGCTGGG + Intergenic
970937231 4:21587502-21587524 GTAAATGAAGAGTTAGAGCTTGG + Intronic
977137015 4:93317605-93317627 TTAAATGCAGCATTGCAGTTTGG - Intronic
978197432 4:105987726-105987748 GTTAATACAAAATTGCAGCTGGG - Intronic
979076192 4:116274570-116274592 GTAGAGGCAGAATTCCAGCCTGG + Intergenic
980873041 4:138632068-138632090 GCAAATGCAGCATTCCAACATGG + Intergenic
982515222 4:156338013-156338035 TTAAATGCAAAATTCCATCTAGG + Intergenic
983171344 4:164540201-164540223 GTAAATGCTGCATTCCAAATGGG + Intergenic
984604235 4:181766310-181766332 GTAAATTCCAAATTCCAGCCGGG + Intergenic
985298906 4:188466205-188466227 GGAAATGCAGAAATCCAGGCAGG - Intergenic
986251354 5:6061260-6061282 TTAAATTCAGAATTCCAGGCTGG + Intergenic
986460974 5:7971940-7971962 GTAAATGCAGATCCACAGCTGGG - Intergenic
988769964 5:34422469-34422491 CTAAAGGGAGAATTCAAGCTGGG + Intergenic
988815990 5:34835687-34835709 GTGAATACAGAATACCTGCTAGG - Intergenic
989604682 5:43232656-43232678 GTAAATGGAGAACTGCAGCTTGG + Intronic
990290299 5:54343609-54343631 ATAAATGCAGCATTCCAAATTGG + Intergenic
990464589 5:56060110-56060132 GAAAATGCAGATTCCCAGCCGGG + Intergenic
990844845 5:60125425-60125447 ATAAATGCAGTATTCCAGGCAGG - Intronic
994356766 5:98801569-98801591 GGAAAAGCAGCAGTCCAGCTGGG + Intergenic
994803428 5:104411031-104411053 CTAAATGTAGAATTCTAGTTTGG - Intergenic
996530034 5:124518946-124518968 GTAACTCCATATTTCCAGCTAGG + Intergenic
996856993 5:128019461-128019483 GGAAATACAGGATTCCAGCATGG - Intergenic
997022402 5:130016815-130016837 TTAGATCTAGAATTCCAGCTTGG + Intronic
998979779 5:147689446-147689468 GTCACTGCAAAAATCCAGCTTGG + Intronic
999734667 5:154503953-154503975 GTAACTTCAGCATTCCAGTTTGG - Intergenic
999963278 5:156780086-156780108 GAAAAAGAAAAATTCCAGCTGGG + Intergenic
1001036285 5:168299151-168299173 GTAGATGCAAGAATCCAGCTAGG - Intronic
1001038188 5:168313294-168313316 AGAAATGCAGAATCCCAGCCGGG + Intronic
1002262644 5:178005573-178005595 ATAAATGCAGCATTTCATCTAGG - Intergenic
1002920724 6:1570475-1570497 GTAAACTCAAAATTCCATCTGGG + Intergenic
1003286830 6:4741707-4741729 GGAAATACAGATTTCTAGCTGGG + Intronic
1004133641 6:12945666-12945688 TTAAATGCTGAAGTTCAGCTGGG + Intronic
1007139991 6:39562443-39562465 GAAAATACAGCATTCCAGATAGG + Intronic
1007247434 6:40472591-40472613 GGAAGTGCACAAATCCAGCTCGG - Intronic
1007637714 6:43309195-43309217 TGAAATGCAAAATTCCACCTTGG + Intronic
1009848769 6:69168332-69168354 TTAAAAGCAGAATTCTAGCATGG + Intronic
1012278445 6:97300728-97300750 GTAAATGGAGATCACCAGCTTGG + Intergenic
1012573735 6:100764286-100764308 GTAAATACAGAATTTGAACTGGG + Intronic
1014241795 6:119026314-119026336 GTAAATGAAGGAGTCCTGCTTGG - Intronic
1014385735 6:120799603-120799625 GTAAAAGGAGATTGCCAGCTTGG + Intergenic
1014455313 6:121626720-121626742 CTACATGCCGTATTCCAGCTAGG - Intergenic
1015699806 6:136023345-136023367 GTAAAGGCAAGATTCCAGCTTGG - Intronic
1016407869 6:143749419-143749441 GTAAATGCAAAGTTTTAGCTTGG + Intronic
1016573984 6:145547069-145547091 GAAACTGCAGTATTCCAGCATGG - Intronic
1017586928 6:155936802-155936824 TGAAATGCAGAGTTCAAGCTGGG - Intergenic
1018595558 6:165476879-165476901 GAAAATGCCAAATTCCAGCCAGG - Intronic
1021364803 7:19764219-19764241 TTCAAGGCAGAATGCCAGCTGGG - Intronic
1023960247 7:44920750-44920772 TTAAATAAAGAACTCCAGCTGGG + Intergenic
1024692530 7:51818696-51818718 GTAAATGCATAATTTCAGGCTGG + Intergenic
1028026431 7:85847267-85847289 GTAAATCCAGATTTCCATCTGGG + Intergenic
1028818069 7:95171896-95171918 GTAAATACAGAAGTCCAAATTGG + Intronic
1030654225 7:112148628-112148650 GGAAATGCTAAATTTCAGCTAGG + Intronic
1030876364 7:114817979-114818001 GTAAATGCTAAATTTCAGTTGGG - Intergenic
1031138003 7:117906925-117906947 GTAGATGATGAATTCTAGCTGGG - Intergenic
1034240415 7:149606397-149606419 GGAAATGCAGATTTCCTTCTGGG - Intergenic
1034348887 7:150403954-150403976 GGAACTGAAGAATTCCAGGTGGG - Intronic
1036481272 8:9141731-9141753 GTAAAGGCATCATTCCAGCAGGG + Intronic
1037130908 8:15406792-15406814 CTAAATGGAAAATTCAAGCTGGG + Intergenic
1037497915 8:19458421-19458443 GTTCATGCAGAATTTCAGGTTGG - Exonic
1039486568 8:37914789-37914811 GAAAATGCAAAACTCCAGGTGGG - Intergenic
1041511218 8:58657031-58657053 ATAAAGGAAGAATTCCAGCTAGG - Intronic
1041875688 8:62684264-62684286 GTCAATGCAGATGTCCAGCTAGG + Intronic
1043229410 8:77782298-77782320 GTAAATGAAGATTTCCACCAAGG + Intergenic
1043472195 8:80574047-80574069 GCAAAGGTGGAATTCCAGCTAGG - Intergenic
1043577014 8:81669496-81669518 GCAAGTCCAGAATTCCAGCAGGG - Intronic
1047150272 8:122253043-122253065 TTAAAAGCAGAATCCAAGCTGGG + Intergenic
1050813279 9:9777397-9777419 ATAAATATATAATTCCAGCTAGG + Intronic
1052385906 9:27823530-27823552 GTAAATGCAGAGGACCAGTTAGG + Intergenic
1052596953 9:30573866-30573888 CTAAAAGAAGAAATCCAGCTAGG + Intergenic
1052826556 9:33180306-33180328 CTGAATGCAGCATTCCAGCCGGG + Intergenic
1056144981 9:83720374-83720396 GAAAATTCAGAATTCCACCCTGG - Intergenic
1057766055 9:97920242-97920264 GTAAATCAACAATTCTAGCTAGG + Intronic
1059621193 9:116007435-116007457 TTAAATGCAAACTTCCAGCTAGG + Intergenic
1060853789 9:126898968-126898990 CTAATTGCAGAAACCCAGCTTGG + Intergenic
1061166380 9:128924964-128924986 GTAAATACACAAATACAGCTAGG - Intronic
1061230508 9:129313148-129313170 GTAAATGCTTAAGACCAGCTGGG + Intergenic
1061251639 9:129429717-129429739 TTAATTGCAGAATTCCAGTTAGG - Intergenic
1186565101 X:10654089-10654111 GCAAAGACGGAATTCCAGCTGGG + Intronic
1188059488 X:25583457-25583479 ACAAATGGAGAATTCCAGATGGG + Intergenic
1191739610 X:64422925-64422947 GAAAAGGCAGAATTTCTGCTGGG - Intergenic
1192461870 X:71323926-71323948 AAAAATAGAGAATTCCAGCTGGG - Intergenic
1193619812 X:83738040-83738062 TTACATGCTGAATACCAGCTTGG + Intergenic
1194230490 X:91316854-91316876 GTAAAAGCAGAAATCCAGTAAGG + Intergenic
1195423485 X:104701360-104701382 GCAAAGCCAGAATTCAAGCTCGG + Intronic
1195534026 X:105990447-105990469 CTAAATGGAGAAGTCGAGCTGGG + Intergenic
1195668654 X:107451390-107451412 GTAAATGGCGAACTCCACCTGGG + Intergenic
1196000279 X:110776350-110776372 CTGAATACAGAATTCCAGATTGG + Intronic
1196000287 X:110776496-110776518 CTAAATACAGAATTCCAGATTGG + Intronic
1196392459 X:115222806-115222828 GAAAATGCAGAATGCAAGTTGGG - Intronic
1196411565 X:115425259-115425281 GTAAATGGAGAACTCCAGCTCGG + Intergenic
1198704039 X:139427962-139427984 GTAAATGAAGAACTCCATTTAGG - Intergenic
1199072417 X:143493742-143493764 GTCAATGAAGAATTCCATATGGG - Intergenic
1201737658 Y:17286739-17286761 GCAAATGCAGGTTACCAGCTGGG + Intergenic